ID: 1157991034

View in Genome Browser
Species Human (GRCh38)
Location 18:52496649-52496671
Sequence TCTGTTAAGGAGACAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157991030_1157991034 0 Left 1157991030 18:52496626-52496648 CCTGTATATCTGATTTGATGACA 0: 1
1: 0
2: 3
3: 12
4: 185
Right 1157991034 18:52496649-52496671 TCTGTTAAGGAGACAGTGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 216
1157991029_1157991034 1 Left 1157991029 18:52496625-52496647 CCCTGTATATCTGATTTGATGAC 0: 1
1: 0
2: 0
3: 19
4: 226
Right 1157991034 18:52496649-52496671 TCTGTTAAGGAGACAGTGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157991034 Original CRISPR TCTGTTAAGGAGACAGTGGA GGG Intronic
902174453 1:14638780-14638802 TCTGTCCAGGAGACAATTGATGG - Intronic
902209195 1:14892563-14892585 TCTGCAAAGGACAGAGTGGAAGG + Intronic
903744345 1:25576731-25576753 TCTGTGAAAGATAAAGTGGATGG - Intergenic
905236426 1:36553269-36553291 TGTGTTAGGAAGCCAGTGGAGGG - Intergenic
905573693 1:39026448-39026470 TCTGTTAAAGAGACCTCGGAAGG - Intronic
906847125 1:49205243-49205265 TCTTTCAAGGACACAGAGGAGGG + Intronic
909663790 1:78111612-78111634 TTTTGTTAGGAGACAGTGGAAGG + Intronic
910042213 1:82866546-82866568 TCACTTGAGGAGACAGTGAAGGG + Intergenic
915084058 1:153372713-153372735 TGTGCTAAGGAGACACTGGGGGG - Intergenic
915796281 1:158737802-158737824 TGTGTTGAGGAGACATTGAAGGG - Intergenic
915940158 1:160113924-160113946 TGTGTTAAGGAGAGAGTGAGAGG - Intergenic
917982379 1:180278502-180278524 TCTGGTAAGGAGACAGCTGCAGG + Exonic
920177302 1:204110157-204110179 TCTGTCAAGGTGACAGAGCAAGG - Intronic
921226409 1:213024352-213024374 TCTGTTGAGGAGAGAGAGCAGGG - Intergenic
922364758 1:224853424-224853446 ACTGTTTGGGTGACAGTGGAGGG + Intergenic
923852730 1:237815077-237815099 TCTGTTTAGGAGACGGATGAGGG + Intronic
923992391 1:239453806-239453828 TCTGTGAAGGATAAAGGGGAGGG + Intronic
924171717 1:241349285-241349307 TTTCTTAAGGAGACAATGGGTGG - Intronic
924855322 1:247869716-247869738 ACTATCAAGGAGACAGTGTAGGG + Intronic
1064444122 10:15378703-15378725 TCTGCGAAGGGGACAGAGGAGGG + Intergenic
1065091943 10:22244133-22244155 TCTGCAGGGGAGACAGTGGAGGG - Intergenic
1065901959 10:30215914-30215936 TCTGTTAAGTAGACAAAGAAAGG + Intergenic
1066431559 10:35356806-35356828 TCTGTTAAGGAGAGAGAGAGAGG - Intronic
1067828026 10:49593457-49593479 TGGGTAAAGGAGTCAGTGGAGGG + Intergenic
1068585848 10:58797509-58797531 TCTGTTCAGGTCCCAGTGGAAGG - Intronic
1068843362 10:61641068-61641090 TCTGTTAATCACACAATGGAAGG - Intergenic
1069033046 10:63618132-63618154 TCAGGTGAGGAGAAAGTGGAAGG - Intronic
1069102849 10:64344696-64344718 TTAGTGGAGGAGACAGTGGAGGG + Intergenic
1069729447 10:70601405-70601427 TCTGTTAAGGGCTCAGTGGGAGG - Intronic
1069911255 10:71761178-71761200 TCTGTTCAGGTGAGAGTGCAAGG - Intronic
1070589264 10:77789947-77789969 GCTGTCAAGGAGACAGAGGCAGG + Intergenic
1071338609 10:84622342-84622364 TGTGCTAAGGAGACACTGAAAGG + Intergenic
1071706697 10:88006934-88006956 GCTGTTAGGGAGAGAGTAGATGG + Intergenic
1072552142 10:96487219-96487241 TCTGTTAAGCAGCCAGTGCCAGG + Intronic
1073332355 10:102678814-102678836 TCTGTTATGGAGGCAAAGGAGGG + Intronic
1073865543 10:107800220-107800242 TCTTTTAAAGTGACAGTGGCAGG + Intergenic
1076849377 10:133085720-133085742 ACTGTTCAGGAGACAGTGCCCGG + Intronic
1081639448 11:44742820-44742842 TCTGTCAATGGGAGAGTGGATGG - Intronic
1084069259 11:66723530-66723552 TCTCTTTAGGAGAAAGGGGAGGG - Intronic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084407398 11:68982896-68982918 ACTGTTTAGGAGACAGTGTTAGG - Intergenic
1086722992 11:90144930-90144952 TCTGTTAAAAAGAAAGTGGCTGG - Intronic
1087209687 11:95434401-95434423 TGTGTGAAGGAGAGAGAGGATGG - Intergenic
1087489861 11:98811317-98811339 CCTGTGAAGGATACTGTGGAAGG - Intergenic
1087962130 11:104365457-104365479 TATTTTAAGTACACAGTGGATGG + Intergenic
1088010978 11:105000717-105000739 TATATTAAGAAGACAGTGTATGG - Intronic
1089049662 11:115535201-115535223 TCAGTTAAAGAGTCAGTAGATGG + Intergenic
1089603301 11:119627829-119627851 TCTGTTGAGGTGGCAGAGGATGG + Intronic
1089668493 11:120035394-120035416 TTTGTTCAGGATACAGTGGCGGG + Intergenic
1091017290 11:132063449-132063471 TCTATTAATGAGAGGGTGGAAGG + Intronic
1092254459 12:6918679-6918701 TCTGTTAAGTTGCCACTGGAAGG + Intronic
1092277216 12:7070464-7070486 GCTGTAAAGGGGACAGTGGTGGG + Exonic
1093890335 12:24512384-24512406 TCTGTTCTGGTGACAATGGAAGG - Intergenic
1094347989 12:29492272-29492294 TATGTTTAGGGGACAGTGGGAGG + Intronic
1096949701 12:55454668-55454690 TTTGATAAGGAGAAAGTAGATGG + Intergenic
1100447276 12:94672785-94672807 TCTGTTTAGGGAACAGTGTAGGG - Intergenic
1100666198 12:96756090-96756112 TCTGTGAAGGAGACAGGGGAAGG + Intronic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1101697798 12:107142706-107142728 TGAGTTAAGGAGACCGTGGATGG - Intergenic
1104274096 12:127309028-127309050 TTTCTTAAAGAAACAGTGGATGG - Intergenic
1105662959 13:22519627-22519649 TCTGTTAAGCAGATAGTGTAAGG - Intergenic
1105895667 13:24715615-24715637 TCTCTTAAAAAGACAGTGGCTGG + Intergenic
1106351813 13:28937779-28937801 TCTGTTAAGGGGACAGTGACTGG + Intronic
1106569622 13:30915390-30915412 TCTAGAAAGGGGACAGTGGACGG - Intronic
1107717152 13:43211657-43211679 TCTAGTAAGGATACAGGGGAAGG - Intergenic
1110858355 13:80321251-80321273 CCTGTTCAGGAGACAGTGAATGG - Intergenic
1111269022 13:85855317-85855339 CCTGTTGAGGAGACAGTGCAGGG - Intergenic
1111277508 13:85968890-85968912 TCTCTTCAGGAGAGAGAGGAGGG - Intergenic
1113215847 13:108039860-108039882 GGTGCTAGGGAGACAGTGGAAGG + Intergenic
1115324538 14:32124606-32124628 TCTGTTAGGGTGACCGTAGATGG + Intronic
1116589699 14:46756185-46756207 ACTTTTCAGGAGACAGTGGGAGG - Intergenic
1116722196 14:48511833-48511855 TATGTTAAGGAGATAGTAGTAGG - Intergenic
1117127132 14:52641240-52641262 TTAGTTAAGGAGCCAGTAGAAGG + Exonic
1117149005 14:52866373-52866395 GCTGTTGGGGAGAAAGTGGAGGG - Intronic
1117249090 14:53917456-53917478 TCTGTGAAGAAGACAGAAGATGG - Intergenic
1117571711 14:57055510-57055532 ACAGTGAAGGGGACAGTGGATGG + Intergenic
1118939253 14:70317418-70317440 TCTGTGAAGGAGGCAGTCCAAGG + Intergenic
1121102684 14:91260982-91261004 TCTTTAAAGCTGACAGTGGATGG - Intergenic
1121662139 14:95643090-95643112 ACTGTTAAGGTGACAGTGCATGG - Intergenic
1123161861 14:106286655-106286677 TCTGGAAAGGAGTGAGTGGATGG + Intergenic
1123177582 14:106436253-106436275 TCTGGAAAGGAGTGAGTGGACGG + Intergenic
1125114593 15:36075085-36075107 TCTGTAAAGGAGAGAGTAAAGGG - Intergenic
1125751904 15:42035034-42035056 TCAGTTCAGGGGACAGTGAAAGG - Intronic
1126740944 15:51775524-51775546 TCTGTGAAGGGGACAGGAGAAGG - Intronic
1129294929 15:74594963-74594985 TCTGTCAAGGAGAAAGGAGAAGG + Intronic
1130322021 15:82849559-82849581 TCTGAAAAGGAGTGAGTGGACGG + Exonic
1131095218 15:89650194-89650216 TCTGTTGAGGATGCAGTGAAGGG - Intronic
1131176121 15:90210836-90210858 TCTGTGGAGGAGTGAGTGGAAGG + Intronic
1131554101 15:93381748-93381770 TCTCTTCAGGAACCAGTGGAAGG + Intergenic
1132252581 15:100345185-100345207 GCTGTGAAAGAGAAAGTGGAAGG - Intergenic
1132625749 16:890701-890723 TCTTTTAAGGACACAGTCGTTGG + Intronic
1133521329 16:6560505-6560527 TCTGTTCAAGAGACAATAGAAGG + Intronic
1133707561 16:8369611-8369633 TCTGCAGAGGAGACAGAGGAAGG - Intergenic
1137547500 16:49414639-49414661 TCATTTAAGGAGAAAGTGGGGGG - Intergenic
1137830978 16:51543057-51543079 TCAGTTAAGGAAACAGCTGAGGG + Intergenic
1138062919 16:53910310-53910332 TTTGTTCTGGAGACAGTGGTTGG + Intronic
1138983317 16:62296995-62297017 GCACTTAAGAAGACAGTGGAGGG + Intergenic
1140990965 16:80210968-80210990 TCTGTGAAGGAGAAATTGCATGG + Intergenic
1141711535 16:85702274-85702296 GCTGCTAAGCAGGCAGTGGAGGG + Intronic
1144328544 17:14204639-14204661 TTTGTGAAGGATACACTGGAGGG - Intronic
1144537388 17:16104019-16104041 TTTGTTAAGGAAACCATGGAAGG - Intronic
1145282288 17:21476898-21476920 TCTGTTAAGAAGCCAGTCCATGG - Intergenic
1146255361 17:31389117-31389139 TATGCTAGGGAGACAGTGAAAGG - Intergenic
1147150757 17:38512273-38512295 TGTGTCAAGGACACAGTGAAAGG - Exonic
1149993483 17:61395539-61395561 TGTGTAAAGGAGGGAGTGGAGGG + Intergenic
1156271417 18:35536568-35536590 AATGTGAAGGAGACAGAGGAGGG - Intergenic
1156362579 18:36397286-36397308 TCTGTTCAGCAGAGAGTAGAGGG - Intronic
1156362973 18:36400573-36400595 TCTGAGAAGGAGACTGTGGTTGG + Intronic
1156652249 18:39238290-39238312 TCTGTCAATGAGAAAATGGAGGG + Intergenic
1157837608 18:50921307-50921329 TCTGTTGAAAAGAGAGTGGAAGG - Intronic
1157991034 18:52496649-52496671 TCTGTTAAGGAGACAGTGGAGGG + Intronic
1160664205 19:315985-316007 TCTGTTGAGAAGTCAGAGGACGG - Intronic
1161054032 19:2181002-2181024 ACTGACAAGGAGACAGAGGAAGG - Intronic
1163398165 19:17076047-17076069 ACGGTGAAGGAGAAAGTGGATGG + Intronic
1166819319 19:45567506-45567528 TCAGATAAGGAGACAGAGCAGGG + Intronic
927473557 2:23395120-23395142 TGTGTTGAGGTGACAGAGGAAGG + Intronic
927607757 2:24503364-24503386 ACTGTTAAGAAGACAGAGGAAGG - Intronic
928243415 2:29606198-29606220 TCTGTGAGGGAGACAGGGGAGGG - Intronic
929115313 2:38438914-38438936 TTTTTTAAGGAGACACTGCAAGG - Intergenic
931618507 2:64186487-64186509 TCAGATAAGGAGAAAGAGGAAGG + Intergenic
931852280 2:66263711-66263733 ACTGTAAAGAAGTCAGTGGATGG - Intergenic
931858274 2:66327097-66327119 TGTGTTAAGGAGAGAATGGTGGG + Intergenic
933952583 2:87343110-87343132 GCTGTTAGGGAGACAGAGGTAGG + Intergenic
934950913 2:98574853-98574875 TCTGTTCTGGTGACAGGGGATGG - Intronic
935714108 2:105924757-105924779 TCTGCTAAGGAGACTGCGGGAGG + Intergenic
936838613 2:116740864-116740886 ACTGTCAAGGAGACAGGGGTAGG + Intergenic
937580666 2:123483869-123483891 TCTGTGAAGGATAAAGTTGAAGG + Intergenic
938218423 2:129543872-129543894 TGAGTTAAGGAGACAGTGCCGGG - Intergenic
938316651 2:130334054-130334076 TCCATTAAGGAAACAGTTGATGG + Intergenic
939339193 2:140871396-140871418 ACTGTTAAGGAAACAGAGAAAGG + Intronic
939724397 2:145698235-145698257 CATGTTAAGGAGAAATTGGAGGG + Intergenic
940102607 2:150059015-150059037 TTTGTTAAGTAGACTGTGGTAGG + Intergenic
940899473 2:159113290-159113312 TCTGTTTAGGAGGCAGTAAAAGG - Intronic
940988488 2:160074017-160074039 ACTAGGAAGGAGACAGTGGAAGG + Intergenic
942787290 2:179714444-179714466 TTTGTTAAGGAGGCATTGCATGG - Intronic
945987550 2:216367418-216367440 TCTATGAAGGAGACAAAGGAGGG - Intronic
946230909 2:218290839-218290861 TCTGTTGGGGACACAGTGGAAGG - Intronic
946623538 2:221585671-221585693 TCTCTGAAAGAGACAGTGCATGG - Intergenic
946995604 2:225387979-225388001 TCAGTAAAGAAGACTGTGGAAGG - Intergenic
948213302 2:236210798-236210820 CCTGTGAAGGAGGCAGTGGAGGG + Intronic
948945389 2:241216666-241216688 CCTGGTAAGGTGACAGTGGTAGG - Intronic
1169485562 20:6028301-6028323 TATGTTAATTAGAGAGTGGAAGG + Intronic
1169879550 20:10331586-10331608 TTTGTTTAGGACACAGTTGATGG + Intergenic
1173125800 20:40335005-40335027 CCTGTTAAGTACACAGAGGAGGG - Intergenic
1173910786 20:46668920-46668942 ACTGTTCAGTAGACTGTGGAAGG + Intronic
1176020192 20:62958783-62958805 TCTGTTATGGAGACAGTCCCAGG - Intronic
1177245757 21:18520840-18520862 TCTGTCAAGGATACTGTAGATGG - Intergenic
1177470011 21:21548439-21548461 TTTGTTATGTAGACAGTGGAGGG - Intergenic
1178966079 21:37119575-37119597 TCAGTTAAGGAGACAGAAGCGGG - Intronic
1179407727 21:41139160-41139182 TCTGTAAATGAGAAAATGGAGGG + Intergenic
1180917765 22:19500700-19500722 GCTTTTAGGGAGACTGTGGAGGG - Intronic
1182357466 22:29728789-29728811 TCTGTTCTGGAGCCAGTGAATGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182789698 22:32940859-32940881 TAGGTTAAGGAGACAGAGGATGG - Intronic
1183836426 22:40457641-40457663 TCTGTCAAGAAGACAGAGCAAGG + Intronic
1184261918 22:43322483-43322505 GATGTTAAGGAAGCAGTGGAAGG - Intronic
949112609 3:280710-280732 TCTGAGAAGGAGTCAGTGAAGGG + Intronic
953335449 3:42090346-42090368 TCTTTGAATGTGACAGTGGAGGG + Intronic
953996073 3:47521060-47521082 TCTGTCAGGGAGACACTGGAAGG + Intergenic
958191983 3:90195432-90195454 TCTGTGAAGGAGCCTATGGAGGG + Intergenic
959536704 3:107494864-107494886 TCTTTTAAGGAAACAGTAAAAGG - Intergenic
959565264 3:107826665-107826687 TCGGCCAAGGAGACAGGGGAAGG - Intergenic
959969703 3:112395574-112395596 TCTGTTAAGTCGTTAGTGGAAGG + Intergenic
961124601 3:124405372-124405394 TCTGGTAAGGATGCAGTAGAAGG + Intronic
962391711 3:134977900-134977922 CCTGTGAAGGAGAGAATGGAAGG + Intronic
962681115 3:137801426-137801448 TCTGCCAAGGAGACAGAGGAGGG + Intergenic
965887078 3:173459068-173459090 TCTGTTAAGAAGAAAGAAGAGGG + Intronic
969401030 4:6955618-6955640 TCTGTTAATGAGACAAAGGAGGG + Intronic
970550180 4:17172315-17172337 TGTGTTGAGGACACAGTAGAGGG - Intergenic
974455473 4:62124642-62124664 TCTGTTAATGAGGCAGCTGATGG - Intergenic
976337567 4:83908324-83908346 ACTGTTAAGGAGGCATTGAAAGG + Intergenic
977597572 4:98900524-98900546 TCTTTTAAGTAGAGAGTGAATGG + Intronic
978727819 4:111990889-111990911 TTTGTAAAGGAGACAGTTAAGGG - Intergenic
979151901 4:117328316-117328338 TCTGTCCAGGAGAGAGAGGAAGG - Intergenic
980068901 4:128221732-128221754 TATTTTAATGAGTCAGTGGATGG + Intronic
981498223 4:145417263-145417285 GCTATTCAGGAGACTGTGGAGGG + Intergenic
981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG + Intronic
985240150 4:187922423-187922445 TCTGTTCAGAAGAAAGTGGCTGG - Intergenic
986499441 5:8383730-8383752 TCTGTTAAGGAGGCAATTCAAGG + Intergenic
986592307 5:9383784-9383806 TCTGTTAAGATCAGAGTGGAGGG - Intronic
987761273 5:22165279-22165301 TCTGTCATGGAGAAAGTGAAGGG - Intronic
988785779 5:34564454-34564476 TCTCTTAGGGAGTCTGTGGAGGG - Intergenic
989331326 5:40262283-40262305 TAGGTTAAGGAGTGAGTGGAGGG + Intergenic
989800606 5:45533923-45533945 TCTGCTAAGTGGGCAGTGGAGGG + Intronic
993027570 5:82664014-82664036 TCTGTGAAGGTGAAAGTGAATGG + Intergenic
993051522 5:82931623-82931645 TCCTTTAAGGAAACAGTGAAAGG - Intergenic
993962021 5:94309765-94309787 TCTGTTTAGGACTCATTGGAGGG - Intronic
997142555 5:131398048-131398070 ACTGTGAAGGACACAGTAGAGGG + Intronic
998766589 5:145495082-145495104 TGAGTTAAGGAGATAGTGGGAGG - Intronic
999062020 5:148646178-148646200 GCAGTTCAGGAGACACTGGAAGG + Intronic
999323024 5:150626319-150626341 TCTCCTAAGGAGACAGAGGAAGG - Intronic
999917844 5:156283204-156283226 TCTATTAAGGAGACAGTGATTGG + Intronic
1001769590 5:174283236-174283258 TCTGGGAGGGGGACAGTGGAGGG + Intergenic
1002525454 5:179813249-179813271 TCTGATAAGGTGGCTGTGGATGG - Intronic
1002600117 5:180349514-180349536 TCCCCTGAGGAGACAGTGGAGGG + Intronic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1004775393 6:18838492-18838514 TCTGTAAAGCAGACAGTGTTAGG + Intergenic
1005993129 6:30915667-30915689 TCTGTTCTGGAGACAGTAGAGGG + Intronic
1010744584 6:79546571-79546593 TCTCCCAAGGAGAGAGTGGATGG + Intergenic
1012868496 6:104645745-104645767 TCTGTAAAGGAGAAACTAGAGGG - Intergenic
1017744107 6:157431503-157431525 TCTGTTTTGGAGACTGAGGATGG + Intronic
1019624301 7:2008301-2008323 TCTGTGATGGAGGCAGTGGGTGG + Intronic
1023097957 7:36681958-36681980 TCTGTGAGGGAGAAAGTAGAGGG + Intronic
1023187310 7:37545643-37545665 TTTTTAAAGGAGACACTGGAAGG + Intergenic
1027998883 7:85465637-85465659 TCTGTCAAGGAGACATTGTCTGG - Intergenic
1028465817 7:91150169-91150191 TCTGGTCAGGAGGAAGTGGAAGG + Intronic
1029623203 7:101702819-101702841 TGTGTGGAGGAGAGAGTGGAGGG + Intergenic
1031238538 7:119209800-119209822 TCTGTAAAGGACCCAGTGGGAGG + Intergenic
1033931219 7:146524863-146524885 TCAGTTAAGGAGAGTGTGCAAGG + Intronic
1034823397 7:154237589-154237611 TTTGGTAAGTGGACAGTGGAGGG - Intronic
1034974316 7:155439063-155439085 CCAGATAAGGAGACCGTGGAGGG + Intergenic
1035168921 7:157007248-157007270 TGTCTTAAGGAGGCAGTGCAGGG - Intronic
1036531963 8:9598963-9598985 TCTGTTTATGAGACAGAAGAAGG - Intronic
1038985573 8:32805815-32805837 TCTGTTAAGGTGATAGTGATAGG + Intergenic
1042166348 8:65949570-65949592 TCTGTTCAGTAGACAGGGTATGG - Intergenic
1046139079 8:110065978-110066000 TGGCTTAAGGAGACAGAGGAAGG + Intergenic
1046524070 8:115361511-115361533 TCTGGAAAGGTGACTGTGGATGG - Intergenic
1049398696 8:142415169-142415191 TCTGTTAAGGAGGCTGGGGTGGG + Intergenic
1051341595 9:16116786-16116808 GCTATTTAGGAGACAGTGGCAGG + Intergenic
1052772698 9:32704178-32704200 TCTGGGAAGGAGACAGTGAGTGG - Intergenic
1052962484 9:34311874-34311896 TGTGTTAAGTAGACATTGCAAGG - Intronic
1055491964 9:76814599-76814621 TCTGGGGAGGAGACAGTGAAGGG + Intronic
1055552498 9:77444644-77444666 GCTGTGAAGAAGACACTGGAAGG - Intronic
1055819846 9:80248498-80248520 CCTGGAAAGGACACAGTGGATGG + Intergenic
1056316694 9:85397153-85397175 TCTCTCAAGGAGAAAATGGACGG + Intergenic
1056983861 9:91342879-91342901 TAGGTTAAGGAGAAAGAGGAGGG - Intronic
1057896299 9:98911874-98911896 GCTGATAAGGAGTCAGTGGCTGG + Intergenic
1059768816 9:117408802-117408824 TATGTTATTGAGACAGTGTAGGG - Intronic
1060679375 9:125547622-125547644 TCTGCTTAGGAGGCAGGGGAAGG - Intronic
1061219191 9:129240375-129240397 TCTGTGAAGGACAAAGGGGATGG - Intergenic
1061518944 9:131106063-131106085 TCTGTTGAGGAGCCCGAGGAGGG - Intronic
1061667945 9:132171118-132171140 TCTGAGCAGGAGCCAGTGGAAGG + Intronic
1061766178 9:132882800-132882822 TTTGTTCTGGAGGCAGTGGAGGG + Intronic
1190067414 X:47251046-47251068 TCTGTTAAGGAGCCAGAGCCTGG + Intergenic
1195357031 X:104048658-104048680 TCAGTTAGGGAGACGGTGGGTGG - Intergenic
1197691441 X:129505014-129505036 TCTTTTAAGGAAAAAGTTGATGG - Intronic
1199526801 X:148801862-148801884 TGTATTGAGGAGAGAGTGGAAGG - Intronic
1200212423 X:154352642-154352664 TCTGTGAAGGTGACAGGCGAGGG - Exonic