ID: 1157988362

View in Genome Browser
Species Human (GRCh38)
Location 18:52465561-52465583
Sequence TTCACAATAGATCCCCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157988352_1157988362 30 Left 1157988352 18:52465508-52465530 CCACTGAATGCCTAAAGTTTTGT 0: 1
1: 0
2: 1
3: 19
4: 159
Right 1157988362 18:52465561-52465583 TTCACAATAGATCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 136
1157988361_1157988362 -1 Left 1157988361 18:52465539-52465561 CCTCAGGGACTTGGACTTGGGCT 0: 1
1: 0
2: 3
3: 24
4: 203
Right 1157988362 18:52465561-52465583 TTCACAATAGATCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 136
1157988354_1157988362 20 Left 1157988354 18:52465518-52465540 CCTAAAGTTTTGTGGAGATGCCC 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1157988362 18:52465561-52465583 TTCACAATAGATCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 136
1157988360_1157988362 0 Left 1157988360 18:52465538-52465560 CCCTCAGGGACTTGGACTTGGGC 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1157988362 18:52465561-52465583 TTCACAATAGATCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157988362 Original CRISPR TTCACAATAGATCCCCAAAG AGG Intronic
903505797 1:23834919-23834941 TTCACAACAGATCACAAAAAAGG + Intronic
904453958 1:30635822-30635844 TCCTCAACAGATCCCCAAAGAGG + Intergenic
906472868 1:46145689-46145711 TTGAAAATTGATCCCCAACGTGG - Intronic
908015641 1:59831326-59831348 TTCACTAAAGACCCCCAAAAAGG - Intronic
908480296 1:64533041-64533063 TTCCCAACAGAGCCCCAAAGAGG + Intronic
913489161 1:119362629-119362651 TTCATAATAGCCCCCCAAACTGG + Intergenic
915679927 1:157571465-157571487 TGCACAATAAATCCCCAAAAAGG - Intergenic
917757638 1:178118564-178118586 ACCACAAAAGATCCCCAAACTGG - Intronic
919400779 1:197113816-197113838 TTCACAAAAGATTTCCAAAATGG + Intronic
921155356 1:212434119-212434141 TTCACAAATGATGCCCAAACTGG - Intronic
923906615 1:238392024-238392046 TTCCCAAAAGAGTCCCAAAGGGG - Intergenic
924379704 1:243451022-243451044 TTCAAAATATATCCCCTAAGGGG + Intronic
1063499160 10:6537542-6537564 TTCAGAATAGATCCCGAGAAAGG - Intronic
1064374087 10:14779965-14779987 ATCAGAATAAATCCCCAAACGGG + Intergenic
1064568372 10:16667239-16667261 TTCATTATAGGTACCCAAAGGGG + Intronic
1065523618 10:26595497-26595519 TTTACAGTAGGTCCTCAAAGAGG + Intergenic
1065529695 10:26655856-26655878 TTTACAGTAGGTCCTCAAAGAGG + Intergenic
1065557244 10:26929080-26929102 TTTACAGTAGGTCCTCAAAGAGG - Intergenic
1065940292 10:30558272-30558294 TTCACAATGAATCCATAAAGTGG - Intergenic
1068587593 10:58816623-58816645 TTCAGGAGAGATCCCCAAAGAGG - Intronic
1071192334 10:83115839-83115861 TTCTCAGAAGATCCCCCAAGTGG + Intergenic
1071913463 10:90263075-90263097 TTGACCTTAGATCCCCAATGTGG + Intergenic
1072839198 10:98751748-98751770 TTCCCCATAGTTCCCCAAGGGGG + Intronic
1075563241 10:123483578-123483600 TTTTAAATAGATCACCAAAGTGG - Intergenic
1076388594 10:130077642-130077664 TTAACAATAAATCACCAATGGGG - Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079663344 11:23070465-23070487 TTCACAATAAATACCCAGGGAGG + Intergenic
1081124463 11:39305897-39305919 ATCCTAATATATCCCCAAAGAGG + Intergenic
1081253041 11:40859054-40859076 ATCAAAATAGATCCCAAAAGAGG + Intronic
1081797835 11:45833941-45833963 TTGACAACAGATGCCCAATGTGG + Intergenic
1082686098 11:56241447-56241469 TTTCCAATAGATCTCCAAAGTGG - Intergenic
1083413435 11:62509606-62509628 TCAACAATTGAACCCCAAAGAGG + Intronic
1084558800 11:69891183-69891205 TTCTCAATAGCCCCACAAAGGGG + Intergenic
1089818271 11:121197027-121197049 TTCCAGGTAGATCCCCAAAGAGG + Intergenic
1095128060 12:38505622-38505644 ATCACAAGACATCTCCAAAGTGG + Intergenic
1095743353 12:45630832-45630854 TCCACAATAGATACCACAAGTGG + Intergenic
1099971540 12:89505245-89505267 TTCAAAATAGATTTTCAAAGTGG - Intronic
1100332613 12:93598909-93598931 TTCAAAATTGCTCTCCAAAGAGG + Intergenic
1103589834 12:121983759-121983781 TTCAGAAAACATCTCCAAAGAGG - Intronic
1104270646 12:127279835-127279857 TTCACAAAAGACCCCAGAAGGGG + Intergenic
1109988200 13:70017304-70017326 TGGACCATAGAGCCCCAAAGAGG - Intronic
1111386370 13:87533953-87533975 TGGAAAATAGATCCACAAAGTGG + Intergenic
1114173627 14:20299493-20299515 TTCAGAATAGATCTGGAAAGGGG - Intronic
1117786768 14:59293886-59293908 CTCAGAATAGAGCCCCATAGTGG + Intronic
1120323914 14:83001648-83001670 TTTATTATAGATCCCCAAAAGGG - Intergenic
1121041745 14:90755133-90755155 TTCTTCATACATCCCCAAAGTGG - Intronic
1121796244 14:96737961-96737983 TTCCCAATAGCTGACCAAAGAGG - Intergenic
1124857763 15:33407226-33407248 TTGACACTTGATCCCCACAGTGG - Intronic
1129972073 15:79787530-79787552 TTCCCCATAGAGCCCAAAAGAGG - Intergenic
1130197703 15:81796161-81796183 TTCAGAATATGTCCCCAAAATGG + Intergenic
1131309939 15:91281208-91281230 TGCAAAATTGCTCCCCAAAGAGG + Intronic
1131830384 15:96351254-96351276 TTCACAATCGATCCCCTAATAGG - Intergenic
1132335143 15:101043354-101043376 TACAAAATAAAACCCCAAAGAGG + Intronic
1136495440 16:30640540-30640562 TTCACAAAACAACCCCTAAGGGG + Intergenic
1138507221 16:57484422-57484444 CTCCCAACAGATCCCCATAGGGG + Intronic
1141020612 16:80492584-80492606 TTGACAAGAGATCCCCAAGAAGG - Intergenic
1141538352 16:84699587-84699609 TTCGCATTAGATCCCCGAGGAGG - Intergenic
1141854423 16:86671366-86671388 TTCAAAATAGATGCCCCAACTGG - Intergenic
1143345362 17:6245137-6245159 TTCAAAAAAGATCTCCAAAGGGG + Intergenic
1144525734 17:15988510-15988532 TTGCCAATAGCTCTCCAAAGTGG + Intronic
1149459887 17:56819829-56819851 TTCCCAATAAATCCACAAGGTGG + Intronic
1157513222 18:48293565-48293587 TTCAAAATGGCTCCCCAAATAGG + Intronic
1157988362 18:52465561-52465583 TTCACAATAGATCCCCAAAGAGG + Intronic
1164933935 19:32196748-32196770 GTCAGCATAAATCCCCAAAGAGG + Intergenic
927234046 2:20853623-20853645 TTCACAATAGATTTGCAAAGCGG - Intergenic
927527729 2:23762560-23762582 TTTACACTTAATCCCCAAAGGGG + Intronic
930291812 2:49503619-49503641 TTCCCAAGAGATCCACCAAGTGG + Intergenic
930463604 2:51715416-51715438 TTCACATTACAGCCCCAAAATGG + Intergenic
931962273 2:67495172-67495194 TTAAAAATTGACCCCCAAAGTGG + Intergenic
934090787 2:88548870-88548892 TAAAGAATAGATTCCCAAAGTGG + Intergenic
936288670 2:111200895-111200917 TTCACACCAGTTGCCCAAAGAGG - Intergenic
939075125 2:137591106-137591128 TTGAAAATAGATTACCAAAGGGG - Intronic
939600779 2:144187508-144187530 TTGAAATTAGATCCCCAATGTGG - Intronic
940325108 2:152417049-152417071 TTCACTACAGATACCCACAGAGG - Intronic
943669417 2:190646121-190646143 TTAACAAAAGATATCCAAAGTGG + Intergenic
945620532 2:212131138-212131160 TTCAAAATACATCCCCAAATGGG + Intronic
946490918 2:220148048-220148070 TTCAGAATAGCCCCACAAAGAGG - Intergenic
1169700749 20:8443883-8443905 GTCACAATAGCACCCCACAGTGG + Intronic
1172501806 20:35433022-35433044 TCCAAAATAGATCCCTAAAAGGG - Exonic
1177271647 21:18856414-18856436 TTTATAATAAATCACCAAAGAGG + Intergenic
1177273349 21:18876549-18876571 ATCACACTGGTTCCCCAAAGAGG - Intergenic
1177376575 21:20278262-20278284 TTTATAATAGATGCCCAAACAGG + Intergenic
1178114464 21:29403406-29403428 TGCAAAATTGATCTCCAAAGTGG - Intronic
1178534670 21:33402434-33402456 TTCAAAATAGTTCTACAAAGAGG + Intergenic
1179660392 21:42870859-42870881 TTCACATGAGATTCTCAAAGGGG - Intronic
1181020691 22:20100646-20100668 TTCACAGAAGAACCCCAGAGTGG - Intronic
1181680648 22:24494246-24494268 TTCTCAATAGGACCCCAAAGAGG + Intronic
1182051963 22:27319515-27319537 TGAAAAATAGATCTCCAAAGTGG + Intergenic
956691854 3:71885811-71885833 TTCTCAATAGAACCCCATGGTGG + Intergenic
957039399 3:75325834-75325856 TTCTCAATAGATCTGGAAAGAGG - Intergenic
957482625 3:80817925-80817947 TTCACAATAGCCACGCAAAGAGG + Intergenic
959556602 3:107726651-107726673 TTCACAATGGATCTGCAAAAGGG - Intronic
959930457 3:111976696-111976718 TTGACAATAGGTACCCAGAGTGG + Intergenic
961072069 3:123941533-123941555 TTCCAAATAGATTACCAAAGTGG + Intronic
962006082 3:131351435-131351457 TTGAAATTTGATCCCCAAAGTGG - Intergenic
962029261 3:131582259-131582281 GACACAGTAGATCTCCAAAGGGG + Intronic
964406746 3:156356472-156356494 GGGACAATAGAACCCCAAAGAGG + Intronic
965350474 3:167606223-167606245 TTCTCATCAGATTCCCAAAGGGG - Intronic
966649164 3:182280201-182280223 CACACAATAGTTCCCCAAGGTGG + Intergenic
969037476 4:4266352-4266374 GACACAATAGATCCCCTCAGTGG - Intergenic
969459326 4:7320366-7320388 TGGACAATGGATCCCCACAGAGG + Intronic
972952102 4:44340125-44340147 TTCAAAATAGATTTCCAAAGTGG - Intronic
975879164 4:78882071-78882093 TTCAAAATAAAACCCCAAATGGG - Intronic
976005736 4:80428164-80428186 ATCAGAATAGATACCAAAAGAGG - Intronic
976143180 4:82014527-82014549 TGCACAATAGAGTTCCAAAGAGG + Intronic
976540222 4:86265539-86265561 TTCACTATTAAACCCCAAAGTGG + Intronic
980551556 4:134342959-134342981 TGCACAATAAATCTGCAAAGTGG - Intergenic
980644761 4:135629140-135629162 TTCACAATAGCTGCAAAAAGTGG - Intergenic
984580841 4:181508363-181508385 TTCACACTGGAACTCCAAAGAGG + Intergenic
986535933 5:8787109-8787131 TTCAAAATAAAGCCCCAAAATGG + Intergenic
986781122 5:11066593-11066615 TTCAGAATATGTGCCCAAAGTGG - Intronic
987380781 5:17283874-17283896 ATCCCAGTAGATTCCCAAAGAGG - Intergenic
990311998 5:54549144-54549166 CTCACAATATGTCCACAAAGGGG - Intergenic
991466249 5:66915416-66915438 TTCTGAAAACATCCCCAAAGAGG - Intronic
993268160 5:85755699-85755721 TTCACAATACATAAACAAAGCGG - Intergenic
995504795 5:112848947-112848969 TTCACAAGTGCTCCCCAAACCGG - Intronic
995504929 5:112850401-112850423 TTCACAAGTGTTCCCCAAACTGG - Intronic
995726351 5:115184732-115184754 TTGACAATAGGTCCACAAATAGG + Intergenic
997349211 5:133218271-133218293 TTCACAATATATCCAGAAATAGG + Intronic
997698405 5:135879496-135879518 TTCACAGGACATCCCAAAAGTGG - Intronic
999315154 5:150578943-150578965 CTCACAATAGAGCACCAAGGTGG + Intergenic
1001947497 5:175792338-175792360 TCCCAAATAGTTCCCCAAAGTGG - Intergenic
1005976501 6:30804125-30804147 TTCACACAAGAACCCCAGAGGGG - Intergenic
1011731465 6:90268359-90268381 TTCAGAACATATCCTCAAAGTGG - Intronic
1012534228 6:100276641-100276663 TTAAGCATACATCCCCAAAGGGG + Intergenic
1013661442 6:112300864-112300886 TTTAAAATATATGCCCAAAGAGG + Intergenic
1014380259 6:120731680-120731702 TTCAAAATTGTTTCCCAAAGTGG - Intergenic
1017344178 6:153360243-153360265 TTCAAAATAGTACCCCAACGTGG - Intergenic
1017944738 6:159086302-159086324 TTCACAAAAGAGTCCCAAGGTGG - Intergenic
1021831669 7:24618555-24618577 TTCACAGCAGCTCCCCAAACTGG + Intronic
1024427901 7:49249086-49249108 TTCTCAATAGATTTCCAAATTGG + Intergenic
1031019297 7:116609704-116609726 TTCAAACGTGATCCCCAAAGTGG + Intergenic
1041003294 8:53472742-53472764 TGCAAAAGACATCCCCAAAGAGG - Intergenic
1041450340 8:57999697-57999719 TACACAATAAAGCCTCAAAGAGG - Intronic
1042501531 8:69514584-69514606 TTCCCAATAGCCCCCTAAAGTGG + Intronic
1042606331 8:70550346-70550368 TTCACATGAAATCCACAAAGTGG - Intergenic
1045917107 8:107485377-107485399 TTCTCCATAGAGACCCAAAGAGG - Intronic
1046497224 8:115030836-115030858 TTCACTAGAAATCCCCAAAAGGG + Intergenic
1050862446 9:10451197-10451219 TTCAAAATAGAGCCTCAAATTGG - Intronic
1055037004 9:71828447-71828469 TTTACAATAGATTTTCAAAGTGG + Intergenic
1058983949 9:110194970-110194992 TTGACTCTAGCTCCCCAAAGAGG + Intronic
1186903127 X:14079852-14079874 CTAATAATAGATCCCCAAAATGG + Intergenic
1190973954 X:55381093-55381115 TTAACAAGAGGTCCTCAAAGGGG + Intergenic
1191114116 X:56833779-56833801 TTCACATTAGATACCCTGAGAGG + Intergenic
1191705753 X:64092985-64093007 TCCCCAATAGATCCCCAAAATGG - Intergenic
1191756615 X:64599543-64599565 TTCACATTCAATACCCAAAGAGG - Intergenic
1191927345 X:66327869-66327891 TACACAATACATCCTCAAGGTGG + Intergenic
1192478014 X:71460319-71460341 TCCACAAAATATCCCCAAACAGG - Intronic
1193871169 X:86800446-86800468 TTCATAATATATATCCAAAGAGG - Intronic
1195323451 X:103739563-103739585 TACACAATATTTCCCCAAACAGG - Intergenic
1199221116 X:145316506-145316528 TTTACAATAGATCACTAGAGTGG + Intergenic