ID: 1157986380

View in Genome Browser
Species Human (GRCh38)
Location 18:52442877-52442899
Sequence GGGATCAGGGGTAAAGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157986371_1157986380 6 Left 1157986371 18:52442848-52442870 CCAATGTCTGCAGGGGCCAGGCA 0: 1
1: 1
2: 3
3: 43
4: 345
Right 1157986380 18:52442877-52442899 GGGATCAGGGGTAAAGCAGGTGG 0: 1
1: 0
2: 1
3: 18
4: 250
1157986376_1157986380 -10 Left 1157986376 18:52442864-52442886 CCAGGCAGTCATGGGGATCAGGG 0: 1
1: 0
2: 0
3: 15
4: 222
Right 1157986380 18:52442877-52442899 GGGATCAGGGGTAAAGCAGGTGG 0: 1
1: 0
2: 1
3: 18
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157986380 Original CRISPR GGGATCAGGGGTAAAGCAGG TGG Intronic
900156724 1:1206153-1206175 GGGAGCAGGGGTGAGCCAGGTGG - Intronic
900714077 1:4132961-4132983 GGGCTGAGGGGTAAAGATGGCGG + Intergenic
902644896 1:17791216-17791238 GGGAGCTGGGGACAAGCAGGAGG - Intronic
904395595 1:30219374-30219396 GGGAGCAGGGGGAGAGCAGCAGG + Intergenic
904616032 1:31750395-31750417 GGCACCAGGGGTGAAGCAAGAGG - Intronic
904804408 1:33120615-33120637 GGGCTCAGGACTAAAGCAGAGGG - Intergenic
906108651 1:43309170-43309192 GGGATCAGCTGTGAAGCAGGCGG - Intronic
909531258 1:76684240-76684262 GGGATCAGTGGCAAGGTAGGGGG + Intergenic
913335583 1:117706660-117706682 GGGATCAGGGTTGGAGCAGAAGG - Intergenic
913446636 1:118957322-118957344 TGGATCTGGGGTAGAGCAGTGGG - Intronic
917898517 1:179517221-179517243 GGGAAGTGGGGGAAAGCAGGCGG + Intronic
920193525 1:204211138-204211160 GGGTGCAGGAATAAAGCAGGAGG - Intronic
922043369 1:221919055-221919077 GGAGTAAGGGGTAAAGCAAGAGG - Intergenic
923136883 1:231127740-231127762 GGGAGGAGGGGTAAAGGTGGGGG - Intergenic
923625996 1:235614538-235614560 GGGATCAGGGTTCAGGCAGATGG + Intronic
923813379 1:237345825-237345847 GGGGTCAGGGGAAAAGAATGAGG - Intronic
924457253 1:244228616-244228638 AGGATCAGGGGAAGGGCAGGGGG + Intergenic
924568601 1:245218370-245218392 GGGCTCAGGTGAAAAGCAGAAGG + Intronic
1062961488 10:1576262-1576284 GGGCTCAGGGTCAAAGGAGGGGG + Intronic
1064084912 10:12338209-12338231 GTGAGCAGGGGAAAAGCAGCTGG + Intergenic
1067558087 10:47286088-47286110 GGGATGAGGGGAAAAGAGGGAGG + Intergenic
1067719902 10:48720279-48720301 GGGACCAAGGGAAATGCAGGAGG + Intronic
1067835247 10:49634301-49634323 GGGATGGGCGGTAAAGCAGATGG + Intronic
1068556078 10:58460437-58460459 GGGAGCAGGGAAAAGGCAGGAGG - Intergenic
1074538090 10:114343323-114343345 GTGATCACGAGGAAAGCAGGAGG - Intronic
1075078084 10:119364572-119364594 GGCAGCTGGGGTACAGCAGGAGG - Intronic
1075564772 10:123495225-123495247 AGGATTAGGGGTGAAGAAGGTGG + Intergenic
1076981211 11:205880-205902 GGGATCAGAGGGAAGGCAGAGGG - Intronic
1077025126 11:436690-436712 GTGAGCAGGGGGTAAGCAGGGGG + Intronic
1077025146 11:436745-436767 GTGAGCAGGGGGTAAGCAGGGGG + Intronic
1077025185 11:436877-436899 GTGAGCAGGGGGTAAGCAGGAGG + Intronic
1077224274 11:1433312-1433334 GGGTGCAGGGGTGAAGCAGGAGG - Intronic
1078008071 11:7547533-7547555 GGGAAAAGGGGGGAAGCAGGAGG - Intronic
1079134869 11:17770672-17770694 GGGCTCAGGGCCAGAGCAGGTGG + Intronic
1081673222 11:44953305-44953327 GGGACCAGGGGAGAAGCAGCTGG + Intergenic
1084126455 11:67102283-67102305 GGGATAAGGGATAGAGCAAGAGG - Intergenic
1085656281 11:78318204-78318226 GGGATCAGGAGTGAATCTGGTGG + Intronic
1086048766 11:82564624-82564646 GGGATCAGGGGAAGTGGAGGGGG - Intergenic
1086415726 11:86587271-86587293 AGGACCAGTGGTAAAGGAGGAGG + Intronic
1088810941 11:113391685-113391707 GGTTTCAGGGGAAAATCAGGAGG + Intronic
1090473191 11:126997958-126997980 GGAGGCAGGGGTCAAGCAGGTGG + Intronic
1091229822 11:133981058-133981080 GGGATGAAGGGAGAAGCAGGAGG + Intergenic
1091310892 11:134574508-134574530 GGGAGCTGGGGCCAAGCAGGTGG + Intergenic
1091624456 12:2111506-2111528 GGGATTAAGGGCAATGCAGGGGG + Intronic
1092241754 12:6840095-6840117 GGGGTCAGAGAGAAAGCAGGCGG - Intronic
1092291480 12:7161943-7161965 GGGATCAGGCTTGAGGCAGGAGG + Intergenic
1096559438 12:52425020-52425042 AGGATCAAAGGGAAAGCAGGTGG - Intronic
1096627871 12:52906408-52906430 GGGAGCCTGGGTAAAGCAGGAGG - Intronic
1098104031 12:67050788-67050810 AGGAAAAGGGGTAAAGCAGTGGG - Intergenic
1099661438 12:85568349-85568371 GGGATCAGGTGTAAAGAATCTGG + Intergenic
1099737661 12:86590781-86590803 GCTTTCAGGTGTAAAGCAGGAGG - Intronic
1100354509 12:93816781-93816803 GGGAACGGGGGTGCAGCAGGTGG + Intronic
1101432500 12:104638128-104638150 GGAAGCAGGGGAAAAGGAGGAGG + Intronic
1101802434 12:108034039-108034061 GGAATCGGGGGTAAGGAAGGAGG - Intergenic
1102460502 12:113096961-113096983 CGGACCAGGGGCAAAGCAGGAGG - Exonic
1104764091 12:131315321-131315343 GGGAGCAGGTGGAAAGGAGGAGG + Intergenic
1104874745 12:132026201-132026223 GGACTCAGAGGTGAAGCAGGTGG - Intronic
1105723128 13:23135590-23135612 GGGATCATGGGCAGAACAGGAGG - Intergenic
1106415613 13:29543674-29543696 GGGATCAGAGGTTCCGCAGGAGG + Intronic
1109798545 13:67345973-67345995 AGTATCAGGGGTAAAGAGGGAGG - Intergenic
1110164371 13:72421190-72421212 GGGATCATAGGTAATGTAGGAGG - Intergenic
1110354354 13:74549877-74549899 AGGCTGAGGAGTAAAGCAGGAGG - Intergenic
1111647637 13:91050466-91050488 GGGATTAGGGGAAAACAAGGTGG + Intergenic
1112199614 13:97262020-97262042 AGGGTCAGGGGAGAAGCAGGTGG + Intronic
1113456863 13:110455465-110455487 GGGAACAGGGGAAAAGCAGCAGG - Intronic
1113783583 13:112990066-112990088 GTGAACAGGGGGTAAGCAGGAGG - Intronic
1113789300 13:113019108-113019130 GGGAGAAGGGGCAAGGCAGGAGG - Intronic
1114688914 14:24562232-24562254 GGGAGCAGGAGCAAGGCAGGAGG - Intergenic
1114990994 14:28289596-28289618 GGGAACATGGATAAAGCTGGAGG - Intergenic
1116031881 14:39583560-39583582 GGGATGTGGGGCAAAGCTGGAGG - Intergenic
1118427988 14:65688251-65688273 GGGTTAAGGGGCAAGGCAGGTGG - Intronic
1119691791 14:76678783-76678805 GGGAGCAGGGCTAGAGTAGGGGG + Intergenic
1122628287 14:103095377-103095399 GGGATCAGGCCCACAGCAGGAGG + Intergenic
1125503232 15:40252394-40252416 GGGAACTGGGGCCAAGCAGGTGG + Exonic
1126218634 15:46186225-46186247 GGAAACAGGGGTGAAGGAGGTGG - Intergenic
1128829224 15:70751312-70751334 AGGAAAAGGGCTAAAGCAGGTGG + Intronic
1128916386 15:71566734-71566756 GGGAGCAGGGGGAAAGAGGGGGG - Intronic
1129153304 15:73702654-73702676 GGGAGCAGTGGTGCAGCAGGGGG - Intronic
1129356999 15:74997903-74997925 GGGATTGGAGGTAGAGCAGGAGG + Intronic
1131705399 15:94990168-94990190 GGAATCAGGGGTTAAGGAAGGGG + Intergenic
1132697185 16:1207257-1207279 AGGATCTGGGGGATAGCAGGGGG - Exonic
1132743175 16:1426093-1426115 GGGTTCTGGGGTAGAACAGGTGG - Intergenic
1133768979 16:8856831-8856853 AGGATCAGAGGTGAAGCATGGGG + Intronic
1133833397 16:9344985-9345007 GGGAACAGTGGAAAAGCAGAAGG + Intergenic
1136086745 16:27890672-27890694 TGGAACAGTGCTAAAGCAGGAGG + Intronic
1142046035 16:87925855-87925877 GGGAGCAGGGGTTAAATAGGAGG - Intronic
1144481116 17:15629842-15629864 TAGGTCGGGGGTAAAGCAGGGGG - Intronic
1144917193 17:18733895-18733917 TAGGTCGGGGGTAAAGCAGGGGG + Intronic
1145193875 17:20869668-20869690 GGGATAAGGGGAAAAGAGGGTGG + Intronic
1145298160 17:21611503-21611525 GGGATAAGGGGAAAAGAGGGTGG - Intergenic
1145722601 17:27088072-27088094 GGGATAAGGGGAAAAGATGGTGG - Intergenic
1145799717 17:27675150-27675172 GGGAGCAGGTGTCAATCAGGAGG - Intergenic
1146769193 17:35553037-35553059 AGGACCTGGGGTAACGCAGGGGG + Exonic
1147034633 17:37670979-37671001 GGGAGAAGGGGTGAAGCATGGGG - Intergenic
1147568453 17:41552161-41552183 GGGGTCAGGGGTGCAGAAGGAGG + Intergenic
1147636646 17:41967997-41968019 GGGACTAGGGGTAAGGCCGGCGG + Intronic
1147947008 17:44086111-44086133 GGCAGGAGGGGGAAAGCAGGAGG - Intronic
1151060731 17:71090715-71090737 AGGAACATGGGTAAAGCTGGAGG - Intergenic
1151693258 17:75700513-75700535 AGGATCAAAGGTGAAGCAGGTGG - Intronic
1157946082 18:51982332-51982354 GACAGCAGGGGTTAAGCAGGTGG + Intergenic
1157986380 18:52442877-52442899 GGGATCAGGGGTAAAGCAGGTGG + Intronic
1158619632 18:59021449-59021471 GGGTCCAGGGGTAAAGATGGTGG + Intergenic
1161354485 19:3811244-3811266 GGGGGCAGGGGTGGAGCAGGGGG - Intronic
1162054767 19:8055974-8055996 GGGATAAGGGGTGAGCCAGGAGG + Intronic
1163421439 19:17215694-17215716 GGGGTCAAGCGTAAAGGAGGCGG - Intronic
1165053888 19:33161380-33161402 GGGAACAGGGGCACAGCATGAGG - Intronic
1165098215 19:33421948-33421970 GGGACAAGGGCTGAAGCAGGGGG - Intronic
1165355973 19:35304292-35304314 GGGATCAGGGGACAACCAGAGGG - Intronic
1165434294 19:35787990-35788012 GTGGTCAGGGGGAAAGCAGGAGG - Exonic
1165817419 19:38650533-38650555 TGGAGGAGGTGTAAAGCAGGAGG - Intronic
1165957229 19:39508664-39508686 GAGATCAGTGCTGAAGCAGGAGG + Intergenic
1166644968 19:44524934-44524956 GGGGTCAGGGGTAAAGAGGGAGG - Intronic
1167151649 19:47713599-47713621 GGGAGCAGGGGTCAGGCATGAGG - Intronic
925901405 2:8511782-8511804 GGGCCCAGGGGAAAAGGAGGTGG - Intergenic
926210163 2:10863331-10863353 GGGAGCAGGTGTCCAGCAGGTGG + Intergenic
926681731 2:15669196-15669218 TGGATCAGGGGTGGAGTAGGGGG + Intergenic
927779012 2:25924502-25924524 GGGATCACCTGTACAGCAGGTGG - Intergenic
928670473 2:33598826-33598848 GGGTTAAGGGGTAGGGCAGGAGG + Intronic
932757193 2:74417065-74417087 GGGATCATGGGCAGAACAGGAGG + Intronic
934606931 2:95702580-95702602 GGGGTCAGGGAAAAGGCAGGAGG + Intergenic
934654225 2:96108914-96108936 GGGGTCAGGGGATCAGCAGGAGG + Intergenic
934856383 2:97732814-97732836 GGGAACCGGGGCACAGCAGGAGG + Intronic
935532528 2:104252687-104252709 GGGTTCAGAGGGAAGGCAGGAGG + Intergenic
936540324 2:113344704-113344726 GGGGTCAGGGAAAAAGCAGGAGG + Intergenic
936913616 2:117617148-117617170 GGGAGCATAGGTACAGCAGGTGG + Intergenic
938380242 2:130832329-130832351 GGCCCCAGGGGTGAAGCAGGAGG - Intergenic
939110741 2:138003835-138003857 GGGATCCAGGGTTAAGCAGAGGG - Intronic
939191159 2:138917961-138917983 AGGTTCAGGGAGAAAGCAGGAGG - Intergenic
939966679 2:148617088-148617110 GGGAAAAGGGGTAAAGGTGGCGG + Intergenic
942417271 2:175772502-175772524 TGGAGCAGGGGCAAAGGAGGAGG + Intergenic
942937500 2:181575617-181575639 GGGATGAGGGGTAATGAGGGAGG - Intronic
944666080 2:201960902-201960924 GGCAGCATGGGTAAAGCAGTGGG - Intergenic
945199995 2:207271965-207271987 GGGATGATGGGGAAAGCAGTCGG + Intergenic
946032267 2:216714577-216714599 GAGATCAGGGGTCAGGCAGGTGG + Intergenic
946310232 2:218879143-218879165 GAGATGAGGGGGAAAGGAGGGGG + Intergenic
946959300 2:224966927-224966949 GGTATCAGGGATAAAGGAGGCGG + Intronic
947735350 2:232451773-232451795 GGGGGCAGGGGTGAAGGAGGTGG + Intergenic
948244834 2:236471921-236471943 GGGCTCAGGGGACAAACAGGAGG + Intronic
948808361 2:240462654-240462676 GGGCACAGGGTTAAAGTAGGGGG - Intronic
1169924049 20:10764933-10764955 GGATGCAGGGGAAAAGCAGGCGG + Intergenic
1171147306 20:22796199-22796221 GGGATCATCAGTAAAGCAAGTGG + Intergenic
1171562433 20:26137180-26137202 GGGATAAGGGGAAAAGACGGTGG + Intergenic
1172589096 20:36105101-36105123 GGGATGTGGGGGAAATCAGGGGG + Intronic
1172608868 20:36234614-36234636 GGGGTTGGGGGTAAAGGAGGAGG - Intergenic
1172862224 20:38063501-38063523 GGGCTCAGGAGGAGAGCAGGTGG + Intronic
1173629454 20:44500337-44500359 GGGTCCAGACGTAAAGCAGGAGG + Exonic
1176944316 21:14959626-14959648 GGCAACAGAGGGAAAGCAGGTGG + Intergenic
1176965350 21:15206341-15206363 GGGATGAGAGGTAAGGGAGGTGG + Intergenic
1178095798 21:29213539-29213561 GGTTGCAGGGGCAAAGCAGGTGG - Intronic
1178483847 21:33004610-33004632 GGGATAAGGGGTAAGGGAGAAGG - Intergenic
1179181083 21:39045758-39045780 GGTCTCAGGGGGAAGGCAGGCGG + Intergenic
1179719610 21:43307685-43307707 GGGATAAGGGGCTAAGGAGGGGG + Intergenic
1180871918 22:19151005-19151027 GGGACCAGTGGGAAAGCTGGAGG - Intergenic
1181099601 22:20530581-20530603 GGGAGCAGTGGTAAAGAGGGTGG + Intronic
1181672937 22:24434198-24434220 AGGATCTGGGGGAAGGCAGGTGG - Intronic
1181907020 22:26206287-26206309 GGAATTGGGGGTAAAGGAGGTGG - Intronic
1182290481 22:29274559-29274581 GGGAACAGGGGAAAATCAGCTGG - Intronic
1182656956 22:31898277-31898299 GGGCTCTGGGGTAGAGCAGCAGG - Intronic
1184115143 22:42417796-42417818 GGGAGGAGGGGTGGAGCAGGAGG + Intronic
1184279580 22:43429330-43429352 GGGACAAGGAGCAAAGCAGGTGG + Intronic
1184309381 22:43631422-43631444 GGGCTCTGGGGAAAAGCATGTGG - Intronic
1185046396 22:48530726-48530748 GGGGTCAGGTGTGAACCAGGTGG - Intronic
1185116570 22:48941440-48941462 GGGATCTGGGGTTGAACAGGTGG + Intergenic
950909771 3:16576699-16576721 GGGGTCAGGGGAAGAGTAGGTGG - Intergenic
954900621 3:54016199-54016221 GGGAGAAGGGGGAAAGCAGAAGG + Intergenic
955506951 3:59641886-59641908 GGGGCCAGGGGTACAGAAGGTGG + Intergenic
960219887 3:115094015-115094037 GGGTACAGGGGTAAAGCTGAGGG - Intronic
960377382 3:116920040-116920062 GGGATTATGGGTAAAGCTGTAGG + Intronic
960970064 3:123132944-123132966 GGGATCAGGGCAAAAGCATGTGG + Intronic
962449669 3:135502491-135502513 GGCATCAGGATTAATGCAGGTGG + Intergenic
963958164 3:151278596-151278618 GGGATGTGGGGAAAAGTAGGAGG - Intronic
964743067 3:159987950-159987972 GGGGTCAGGAGTAGAGCAGAGGG - Intergenic
966956056 3:184880324-184880346 GGTATCAGAGGTTAAGGAGGGGG - Intronic
967070982 3:185962036-185962058 GGCATGAGGGGGAAAGCAGTGGG - Intergenic
967080957 3:186048907-186048929 GGGATCAGGGGAAGAGAACGAGG + Intronic
967988162 3:195111443-195111465 GGGAGCAAGGGGAAAGGAGGTGG + Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
969617494 4:8262189-8262211 TGGGGCAGGGGTGAAGCAGGGGG + Intergenic
975094488 4:70442400-70442422 GGGATGAGAGGAGAAGCAGGTGG - Intronic
976927791 4:90522998-90523020 AGGAGCAGGGGTAAAGAGGGGGG - Intronic
978886579 4:113772597-113772619 GGGGTCAGGGGGAGGGCAGGGGG - Intergenic
984954672 4:185033516-185033538 GGGATCGGGAGGAGAGCAGGTGG - Intergenic
985666403 5:1183631-1183653 GGGAAGAGGGGGAGAGCAGGTGG + Intergenic
986279900 5:6314428-6314450 GAGCTCAGGGGGAAAGCAGGGGG - Intergenic
986839203 5:11676416-11676438 GGGGGCAGGGGTTAAGGAGGAGG + Intronic
987946575 5:24617232-24617254 GTGATCGGGGCAAAAGCAGGAGG - Intronic
988445847 5:31284912-31284934 TGGATCAGGAGCAAAGCAGGAGG + Intronic
990086769 5:51987995-51988017 GGGTTCAGTGGTTAAGCAGGTGG + Intergenic
990890803 5:60647507-60647529 GGTTTCAGGGGTGAAGAAGGAGG + Exonic
995334135 5:110979387-110979409 GGGACCAGGAGCAAAGCATGGGG - Intergenic
996619856 5:125487338-125487360 TGAACCAGGGGTAAAGCAGTAGG - Intergenic
996858249 5:128034491-128034513 GGGATCATGGATAGAGCTGGAGG + Intergenic
997199254 5:131999842-131999864 GGGGTGAGGGGAAAAGCAGGGGG - Intronic
998128977 5:139641631-139641653 GGGATCAGGGGATATGAAGGGGG + Intergenic
998674530 5:144392202-144392224 GGAATCAGGAGCAATGCAGGGGG + Intronic
998839422 5:146237390-146237412 AGGTTCTGGGGTAAAGGAGGAGG - Exonic
999057287 5:148592083-148592105 GGGAACATGGATAAAGCTGGAGG + Intronic
1000258063 5:159559860-159559882 GGGGTCAGGGGGAATGGAGGAGG - Intergenic
1001018814 5:168165514-168165536 GGGATCAGGGGTAGGGCTGGTGG - Intronic
1002191463 5:177480054-177480076 AGCATCAGGGGTCAAGCAGATGG - Intergenic
1002995599 6:2281099-2281121 AGGATCAAGAGTAAATCAGGAGG - Intergenic
1005808106 6:29494007-29494029 GGGGGCAGGGGTAAGTCAGGGGG + Intergenic
1005958442 6:30680342-30680364 GGGATTAGGGAGACAGCAGGAGG + Intronic
1006248540 6:32761474-32761496 GGGATCTAGGGCAGAGCAGGGGG - Intronic
1006310171 6:33251813-33251835 GGGATCAGTGGTAAGGGAAGTGG - Intronic
1006599562 6:35216418-35216440 GGGATCAGAAGAAAAGAAGGAGG - Intronic
1007776055 6:44224984-44225006 GAGAGCAGGGGTGTAGCAGGGGG + Intronic
1008011355 6:46471120-46471142 GGGTTCAGAGGAAAAGCAGATGG + Intronic
1010057807 6:71585986-71586008 CAGATCAGGGGAAGAGCAGGGGG - Intergenic
1010168862 6:72951042-72951064 GGGATCTGGGAAAAGGCAGGAGG - Intronic
1010272415 6:73929310-73929332 GGGATTAGGGGAGAAGTAGGTGG + Intergenic
1011561499 6:88621878-88621900 GGGATAAGGATTAAAGCAGAGGG - Intronic
1011603478 6:89081009-89081031 GGGATCCGGGGTAAAGGAGGCGG - Exonic
1014300645 6:119677353-119677375 AGGAATAGGGGAAAAGCAGGGGG - Intergenic
1016017555 6:139201428-139201450 GTTATAAGGGTTAAAGCAGGAGG - Intergenic
1017002678 6:150006675-150006697 GGCAGCAGGGGTGAGGCAGGAGG - Intergenic
1017093035 6:150778674-150778696 GGTTACAGGGGTAAAGAAGGTGG - Intronic
1018765882 6:166932389-166932411 GGGCTCAGGGGCAGAGCAGGAGG - Intronic
1018844725 6:167547565-167547587 GGGATGAGGAGTAAGGAAGGAGG - Intergenic
1020570420 7:9853124-9853146 GGAATGAGGGGCAAAGCACGAGG + Intergenic
1021025144 7:15657881-15657903 GGAATGAGGGGCAAGGCAGGTGG + Intronic
1021852061 7:24817980-24818002 GAAATCAGGGTTGAAGCAGGGGG + Intronic
1022035600 7:26531293-26531315 GGGAGCTGGGGGAAAGGAGGTGG - Intergenic
1023275133 7:38510706-38510728 GAGAGCAGGGGTCAAGCTGGTGG - Intronic
1026776031 7:73231630-73231652 GGGATCTGGGATGGAGCAGGAGG + Intergenic
1027016888 7:74785001-74785023 GGGATCTGGGATGGAGCAGGAGG + Intronic
1027071139 7:75160935-75160957 GGGATCTGGGATGGAGCAGGAGG - Intergenic
1028224533 7:88234340-88234362 GGGGTGAGGGGTGAAGAAGGGGG - Intergenic
1032879446 7:136073858-136073880 GGGATGAGGGGTGGAGCAGAGGG - Intergenic
1035372115 7:158386330-158386352 GGGAGGAGGGGTACAGAAGGAGG - Intronic
1035565438 8:637709-637731 GGGAGCAGGAGGAAAGCTGGGGG + Intronic
1036126485 8:6067759-6067781 GGGAAGAGGGGTTAAGCAGCTGG - Intergenic
1036690409 8:10941357-10941379 GGGGTCAGGGCAGAAGCAGGAGG - Intronic
1037114353 8:15205934-15205956 GGGAACATGGGTGAAGCTGGAGG + Intronic
1041029567 8:53723332-53723354 GGGATCAGGGGTGAGGAGGGTGG - Intronic
1041073036 8:54143749-54143771 GGGAGCAGGGGAACACCAGGAGG - Intronic
1041747871 8:61229362-61229384 GGGAACAGAGGTAAAGCATTTGG - Intronic
1046455612 8:114456184-114456206 GGGATAAGGGGGAAAGGAAGTGG - Intergenic
1046872650 8:119220718-119220740 GGGCTATGGGGTAAAGCAGAGGG - Intronic
1048296645 8:133219453-133219475 GGGAATAGGGTTAAATCAGGTGG - Intronic
1051318950 9:15878825-15878847 GGGAACATGGATAAAGCTGGAGG + Intronic
1057911133 9:99021361-99021383 GGGCTCTGGGGTGTAGCAGGAGG + Intronic
1058402669 9:104636228-104636250 GGGATCAGCTGGAAACCAGGAGG + Intergenic
1059381990 9:113934003-113934025 GGGAGCAGGGGTTGAGCTGGTGG + Intronic
1060254249 9:122013340-122013362 GGCAGCAGGGGTATAGGAGGTGG + Intronic
1060606448 9:124918853-124918875 AGGATCAGGAGGACAGCAGGAGG - Intronic
1060838377 9:126775516-126775538 GGGATCAGGGATGAACCAGCTGG - Intergenic
1061368230 9:130183434-130183456 GGGAGCAGGGGGAGGGCAGGAGG + Intronic
1061887639 9:133600595-133600617 GGGAGCAGGGGTAAAACCAGAGG + Intergenic
1062030243 9:134358892-134358914 GGGCTCAGGGGAAGGGCAGGCGG + Intronic
1062578857 9:137221051-137221073 GGGAGCAGGCGGGAAGCAGGGGG + Exonic
1185545287 X:938450-938472 GAGGTCAGGAGTAAAGCATGGGG + Intergenic
1186384239 X:9092889-9092911 GGGATCAGGGATTTGGCAGGGGG + Intronic
1187035732 X:15537598-15537620 GGTATGAGGGGAGAAGCAGGAGG - Intronic
1187581752 X:20614640-20614662 GGGATCAGGAGTGAAGGAGCAGG - Intergenic
1187965745 X:24609730-24609752 AGAATCAGGGGTGAAGAAGGTGG + Intronic
1188156662 X:26749412-26749434 GGGATCATGGGCAGAACAGGAGG - Intergenic
1189010732 X:37043588-37043610 GGGAGGAGGGGAAAAGCAGTGGG + Intergenic
1189035671 X:37491967-37491989 GGGAGGAGGGGAAAAGCAGTGGG - Intronic
1190004309 X:46720445-46720467 GGAATCAGGGGAGAAGCAGGGGG - Intronic
1191060078 X:56285841-56285863 GGGGTCAGGGGTAGGGGAGGGGG + Intronic
1191715224 X:64189809-64189831 GGGATCAGGGGTTGGGCAGAAGG - Exonic
1191720325 X:64223597-64223619 GGCTTCAGGGGTAAGGGAGGAGG - Intergenic
1192204971 X:69089568-69089590 GGCCTCTGGGGCAAAGCAGGGGG + Intergenic
1195698839 X:107686604-107686626 GGCATCCGGGGAGAAGCAGGAGG + Intergenic
1196030502 X:111091179-111091201 GGGAACAGGGCAAAAGCTGGGGG + Intronic
1198496241 X:137196341-137196363 GGGTTCAAGGAAAAAGCAGGTGG + Intergenic
1199912265 X:152299425-152299447 GGGATAAGCGGGGAAGCAGGGGG + Intronic
1201234012 Y:11892770-11892792 GGTATCAGGAATAATGCAGGAGG + Intergenic
1201636239 Y:16126237-16126259 GGCATCAGGGGTACAGGAAGAGG - Intergenic