ID: 1157991769

View in Genome Browser
Species Human (GRCh38)
Location 18:52504800-52504822
Sequence CTGGAGAAGCAGGCTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 1, 1: 0, 2: 7, 3: 74, 4: 661}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157991769_1157991775 28 Left 1157991769 18:52504800-52504822 CCAACCTCAGCCTGCTTCTCCAG 0: 1
1: 0
2: 7
3: 74
4: 661
Right 1157991775 18:52504851-52504873 CTACAGCAATCCGACAATTCTGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157991769 Original CRISPR CTGGAGAAGCAGGCTGAGGT TGG (reversed) Intronic
900106082 1:981693-981715 CAGGAGGTGCAGGCTGCGGTGGG + Intronic
900411975 1:2516626-2516648 CTGGAGAAGCAGCCTCTGGGTGG + Intronic
901137345 1:7006587-7006609 CTGGAGAACCCAGTTGAGGTGGG + Intronic
901195226 1:7436557-7436579 TGGGAGGAGCAGGGTGAGGTCGG + Intronic
901807670 1:11748521-11748543 CTTGAGCAGCAAGCTGAGGATGG - Exonic
902064419 1:13672392-13672414 CTTGAGTAGGAGGCTCAGGTTGG + Intergenic
902252667 1:15165089-15165111 CTAGAAAAGCAGGCTGGGCTTGG - Intronic
902384938 1:16071192-16071214 CTGGAGCTGCAGGCTGCTGTGGG - Intronic
902564892 1:17304977-17304999 CTGGAGCTGCAGGCACAGGTGGG + Intergenic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
902907643 1:19570460-19570482 CTTGCTAGGCAGGCTGAGGTGGG - Intergenic
903006978 1:20305271-20305293 GTGGAAATGCAGGCTGAGCTGGG + Intronic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903847562 1:26287545-26287567 CAGGACAAGCAGGCTGCGGCAGG + Intronic
904339459 1:29824735-29824757 CTGGAGAGGCTGGGCGAGGTAGG + Intergenic
904424799 1:30416406-30416428 CTGGAGTAGGAGGCAGAGGTGGG - Intergenic
904755331 1:32765721-32765743 CTGGAGAGGCAGGGTGGGATAGG + Intronic
904834194 1:33324385-33324407 CTGCAGAAACAGGCTGAAGGGGG + Exonic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905201578 1:36320271-36320293 CTGAGGAAGGAGGCTGGGGTGGG - Exonic
905212819 1:36385979-36386001 CTGGAGACGCAGGCGGAGGGCGG - Intergenic
905232357 1:36522142-36522164 CTGGAGACCCAGTCTGAGGGGGG - Intergenic
905349912 1:37338288-37338310 CTGGAGAGGTATGCGGAGGTGGG + Intergenic
905448607 1:38043460-38043482 CTGGTGACCCAGGCCGAGGTGGG + Intergenic
905876701 1:41436082-41436104 CTGGATTAGCAGGCTAAGATTGG + Intergenic
906058795 1:42935225-42935247 CTGGAGAAGCAGGTTGACTCTGG + Intronic
906096559 1:43228167-43228189 CTGGAGAGGCAGGGAGAGGCTGG - Intronic
906206944 1:43991987-43992009 CTGGAGCTGCGGGCGGAGGTGGG + Exonic
906626646 1:47331413-47331435 CAGGAGGTGGAGGCTGAGGTGGG - Intergenic
907394308 1:54178596-54178618 ATGGAGGGACAGGCTGAGGTGGG + Intronic
907491301 1:54810570-54810592 CTGGGGAAGCAGGATGGGGCGGG - Intronic
908843052 1:68297830-68297852 CAGGGGAAGGGGGCTGAGGTGGG - Intergenic
908911629 1:69078431-69078453 CTCAGGAGGCAGGCTGAGGTAGG + Intergenic
909626559 1:77723426-77723448 TTGGAGATGCAGACTGAGCTAGG + Exonic
910053609 1:83005747-83005769 CTGGAGATGCTGATTGAGGTTGG + Intergenic
912927096 1:113922826-113922848 CTTGAGAGGGAGGCTGAGGTTGG - Intergenic
913301456 1:117374183-117374205 CTGTAGTCGGAGGCTGAGGTGGG + Intronic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
915832674 1:159145780-159145802 CTGGAGAATCTGTCAGAGGTGGG - Intronic
917422897 1:174883408-174883430 CTGGAGACGCAGGAGGAGTTGGG + Intronic
917478671 1:175391290-175391312 GTGGAGACGCTGGCCGAGGTAGG + Exonic
917853814 1:179085977-179085999 CTGGAGAAGCCTGGGGAGGTGGG + Intronic
917955065 1:180087425-180087447 CTGGAGAATGATGCTGAGGGGGG + Intronic
918052471 1:180986653-180986675 CTAGGGAAGGAGGCTGAGGTGGG - Intronic
918445929 1:184616919-184616941 CTGGAGTGCAAGGCTGAGGTGGG + Intronic
918540550 1:185627227-185627249 CTGAGGCAGGAGGCTGAGGTGGG + Intergenic
919981841 1:202646786-202646808 CTGGGGGAGAAGGCTGAGGGTGG - Intronic
920228188 1:204453047-204453069 CTGGAGATGCTGGAAGAGGTGGG - Intronic
920903222 1:210133234-210133256 CTGGAGAATCAGACTCAGTTTGG + Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921591713 1:217011824-217011846 CTAGACATCCAGGCTGAGGTGGG - Intronic
922549057 1:226480661-226480683 CCTGAGAACCAGGGTGAGGTGGG - Intergenic
922776990 1:228219362-228219384 AGGGAGGTGCAGGCTGAGGTGGG + Exonic
922802629 1:228371313-228371335 CGGGAGATGCAGGCGGAGCTGGG - Exonic
922847490 1:228699197-228699219 CTGAGGCAGGAGGCTGAGGTGGG + Intergenic
922936355 1:229426014-229426036 GTGGAGACGGAGGCAGAGGTTGG + Intergenic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
923479744 1:234373104-234373126 CCTGGGAGGCAGGCTGAGGTGGG + Intergenic
923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG + Intergenic
924722889 1:246639438-246639460 CTGGAGGAGCAGTGTGCGGTCGG + Intronic
1062897643 10:1116362-1116384 GTGGAGACCCAGGGTGAGGTGGG - Intronic
1063011017 10:2021515-2021537 CTGGAGAAGCACACAGAGGGAGG - Intergenic
1063126183 10:3138525-3138547 CTGCAGAAGCAGGCGTGGGTAGG - Intronic
1063707883 10:8448767-8448789 TGGGAGGAGCAGGTTGAGGTGGG - Intergenic
1064001894 10:11670630-11670652 CTGGAGAACTAGGATGAAGTGGG - Intergenic
1064876510 10:20000994-20001016 CTGGAGTAGCAGGATGAGCTGGG + Intronic
1066256744 10:33686924-33686946 CTAGAAAAGCAGCCTCAGGTAGG - Intergenic
1066277985 10:33887529-33887551 CTAGAGACCCAGACTGAGGTTGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067218682 10:44325417-44325439 CTGGAGAAGAGGAGTGAGGTAGG - Intergenic
1067470311 10:46532472-46532494 CTGAGGCAGGAGGCTGAGGTGGG - Intergenic
1067829996 10:49606120-49606142 GTGGAGAAGCAGGCTGGTGTTGG - Intergenic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1069345664 10:67467024-67467046 CTGGCTAGGGAGGCTGAGGTGGG + Intronic
1069536982 10:69261112-69261134 TTGGAGAAGAAGGATAAGGTTGG - Intronic
1069707747 10:70469282-70469304 CTGGAGATTCTGGCTGAGGAGGG + Intergenic
1070166335 10:73900956-73900978 CTGGAGATGGAGGCTGAGGCAGG + Intergenic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1071543722 10:86511198-86511220 CTGAGGCAGGAGGCTGAGGTGGG + Intronic
1072456413 10:95580198-95580220 CTGAGGAATCAGGCTGAGGCTGG - Intergenic
1072553308 10:96495219-96495241 CTCAGGAAACAGGCTGAGGTGGG + Intronic
1072725667 10:97811764-97811786 CTGCAGGTGCAGGCTCAGGTGGG + Intergenic
1072794687 10:98345653-98345675 CTGGGCATGGAGGCTGAGGTAGG - Intergenic
1073591737 10:104764296-104764318 CTGATGAAGCGGTCTGAGGTGGG + Intronic
1073607896 10:104914505-104914527 ATTGGGAAGGAGGCTGAGGTGGG + Intronic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074567378 10:114592852-114592874 CTGAAGAAGAAGGTTGGGGTGGG + Intronic
1075015606 10:118908197-118908219 CTAGAGAAACAGGCTGAGTGGGG - Intergenic
1075400153 10:122155213-122155235 CTGGAGAGGCAGGTTGAGAAGGG - Intronic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076256624 10:129031663-129031685 CTCAGGAAGGAGGCTGAGGTGGG + Intergenic
1076501482 10:130939744-130939766 CTGGAGATGGAGGGTGAGGCTGG + Intergenic
1077076282 11:703629-703651 CTGGAGACGCAGGATGGGGTAGG + Intronic
1077230214 11:1455325-1455347 CTGGGGAGGCAGGCTGGGGGCGG - Intronic
1077351530 11:2095306-2095328 CTGGAGAGGGAGGTTGAGGTGGG - Intergenic
1077493358 11:2872437-2872459 CTCGAGAGGGAGGCTGAGGCAGG - Intergenic
1077558054 11:3236079-3236101 CAAGAGAGGGAGGCTGAGGTGGG + Intergenic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1077775926 11:5271475-5271497 ATGGAGACGGAGGCAGAGGTGGG - Intronic
1078259649 11:9693686-9693708 CTGGACAAGGAGGCTGACCTGGG - Intronic
1078355643 11:10629712-10629734 CTGCAGAAGGAGGATGAGCTGGG + Intronic
1078697589 11:13650138-13650160 CTGAGGCAGGAGGCTGAGGTGGG - Intergenic
1079386667 11:19986181-19986203 CTGGAGATGGAGGATGAGGGTGG + Intronic
1080212696 11:29805476-29805498 CTGGCTACTCAGGCTGAGGTGGG - Intergenic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1081718838 11:45271502-45271524 CTGGAGAGGAAGGCTGGGGTTGG + Intronic
1081767103 11:45619009-45619031 CAGGAGAAGCAAGCTCAGGTAGG + Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083675945 11:64324684-64324706 CTGGGGAGGGAGGCTGAGGCAGG + Intergenic
1083832838 11:65243950-65243972 GTGGAGCAGCACGCAGAGGTAGG - Intergenic
1083832854 11:65243996-65244018 ATGGGGCAGCAGGCTGGGGTGGG - Intergenic
1083974489 11:66106642-66106664 GTGAAGAGGTAGGCTGAGGTGGG + Intronic
1084463324 11:69308263-69308285 CGGGAGAGGCAAGATGAGGTTGG - Intronic
1084736438 11:71108540-71108562 CTGGAGCAGGAGGCTGGGTTGGG - Intronic
1084772116 11:71350009-71350031 CTGGTGAAGCGGGCTGATGTTGG + Intergenic
1085224848 11:74910586-74910608 ATGGAGAAGCAGGCAGAGTCAGG + Intronic
1085782678 11:79423662-79423684 CTGGAGCAGCAGGCGCAGGGAGG + Intronic
1086105502 11:83142567-83142589 CGGGAGGAGGAGGTTGAGGTGGG + Intergenic
1086156290 11:83670070-83670092 CTGGATAAGCTGGTTGAGTTAGG - Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086453156 11:86936777-86936799 CTGTAGTAGGAGGCTGAGCTGGG + Intronic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1087093756 11:94300716-94300738 CTCGGGAGGGAGGCTGAGGTGGG + Intergenic
1087509193 11:99068548-99068570 CGTGAGAAGCAGGCTGGGTTAGG + Intronic
1088627961 11:111745978-111746000 CTGCAGCAGCATGCTGAAGTGGG - Intronic
1088677749 11:112212695-112212717 CTGGACAAGCAGGCTTGGGTGGG - Intronic
1089288002 11:117420017-117420039 CTGGGGAAGGAGGCTGAGGTGGG + Intergenic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089713008 11:120330452-120330474 TTGGAGAAGCAGGCGGAGTGAGG + Exonic
1090409291 11:126496628-126496650 CTGGAGAAGGAGGCTAAGTCTGG + Intronic
1090446649 11:126770191-126770213 CTGAAGAAGCAAGGGGAGGTGGG - Intronic
1090839106 11:130473883-130473905 CTGGAGTAGCGGGCAGAGGACGG + Exonic
1091234993 11:134015661-134015683 CTGGAGCAGGAGCCTGAGGTGGG + Intergenic
1091307226 11:134544010-134544032 GTGGAGAAGGAAGCAGAGGTGGG - Intergenic
1092062969 12:5565782-5565804 CTTGAGAAGCAGGGGGAAGTGGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092208772 12:6632922-6632944 CTGGAGAAGCAGGCAGGCCTGGG - Intronic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1092660284 12:10731455-10731477 CTGAGGCAGGAGGCTGAGGTAGG - Intergenic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1096003133 12:48145856-48145878 CTGGAGGAGCAGGCAGTGGGTGG + Exonic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096637225 12:52967925-52967947 CTGGAGCAGCAGGCTCTAGTGGG + Intergenic
1097169892 12:57106698-57106720 CTGCAGAAGGGGGCTGAGGCTGG - Exonic
1097801803 12:63922565-63922587 CTGGAAAAGTAGGTTGAAGTAGG - Intronic
1097809833 12:64006458-64006480 CTGGAGAGGCAGGCTGTGGAGGG + Intronic
1097813652 12:64046651-64046673 GGGGAGAAGCAGGCTGAAGCGGG + Intronic
1097877614 12:64657938-64657960 ATGGTGGTGCAGGCTGAGGTGGG + Intronic
1097935263 12:65242230-65242252 CTGAAGAAAAAGTCTGAGGTAGG - Intronic
1100233475 12:92633742-92633764 CTGCAGGAGCAGTCTCAGGTAGG - Intergenic
1101440207 12:104698241-104698263 CTGGAGAAATGGGTTGAGGTTGG - Intronic
1102095913 12:110241252-110241274 AGGGAGAAGCAGACTTAGGTAGG + Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102592888 12:113970383-113970405 GTGGAGATGAAGGCTGAGATCGG - Intergenic
1103583426 12:121933569-121933591 GTGGCCAAGGAGGCTGAGGTGGG + Intronic
1104421893 12:128642840-128642862 CAGAAGCAGCAGGCTGTGGTTGG + Intronic
1105578822 13:21675233-21675255 GTGGGGAAGCAGGGTGAGGCAGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107021776 13:35759610-35759632 GTAGAGAAGGAGGCTGAGGAAGG - Intergenic
1107121834 13:36804558-36804580 CTGTAGTCCCAGGCTGAGGTGGG - Intergenic
1108002833 13:45920705-45920727 CTGGTTAAGAAGTCTGAGGTAGG + Intergenic
1108287623 13:48924458-48924480 CTCGGGAGGGAGGCTGAGGTGGG - Intergenic
1108620749 13:52181718-52181740 CTGGGGAAACAGGCTGATGAAGG + Intergenic
1108666001 13:52631260-52631282 CTGGGGAAACAGGCTGATGGAGG - Intergenic
1108830597 13:54473188-54473210 CTTGAGAAGCAGCCTGAGGTTGG + Intergenic
1108868596 13:54952963-54952985 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1110092430 13:71470418-71470440 CAGGAGAATCAGGCTGAGGCAGG - Intronic
1110177120 13:72570122-72570144 TTTAAGAAGCAGGGTGAGGTTGG - Intergenic
1112229589 13:97575080-97575102 CTGGAGTAGAAGGCTGTGTTTGG + Intergenic
1112279846 13:98053347-98053369 CTTGGGAGGCAGGCTGAGGTGGG - Intergenic
1112367888 13:98771465-98771487 CTGGAGTAGCCAGCAGAGGTGGG - Intergenic
1112520732 13:100092638-100092660 TTAGAAAAGCAAGCTGAGGTGGG - Intronic
1112837665 13:103535867-103535889 CTTGGGAGGCAGGCTGAGTTGGG - Intergenic
1113127147 13:106991907-106991929 CTGCAGATAAAGGCTGAGGTGGG + Intergenic
1113360361 13:109625345-109625367 CTCTGGAAGGAGGCTGAGGTGGG - Intergenic
1113670480 13:112172281-112172303 GTGAAGATGCAGGCAGAGGTCGG - Intergenic
1113672225 13:112183052-112183074 GTGGAGAAGGAGGCTGACGATGG - Intergenic
1114082840 14:19216425-19216447 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1114559167 14:23578343-23578365 CTGGAGGAGCAGGCTGGGTGGGG + Exonic
1114890050 14:26908736-26908758 CTGGAGAAGGGGTTTGAGGTAGG + Intergenic
1115121250 14:29940713-29940735 CTGGAGCAGGAGGATGAGTTGGG - Intronic
1115170319 14:30497502-30497524 CTGGAGAGGAAGGCAGAAGTTGG - Intergenic
1116823263 14:49646426-49646448 CAGGAGAAGGAGGCTAAGGCAGG - Intronic
1117463620 14:55971235-55971257 CTGGAGAAGGAAGCAGAGGTTGG - Intergenic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1118885576 14:69863166-69863188 CTAGAGAAGGAGGCTGCGGTTGG + Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119944503 14:78678433-78678455 CTGGAGTAGCTGGGTGTGGTGGG - Intronic
1120030096 14:79631447-79631469 GTGGAGAGACAGGCAGAGGTGGG + Intronic
1120794508 14:88617711-88617733 CTGATGTAGCAGGCCGAGGTGGG - Exonic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1120949082 14:90024313-90024335 CAGGTGCAGCAGGCAGAGGTGGG - Intronic
1121050991 14:90818806-90818828 CTGGAGAGGCAGACTGGAGTTGG - Intergenic
1122126308 14:99580403-99580425 CTGGAAAAGCAAGCAGAGGGCGG + Intronic
1122564082 14:102639374-102639396 GGGGAGGAGAAGGCTGAGGTAGG - Intronic
1122576528 14:102746598-102746620 CAGGGGAAGCAGGCTGAGCCAGG + Intergenic
1122785897 14:104163106-104163128 CTGGAACAGGAGGCTGAGGCTGG + Intronic
1122836037 14:104431597-104431619 CAGCAGACGCAGCCTGAGGTGGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1123059059 14:105586211-105586233 CTGGGGGAGCAGGCTGAGCTTGG + Intergenic
1123083387 14:105706442-105706464 CTAGGGGAGCAGGCTGAGCTTGG + Intergenic
1123626071 15:22227632-22227654 CTGGAGCGGCATGCTGGGGTGGG + Intergenic
1124162100 15:27281345-27281367 CTGGAAAAACAGGCAAAGGTGGG - Intronic
1124231859 15:27952788-27952810 CTGGGGAGGGAGGCTGAGGTAGG - Intronic
1124816636 15:33000532-33000554 TTGGAGAGAGAGGCTGAGGTGGG + Intronic
1124999534 15:34755384-34755406 ATGGAGATGCTGGCTGAGGGAGG + Intergenic
1125494212 15:40175766-40175788 CTGGAGAAAAAGGCTGTGATAGG - Intronic
1125496904 15:40204880-40204902 TTTGGGAGGCAGGCTGAGGTGGG - Intronic
1125577291 15:40764363-40764385 GTGGAGAAGCGGGCTCAGCTCGG + Intronic
1125845731 15:42851339-42851361 CAGAAGAAGCAGGCAGGGGTCGG + Intronic
1126120696 15:45248683-45248705 CTGTAGAAGCAGGCAGAACTAGG - Intergenic
1127845373 15:62866082-62866104 GTGGAGAAGGTGGATGAGGTTGG + Intergenic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1128081024 15:64856990-64857012 CTGGAGAAGCAGGGGGAGAGGGG - Intronic
1128351877 15:66896327-66896349 CTGGAGAAGCAGGCAGATCTAGG + Intergenic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128749541 15:70139225-70139247 GAGGAGCAGCAGGCGGAGGTGGG - Intergenic
1129295826 15:74599526-74599548 CGGAGGAAGCAGGCTGAGGAGGG + Intronic
1129389702 15:75214450-75214472 CTGGGGCAGCAGGCTGGGCTCGG - Intergenic
1129785092 15:78304576-78304598 CTGGAGAAGGAGGCTGTTCTGGG - Intergenic
1129952946 15:79608016-79608038 CAGGAACAGCAGGCTGAGGATGG - Intergenic
1130008492 15:80126994-80127016 CTGGGTAGGGAGGCTGAGGTGGG + Intronic
1130016755 15:80193331-80193353 GTGGAGGTGCAGGCAGAGGTTGG + Intergenic
1130054121 15:80507642-80507664 GAAGAGAAGAAGGCTGAGGTTGG + Intronic
1130111850 15:80971836-80971858 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1130299157 15:82666934-82666956 CTGGAGGAACAGGAAGAGGTGGG + Intronic
1130511592 15:84594242-84594264 CTTGAATACCAGGCTGAGGTTGG - Intergenic
1130785662 15:87093118-87093140 TTGGAGACTCAGGCTCAGGTTGG + Intergenic
1131191244 15:90318672-90318694 CTGGAGAGACAGGCTGGGCTGGG - Intergenic
1132783041 16:1638945-1638967 CTGGAGAGGCAGGCTGGAGGAGG - Intronic
1132810416 16:1794249-1794271 CGGGAGAGGCAGGGTGAGCTTGG - Intronic
1132907721 16:2291703-2291725 CTGGAGGAACAGCCTGGGGTGGG - Intronic
1132944692 16:2526467-2526489 CTTGAGAAGTAGGGTGACGTGGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133222580 16:4325124-4325146 CTGGAGGGGCTGGCTGGGGTGGG - Intronic
1133711435 16:8405172-8405194 CTTATGCAGCAGGCTGAGGTGGG + Intergenic
1133884205 16:9810579-9810601 CTGGAGATGGAGGCAGAGATTGG + Intronic
1134029055 16:10977382-10977404 CTGGAGAACCAGGACAAGGTGGG + Exonic
1134055739 16:11168759-11168781 CTGGAACAGCAGGCAGATGTTGG - Intronic
1134075907 16:11291234-11291256 CTACTCAAGCAGGCTGAGGTAGG - Intronic
1134096832 16:11423938-11423960 CTGGAGAGGAAGGCAGAGGGTGG - Intronic
1134278855 16:12800715-12800737 CTGGAGCAGAAAGATGAGGTTGG - Intronic
1134439314 16:14288336-14288358 CTGAGGCAGGAGGCTGAGGTGGG - Intergenic
1135139836 16:19911949-19911971 CTGAATCAGCAGGTTGAGGTAGG + Intergenic
1135152705 16:20023159-20023181 CTGGTTCAGCAGGCTGGGGTGGG + Intergenic
1135221712 16:20620466-20620488 CTGTAGTCCCAGGCTGAGGTGGG - Intronic
1136188364 16:28601123-28601145 CTGGAGGCGCGGCCTGAGGTGGG - Intergenic
1136190836 16:28614117-28614139 CTGGAGGCGCGGCCTGAGGTGGG - Intronic
1136244992 16:28969857-28969879 CTCAGGAAGGAGGCTGAGGTGGG + Intergenic
1138457370 16:57129133-57129155 CTGGAGGAACTGGCAGAGGTGGG + Intronic
1139749980 16:69103936-69103958 ATGGAGAAGAAGCCTTAGGTTGG - Intergenic
1139963020 16:70728727-70728749 CTGGAGAACTGGGCTGAGGTGGG - Intronic
1140196447 16:72859434-72859456 TGGGAGAAGAAGGCTGAGGTGGG - Intronic
1140251803 16:73300912-73300934 GTGGAGAAGGAGACTGATGTTGG + Intergenic
1140865665 16:79059600-79059622 CTTGGGAGGCAGGCTGAGGCAGG - Intronic
1141034216 16:80613888-80613910 CTGGAGAGGTAAGCTGAGGCAGG - Intronic
1141221105 16:82070042-82070064 GTGGAGAAGAAGGATTAGGTTGG - Intronic
1141538373 16:84699662-84699684 CGGGAGTCGCGGGCTGAGGTCGG - Intergenic
1141594123 16:85087130-85087152 CTGAAGAAGCAGGCTGTGATTGG + Exonic
1141725383 16:85784742-85784764 ATGCAGGAGCAGGCAGAGGTGGG - Intronic
1141808451 16:86357871-86357893 ATGAAGATGAAGGCTGAGGTTGG + Intergenic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1142499146 17:322670-322692 CTAGGGCAGCAGGCTGAGGGAGG + Intronic
1142522201 17:512908-512930 CTGGAAGAGCAGGCTGTGATGGG + Exonic
1142748460 17:1972950-1972972 CTGGAGCAGCAGGTGGGGGTCGG - Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143265305 17:5632416-5632438 CTGGAGAAGCAGGCTCTTGCTGG + Intergenic
1143496003 17:7312958-7312980 CCGGAAAAGCAGGATTAGGTAGG - Intronic
1144460113 17:15451638-15451660 CTGGGGAAGGACCCTGAGGTGGG - Intronic
1145104785 17:20105870-20105892 CTGGGGATGGAGGCTGTGGTGGG + Intronic
1145109306 17:20147928-20147950 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1145246510 17:21273232-21273254 CAGTAGAAGGAGGCTGAGGGAGG - Intergenic
1145375444 17:22343421-22343443 CTGAAGAAACAGGGTGAGGGGGG - Intergenic
1145743732 17:27297577-27297599 CTGTAGTACCAGGCTGAGGTGGG - Intronic
1145901383 17:28492589-28492611 CTGGAGAAGTAGGCAGGGGAAGG + Intronic
1146173746 17:30651692-30651714 CGGGAGAGGCAGGCTGAGCAGGG - Intergenic
1146347202 17:32067713-32067735 CGGGAGAGGCAGGCTGAGCAGGG - Intergenic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147584175 17:41643582-41643604 CAGGAGAAGCAGGTGGAGCTAGG + Intergenic
1148058396 17:44816611-44816633 CTCGAGAAGCTGACTGAGGCAGG - Intronic
1148220557 17:45858745-45858767 CTGGAGAGGGAGGGTGAGGAAGG + Intergenic
1148474418 17:47917724-47917746 CTGGCTACTCAGGCTGAGGTGGG - Intronic
1148742697 17:49901882-49901904 CAGGAGGAGCAGACTGTGGTTGG - Intergenic
1149347178 17:55750935-55750957 CTGGAGGAGCGGCCTGAGGGTGG - Intergenic
1149446689 17:56718650-56718672 CTGGAGAGGCAGGTAGAAGTCGG + Intergenic
1149600684 17:57891246-57891268 GGGGAGAAGCAGGTTGGGGTCGG - Intronic
1149691854 17:58583716-58583738 CTGGAGAAGCAGGCCTAGGCAGG - Intronic
1149719123 17:58825660-58825682 CTAGAGAATCAGACTGAGGCTGG - Intronic
1150226425 17:63527076-63527098 CAGGAAAGGCAGGCTGGGGTGGG - Intronic
1150734278 17:67723084-67723106 CGGGAGGAGGAGGCTGCGGTGGG - Intronic
1151352039 17:73537514-73537536 ATGGAGAGGCAGGCAGAGGGTGG + Intronic
1151448128 17:74180625-74180647 CTGGAGAAGCTGCCTGGGATGGG - Intergenic
1151539917 17:74759574-74759596 CTGGAGCTGCAGCCTGAGCTGGG - Intronic
1151748117 17:76022358-76022380 CTGGAGAAACGGGCTGGGGCTGG + Intronic
1151867497 17:76813900-76813922 CTGTAGCCACAGGCTGAGGTGGG - Intergenic
1151952872 17:77364790-77364812 CTGGGGCTGCTGGCTGAGGTGGG + Intronic
1152344597 17:79743311-79743333 CAGGTGGGGCAGGCTGAGGTGGG - Intergenic
1152447930 17:80356603-80356625 CTGGACAGGCAGGCAGAGTTCGG - Intronic
1152723323 17:81933377-81933399 CTAGAGAGGCAGGGAGAGGTTGG + Intronic
1152742004 17:82022568-82022590 CTGCAGAAACAGGCAGGGGTGGG - Intronic
1152928056 17:83096897-83096919 CTGAAGCAGCAGGCTGGGGCTGG + Intergenic
1152945634 17:83196068-83196090 CTGGGGGAGGAGGCTGGGGTGGG - Intergenic
1153041461 18:816296-816318 CTAGAGGAGCAGGCTCAGGCAGG - Intergenic
1154003022 18:10500963-10500985 CTGAGGCAGGAGGCTGAGGTGGG - Intergenic
1155441231 18:25864832-25864854 CTGGATCAGTAGGCTTAGGTTGG - Intergenic
1155815815 18:30307962-30307984 CTGGAGAAAAAGGAAGAGGTGGG + Intergenic
1155819688 18:30359728-30359750 CTGCTGAACCAGGTTGAGGTGGG - Intergenic
1156281675 18:35645339-35645361 CTTGGGAAGGAGGCTGAGGCAGG - Intronic
1156359308 18:36370178-36370200 TGGTGGAAGCAGGCTGAGGTGGG - Intronic
1156789351 18:40952903-40952925 CTGGGTTAGCAGGCAGAGGTTGG + Intergenic
1157760602 18:50261501-50261523 CTGTTCAAGGAGGCTGAGGTGGG - Intronic
1157867297 18:51197512-51197534 CAGGGGAAGGAGGCAGAGGTAGG + Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158082940 18:53615728-53615750 CAGGGTAAGCAGGCTGTGGTTGG - Intergenic
1158092279 18:53728175-53728197 CTGGGTAAACAGGCAGAGGTTGG - Intergenic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1159882163 18:73868475-73868497 CTGAAGCAGCAGCCTGAAGTGGG - Intergenic
1160010708 18:75105533-75105555 CTGGGGAAGAGAGCTGAGGTTGG + Intergenic
1160027021 18:75226914-75226936 CTGTTGCAGCGGGCTGAGGTGGG - Intronic
1160116090 18:76080986-76081008 CTGGAGAAGCAACATGAGTTGGG + Intergenic
1160121117 18:76131177-76131199 CTGGAGAGGCAGGCAGGGGCCGG - Intergenic
1160139789 18:76311239-76311261 CTGGAGAAGCAGACACAGCTCGG - Intergenic
1160622981 18:80183577-80183599 CTGATGAAGCAGGATGAAGTGGG - Intronic
1161398240 19:4056069-4056091 CTGGGGAAACAGGCTGGGGGAGG - Intronic
1161433238 19:4246526-4246548 CTGGGGAAGGAGGCTGGGGAAGG + Intergenic
1161448909 19:4333715-4333737 CCGGAGAATCAGGCTGAAGTGGG + Exonic
1161509589 19:4663113-4663135 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161509719 19:4663640-4663662 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162748233 19:12811504-12811526 CTGGAGGAGGAGGCTAAGGTGGG + Intronic
1162988671 19:14288348-14288370 CGGGAGAGGCAGGCTGAGCAGGG + Intergenic
1163326139 19:16604525-16604547 CTGGATGTGCAGGCTGAGGCTGG + Intronic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1164837656 19:31367928-31367950 CTATTGAAGGAGGCTGAGGTGGG - Intergenic
1165110412 19:33498914-33498936 CTGGAGGGGCAGCCTGGGGTGGG - Intronic
1165524085 19:36338111-36338133 CTGTAGTCCCAGGCTGAGGTGGG - Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166476654 19:43131596-43131618 CTGGAGCAGCAGGCTCACCTGGG - Intronic
1166575423 19:43832914-43832936 CTGGGGATGGAGGCTGAGGTAGG + Intronic
1166661822 19:44652302-44652324 CAGGAGACTGAGGCTGAGGTGGG - Intronic
1166724699 19:45019749-45019771 CTGGAGATGGAGGTTGCGGTGGG - Intronic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1167306362 19:48712297-48712319 CTGCAGGATTAGGCTGAGGTTGG + Intergenic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167751878 19:51385775-51385797 CTGGAGAGGTAGACTGAGGCAGG - Intronic
1168266694 19:55227439-55227461 CTGGAGCACAAGGCTGAGGTAGG + Exonic
1168277924 19:55287323-55287345 CTGGAGAGGGAGGATGGGGTAGG - Intronic
1168296017 19:55377653-55377675 CCGGAGACGCAGGCAGAGGTTGG - Exonic
1168321317 19:55511723-55511745 CTGGAGAAGCTGGCAGGGGCTGG + Intronic
1168346498 19:55652582-55652604 CCCGAGAAGCTGGCCGAGGTGGG + Exonic
1168380151 19:55913436-55913458 TTGCAAAAGGAGGCTGAGGTAGG + Intronic
1168482426 19:56732725-56732747 CTGGAAATACAGGATGAGGTTGG + Intergenic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
926807480 2:16724428-16724450 GATGAGAAGCAGGCTGAGATGGG + Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927381663 2:22486510-22486532 CTGGAGAAGCAAGCGGTGGGGGG - Intergenic
927683390 2:25154749-25154771 CTGGGGAAGGAAGCTGAGATGGG + Exonic
927891355 2:26751953-26751975 CTGTAGTCCCAGGCTGAGGTGGG - Intergenic
927899957 2:26812065-26812087 CTGGAAGACCAGGATGAGGTTGG + Intergenic
928219953 2:29395360-29395382 CTGGAGGAGCCTGGTGAGGTGGG + Intronic
928309478 2:30197625-30197647 CTGGAGAAACTGGCTCAGGCAGG + Intergenic
928443737 2:31314902-31314924 CTGGAGGAGCAGGCTTGGGGAGG - Intergenic
929996118 2:46827170-46827192 GTGGGGAAGCAGGCAGAGGGAGG + Intronic
932110189 2:68992298-68992320 CAAGAGAAGCATGCTGATGTAGG - Intergenic
932215258 2:69962129-69962151 CTGGAGAGGGAGGCAGAGGAGGG + Exonic
932323413 2:70838316-70838338 ATGGAAATGCAGGCTGAGGTAGG + Intergenic
932417275 2:71581055-71581077 CTGGAAAAGCAGGCGTAAGTAGG + Intronic
932429615 2:71666280-71666302 CTGTAAAAGCAGGCAGATGTTGG - Intronic
933182787 2:79245950-79245972 ATGAAGAAGCAGGCTGGGTTTGG - Intronic
933210884 2:79567685-79567707 CTGGAGTTGCAGCCTGAGATTGG + Intronic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
933276536 2:80290100-80290122 CTTGTGAAGCAGGCTGAGCAAGG + Intronic
933834956 2:86238584-86238606 CTGATGCATCAGGCTGAGGTGGG - Intronic
934776090 2:96938403-96938425 CTGGAGATGCCTGCTGAGCTGGG + Intronic
935585140 2:104793796-104793818 CTTGGGCAGGAGGCTGAGGTGGG + Intergenic
935702051 2:105821399-105821421 CGGCAGAAGGAGGCTGAGATGGG - Intronic
936462815 2:112724692-112724714 GGGGAGAGGCAGGCTGTGGTGGG + Intronic
936472539 2:112811740-112811762 CTTGGGAAGCAGGCTCAGGTAGG + Intergenic
937341791 2:121095936-121095958 CTGGGGAACCAGTCTGAGGCCGG + Intergenic
937485861 2:122314191-122314213 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
938422965 2:131158493-131158515 CTACAGATGGAGGCTGAGGTGGG + Intronic
938493736 2:131780194-131780216 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
938556609 2:132430356-132430378 CTGGAAAGGCAGGCTGGGGGTGG + Intronic
938695900 2:133835318-133835340 CTGTAGGATCAGGCTGAGGCTGG - Intergenic
939376860 2:141379958-141379980 CTTCAGGAGCAGGCTGAGGAAGG - Intronic
939395124 2:141619145-141619167 CAAGAAAAGCAGGTTGAGGTGGG - Intronic
939782445 2:146465448-146465470 GTGGAGTAGCTGGCTGAGTTTGG + Intergenic
940655924 2:156487730-156487752 CTGGAGAGTAAGTCTGAGGTTGG - Intronic
942250568 2:174044167-174044189 CAGGAGAAGGAGGTTGTGGTGGG + Intergenic
942321755 2:174742149-174742171 CTGGGGAAGGAGGCAGAGGGAGG - Intergenic
942792613 2:179778015-179778037 CTTGACAGGGAGGCTGAGGTGGG - Intronic
943407231 2:187505227-187505249 TTCAGGAAGCAGGCTGAGGTTGG + Intronic
943563912 2:189495415-189495437 CTTGAGTAACAGGCAGAGGTTGG + Intergenic
944566643 2:200998183-200998205 CTGGAGAGGAAGGATGAGGGTGG - Intronic
944703996 2:202270651-202270673 CTGCTGCAGGAGGCTGAGGTGGG + Intronic
944798815 2:203215395-203215417 CTGGAGGTGGAGGCTGAGGCAGG + Intronic
944822391 2:203443896-203443918 GTGAGCAAGCAGGCTGAGGTGGG + Exonic
944822593 2:203445652-203445674 CTGAGCAAGGAGGCTGAGGTGGG + Exonic
945998589 2:216461720-216461742 CTTGGGTAGGAGGCTGAGGTGGG + Intronic
946928116 2:224645667-224645689 CTGGAGTGACAGGCTCAGGTGGG + Intergenic
947594082 2:231399932-231399954 CTGGAGAAGCAGGGTGCGGTGGG - Exonic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
947932943 2:233978979-233979001 CTGAAGAAGCAGAGTGATGTGGG + Intronic
948056716 2:235014191-235014213 CTGAAGGATCAGGCTGATGTCGG - Intronic
948939129 2:241187529-241187551 CTGGAACAGCAAGCTGAGCTTGG + Intergenic
1169238912 20:3957901-3957923 GTGGAGAATCAGGCTGAGACTGG - Intronic
1169677083 20:8166413-8166435 CTGGAGAGGTAGGAAGAGGTAGG - Intronic
1170006781 20:11678149-11678171 CAGCAGAAGCAAGCTGAGTTTGG + Intergenic
1170493729 20:16904162-16904184 CTGGAGAGAGAGGGTGAGGTGGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171219757 20:23384508-23384530 CTGGAGGCTAAGGCTGAGGTGGG + Intronic
1171449392 20:25225262-25225284 CTGGAGTAGCAGGCTGACGTAGG - Exonic
1171461256 20:25299287-25299309 CTTGGGAGGCAGGCTGAGGTGGG + Intronic
1171824065 20:29878625-29878647 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1171992635 20:31708497-31708519 CTGGAGAAGCCAGCTGTGGCTGG + Intronic
1172068336 20:32237538-32237560 CTGGAGAGGCAGGCATAGGCAGG + Exonic
1172147611 20:32767790-32767812 CCAGAGCAGCAGGCTGAGGGAGG + Intronic
1172372926 20:34409481-34409503 CTTGAGAAAAAGGCTGAGATGGG - Intronic
1172450581 20:35019958-35019980 GTGGAGGAGCAGGCTTAGGGAGG - Intronic
1172537489 20:35685265-35685287 CTCAGGAAGGAGGCTGAGGTGGG + Intronic
1172577814 20:36022740-36022762 CTGTAGTCCCAGGCTGAGGTGGG - Intronic
1172595875 20:36150931-36150953 CTGGGCAAGCAGGGTGGGGTGGG - Intronic
1172849214 20:37948511-37948533 CAGGAGAGGGAGGCTGAGGCAGG + Intergenic
1173001570 20:39109517-39109539 CGGGAGGAGGAGGGTGAGGTGGG + Intergenic
1173080944 20:39866868-39866890 TTGGACAAGGAGGCTGAGATTGG + Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1174057614 20:47809549-47809571 CTGGGGAAACAGGCTCAGGGAGG + Intergenic
1175278343 20:57787139-57787161 CAGGAAAGGCAGTCTGAGGTGGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1176614170 21:9014182-9014204 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1177677794 21:24324623-24324645 CTGGAGATGAAGTCAGAGGTGGG + Intergenic
1177854933 21:26390160-26390182 CTGGAAGAGCATGATGAGGTGGG - Intergenic
1177953271 21:27565851-27565873 CTGGAGAACCAAGCTGAGGCTGG - Intergenic
1178250284 21:30997376-30997398 GTGGAGATGGAGGCAGAGGTTGG - Intergenic
1178424732 21:32470380-32470402 CTGCAAAAGCAGGCTGGTGTGGG + Intronic
1178619039 21:34158403-34158425 CGGGAGAAGGTGGCTGAAGTGGG + Intergenic
1178977960 21:37236241-37236263 CTGGACCCGCAGGCTGAGGCTGG + Intronic
1179311366 21:40198742-40198764 CTGGAGAGGCAGTGGGAGGTGGG + Intronic
1179551449 21:42146435-42146457 CTGGGGAGGAAGGCTGTGGTGGG + Intergenic
1179551495 21:42146597-42146619 CTGGGGAGGAGGGCTGAGGTTGG + Intergenic
1179898738 21:44377971-44377993 CTGGAGGAGGAGGCTGGGCTTGG + Intronic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1180145032 21:45914057-45914079 CTGCAGTAAAAGGCTGAGGTTGG - Intronic
1180497939 22:15906244-15906266 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
1180622796 22:17172811-17172833 CTGGAGAGGCAGGCTGAGGCGGG + Intergenic
1180723547 22:17927598-17927620 CTGGAGCAGCAGGCAGATGTCGG - Intronic
1181041929 22:20196410-20196432 CTGGAGACGCAGGTGCAGGTGGG - Intergenic
1181138099 22:20783503-20783525 CTGGGGAGGGAGGCTGAGGCAGG + Intronic
1181645765 22:24231269-24231291 ATGGAGGAGGAGGCTGAGCTGGG + Intronic
1181910055 22:26231445-26231467 ATTGAGAATCAAGCTGAGGTAGG - Intronic
1182044536 22:27264046-27264068 TTGGATAAGCAGGCTGAAATCGG + Intergenic
1183269229 22:36850287-36850309 CTGGGGAAGGTGGCTGAGGTTGG + Intergenic
1183293074 22:37014724-37014746 CTGGAAAAGGAGACTGAGGCTGG + Intronic
1183815800 22:40299180-40299202 CTGGGGAGGCAGGCAGAGCTGGG + Intronic
1184274306 22:43401415-43401437 CAGGAGTAGGAGGGTGAGGTGGG + Intergenic
1184715598 22:46280118-46280140 CAGGAAAAGCAGGCTGTGATGGG + Intronic
1185063570 22:48619801-48619823 CTGGAGCGGCATGCTGGGGTGGG + Intronic
1185079845 22:48703638-48703660 CGGGAGAAGGACGCTGAGGGTGG - Intronic
1185346611 22:50313351-50313373 CTGGAGCAGGAGGCTGTGGCTGG - Intronic
949517935 3:4824187-4824209 CTGGAGGAGCAGTCTGTGCTGGG + Intronic
949654967 3:6207265-6207287 CTGGAGAAGCATGGTGAAGATGG - Intergenic
949855502 3:8457579-8457601 ATGGATAAGGAGGCTGAGGCGGG + Intergenic
950103150 3:10370540-10370562 CTGGAGCAGCAGGCTAAGGGAGG - Intronic
950885970 3:16363036-16363058 CTGGAGCATTAGGCTGAGGTGGG - Intronic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
951553994 3:23902602-23902624 TTGGAGAGGCAGGTGGAGGTGGG - Intronic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
952258375 3:31714831-31714853 CTGGAGCAGAAGGATGAGCTGGG - Intronic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
953906124 3:46869075-46869097 CTGGACCAGCAGGCAGAGCTGGG - Intronic
953926757 3:46986458-46986480 CTGGAGAAGCAGGTTCTGGTTGG + Intronic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
955118766 3:56033905-56033927 CTGTAGGTGGAGGCTGAGGTGGG - Intronic
955373853 3:58377530-58377552 CTCGAGAGGCAGGCTGAGGTGGG + Intronic
955772087 3:62395229-62395251 CTGGAGAAGTAGGCAAGGGTTGG + Intergenic
955797089 3:62648572-62648594 CTTGGGAGGCTGGCTGAGGTGGG + Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956321090 3:67997049-67997071 CTGGAAAAGCAAGCTGAGTTAGG + Intergenic
956747653 3:72322388-72322410 CTGGATAGCGAGGCTGAGGTGGG - Intergenic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
958124408 3:89336936-89336958 CTGTTGACCCAGGCTGAGGTGGG + Intronic
958982631 3:100741184-100741206 CTGTAGAACCAGGCTCAGATAGG + Intronic
959038210 3:101389247-101389269 CTGGATTTGAAGGCTGAGGTGGG - Intronic
959883744 3:111475164-111475186 CTGGGAAAGCAGGCTCAGGATGG - Intronic
961053763 3:123768900-123768922 CTGGAGAAGCAGGCAGAGAGGGG - Intronic
961172695 3:124809442-124809464 CTGGAGAAGCAAGCAGGGGATGG - Intronic
961362477 3:126376643-126376665 GTGAAGAAGCCGGCTGGGGTTGG - Intergenic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
961633372 3:128317789-128317811 CTGGAGCAGAAGGCTGAAGGGGG - Intronic
961648675 3:128406352-128406374 CTGGGGGTGCAGGCTGGGGTGGG + Intronic
962009046 3:131376036-131376058 CTGGAGAACAAGGATGAGGCAGG + Intergenic
963009492 3:140755891-140755913 GTGGAGATGGAGGCAGAGGTTGG - Intergenic
963184865 3:142403089-142403111 CTTGAGTACCAGGCTGAGTTTGG - Intronic
963866365 3:150366430-150366452 CTGGAGGAGGGGGTTGAGGTGGG - Intergenic
966405026 3:179587744-179587766 CTGGAGTCCCAGGCTGAGGTGGG + Intronic
966863552 3:184243814-184243836 CAGCAGGAGCAGGGTGAGGTGGG + Exonic
967033143 3:185626965-185626987 CTAGGGAGGCAGGCTGAGGCAGG + Intronic
967154544 3:186680559-186680581 CTGGGCATGGAGGCTGAGGTGGG + Intergenic
967914608 3:194569345-194569367 GTGGTGCAGGAGGCTGAGGTGGG + Intergenic
967980343 3:195061585-195061607 CTGGGAAAGGAGGCTGAGCTGGG + Intergenic
968077078 3:195821865-195821887 CTGGAGGAGCAGGGTGAGAGAGG + Intergenic
968186293 3:196635198-196635220 CTGGAAAAGCAGTCAGGGGTCGG + Intergenic
968239484 3:197064032-197064054 CTGGCTAAGGAGGCTGAGGCAGG - Intronic
968456379 4:702688-702710 TTGGGGAAACAGGCAGAGGTGGG + Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
969279108 4:6157626-6157648 CTGGGGAAGATGGCTGAGCTGGG - Intronic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
969832065 4:9805914-9805936 CTGGTGAAGAATGCTGAGGCAGG + Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970866937 4:20770092-20770114 CAGAAGAAGCAGGCTGTGGGAGG - Intronic
971286212 4:25292263-25292285 CTCCAGAATGAGGCTGAGGTAGG - Intergenic
971287745 4:25306740-25306762 CTGTATGAGCAGGCTGAGGCTGG + Intergenic
971473918 4:27054947-27054969 CTGGATAAGCAACCTGCGGTGGG + Intergenic
971896796 4:32606485-32606507 CTGGAGCAGGAGGATGGGGTGGG + Intergenic
972495828 4:39633573-39633595 CTGTAGAGACAGGCTCAGGTTGG - Intronic
974036515 4:56822503-56822525 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
974075547 4:57165185-57165207 CTGAGGGAGCAGGCTGAGGTAGG + Intergenic
974311369 4:60214608-60214630 CTTGAAAGGAAGGCTGAGGTGGG - Intergenic
974635433 4:64558248-64558270 CTGAAGTTGGAGGCTGAGGTGGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975336570 4:73183564-73183586 GAAGAGAAGGAGGCTGAGGTGGG - Intronic
975561265 4:75710250-75710272 CTCGAGAAGCAGGCTGGGTGTGG - Intronic
975646547 4:76551599-76551621 CTGGAGAGGCATGCTGGGGGAGG + Intronic
975927119 4:79470536-79470558 CTGGAGATGCATGGTGAGGATGG - Intergenic
976790287 4:88870651-88870673 CTGCAGAGGCAGGCTGCGGTAGG - Intronic
977818794 4:101447454-101447476 CTAGAGAAGCAGGATGCAGTAGG + Intronic
978241460 4:106521497-106521519 CTGGAGGGGGAGGCTGAGGTGGG - Intergenic
979067659 4:116158344-116158366 CAGAAGAAGCAGGCCAAGGTGGG + Intergenic
980572553 4:134639628-134639650 CTGGATAAGCAGTTTGATGTTGG - Intergenic
981055902 4:140361045-140361067 TGGGAGAAGCAGGCTGGGATGGG + Intronic
981104179 4:140862089-140862111 TTGGAGAAGCAGGGTAATGTGGG - Exonic
981308760 4:143274866-143274888 CAGGAGATGGAGACTGAGGTAGG + Intergenic
981363834 4:143878244-143878266 CTTGGGAGGCTGGCTGAGGTGGG - Intronic
981374565 4:143999016-143999038 CTTGGGAGGCTGGCTGAGGTGGG - Intronic
981384889 4:144118325-144118347 CTTGGGAGGCTGGCTGAGGTGGG - Intronic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
981913382 4:150008185-150008207 CTGGAGAAGCAGGGAGGGGGGGG - Intergenic
982080334 4:151783485-151783507 ATGAAGAAGTAGGCAGAGGTGGG - Intergenic
983029715 4:162784723-162784745 CTGGAGATGAAGTCTGAGGGAGG + Intergenic
984103548 4:175516267-175516289 TTGAAGAAACAGGCTTAGGTTGG - Intergenic
984269542 4:177534208-177534230 CTGGAGAAGCAGGAGGGAGTAGG + Intergenic
984653785 4:182296023-182296045 CAGGAGGTGGAGGCTGAGGTGGG - Intronic
984705026 4:182841359-182841381 CAGGTGAAGGAGGCTGAGATTGG + Intergenic
985124239 4:186675643-186675665 CTGTAGCTCCAGGCTGAGGTGGG + Intronic
985209465 4:187576894-187576916 CTTTAGAAGCAGGCTGTGCTGGG + Intergenic
985443292 4:190001035-190001057 TTGGATAAACAGGCAGAGGTTGG - Intergenic
985664794 5:1176503-1176525 CTGGAGAGGCCGACTGCGGTCGG + Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
985886331 5:2682696-2682718 CTGGGGAAGGCTGCTGAGGTGGG - Intergenic
985984782 5:3505599-3505621 CGGCTGAAGCAGGCTGAGCTGGG + Intergenic
986142225 5:5041481-5041503 CTGGAGAAGCTTGCTTTGGTGGG + Intergenic
986277981 5:6297367-6297389 TAGAAGAAGAAGGCTGAGGTGGG - Intergenic
986285308 5:6354524-6354546 CGGGAGAAGGAGGCAGAGGCTGG + Intergenic
987909479 5:24123055-24123077 ATGAAAAACCAGGCTGAGGTGGG - Intronic
988042947 5:25911609-25911631 CTGAAGAAGAAGGCAGTGGTAGG - Intergenic
988643161 5:33064275-33064297 CAGTAGAAGGAGGCTGAGGTGGG - Intergenic
988987957 5:36639096-36639118 CTGGAGAAGCAGTGTGTGGTAGG + Intronic
989255403 5:39361271-39361293 CTGTAGAGGTAGGATGAGGTGGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
991013335 5:61906708-61906730 CTGCAGAAGCCAGGTGAGGTGGG + Intergenic
991374891 5:65956486-65956508 CTGCAGTCCCAGGCTGAGGTGGG - Intronic
991956320 5:71998806-71998828 GAGGAGAAGGAGGCTGAGGTAGG + Intergenic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992106638 5:73453465-73453487 CTGAAGAAGCAGGGTGGGGGAGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
994736890 5:103566681-103566703 CAGGAGAATGAGGCTGAGGCAGG + Intergenic
997260638 5:132463257-132463279 CTGGGGAAGGAGGCTGTAGTTGG - Exonic
997459174 5:134040613-134040635 CTGTGGAGGCAGGCTGAGGCAGG + Intergenic
997513543 5:134468909-134468931 GTGTAAAAGCAGGCTGAGATGGG + Intergenic
998356363 5:141540226-141540248 CTCGAGAAGGAGGCTGAGACAGG - Intronic
999689441 5:154134102-154134124 CTGGAGACCCAGGCTCAGCTGGG + Intronic
1000639641 5:163686313-163686335 CCGGAGAACCAAGCTGAGGAAGG + Intergenic
1001237808 5:170044821-170044843 ATGGAGAAGCTGGGGGAGGTAGG - Intronic
1001342161 5:170857410-170857432 CTAGAAAAGCTGGGTGAGGTCGG + Intergenic
1002012937 5:176298385-176298407 CTGGAGTGGGAGGCTGAGATGGG + Intronic
1002214902 5:177624351-177624373 CTGGAGTGGGAGGCTGAGATGGG - Intergenic
1003097237 6:3151989-3152011 CTTGAGCAGCAGGCTGGGGATGG + Intronic
1003755027 6:9108523-9108545 CTGTTGAAGCAGTCTGAGCTTGG - Intergenic
1003968023 6:11271810-11271832 CTGGAGAAAATGGCTGAGATTGG - Intronic
1004173919 6:13322140-13322162 CTGAAGTGGGAGGCTGAGGTGGG + Intronic
1004470746 6:15926907-15926929 CTCAAGATGAAGGCTGAGGTGGG + Intergenic
1006212712 6:32411185-32411207 CTTGTGAAGCAGGCTGAGTGAGG - Intergenic
1006793477 6:36718101-36718123 CAGCAGCTGCAGGCTGAGGTGGG + Exonic
1006913131 6:37577198-37577220 CTGTGGAGTCAGGCTGAGGTTGG - Intergenic
1007372084 6:41432555-41432577 GTGGAGCAGGAGGCTGGGGTGGG - Intergenic
1008118314 6:47579389-47579411 CTGGAGAAGCTGGCTGGTGGAGG + Exonic
1008811137 6:55500774-55500796 CTGGAGAAGGTGGCTAAGGATGG + Intronic
1009979406 6:70709447-70709469 CTGCAGTCGCAGGCTCAGGTGGG - Intronic
1010423469 6:75700596-75700618 CTGGGGTTGGAGGCTGAGGTGGG - Intronic
1011460075 6:87593768-87593790 CTGGAGATGGAGGCTGCAGTGGG - Intronic
1011600614 6:89056742-89056764 CTGGGTCAGGAGGCTGAGGTAGG + Intergenic
1011761967 6:90576873-90576895 CTGGAGGGACAGGCAGAGGTTGG + Intronic
1011866448 6:91834658-91834680 AAGGAGAAGCAGGCAGAGATAGG + Intergenic
1012097280 6:94978124-94978146 CTGGGTAAACAGGCAGAGGTTGG - Intergenic
1012258286 6:97059123-97059145 GTGGAGACCCAGGATGAGGTAGG + Intronic
1012910464 6:105112120-105112142 CTGATGTAGCAGGCTGGGGTGGG - Intronic
1012961175 6:105623476-105623498 CTTGTGAAGGAGGTTGAGGTGGG - Intergenic
1013364843 6:109429265-109429287 GTGCAGAAGCAGGCTGGAGTAGG - Intronic
1013910408 6:115269775-115269797 CTGTAGAAGCAGGCAGCTGTGGG - Intergenic
1015886156 6:137920832-137920854 CTGAAGGAGAAGGCTGAGCTAGG - Intergenic
1016174328 6:141060208-141060230 TTTGAGAACCTGGCTGAGGTAGG - Intergenic
1017024968 6:150173576-150173598 CTGCAGAAGAAGGCTGAAATTGG - Intronic
1017721272 6:157244937-157244959 GCAGAGAAGCAGGCTCAGGTGGG + Intergenic
1018082492 6:160270521-160270543 GTGGAGATGCAGGCAGAGGCTGG + Intronic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1018361483 6:163074880-163074902 CTGGAGTGGGAGGCTGAGGTGGG + Intronic
1018740539 6:166725473-166725495 CTGGAGAAAGAGGCTGGGCTGGG - Intronic
1018926930 6:168213017-168213039 TTGGAGCAGGAGGCTGAGATAGG + Intergenic
1018988890 6:168658531-168658553 CTGTAGCACCAGGCTGAGGAGGG - Intronic
1019215218 6:170438908-170438930 CTGGAGGAGCAGGCTGGGGGTGG + Intergenic
1019416957 7:932256-932278 CTGGAGAGGAAGGCTGGGGAGGG - Intronic
1019485858 7:1288915-1288937 CAGGACAAGCAGGCCGATGTCGG - Intergenic
1019497440 7:1347039-1347061 GCTGAGAGGCAGGCTGAGGTCGG - Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1019729545 7:2622670-2622692 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019729556 7:2622695-2622717 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019907724 7:4077346-4077368 CTGGAGAATGGGGCTGAAGTGGG - Intronic
1020545029 7:9517074-9517096 CTGGAATGGCTGGCTGAGGTGGG - Intergenic
1022377634 7:29829322-29829344 CTTGGGAGGCTGGCTGAGGTGGG - Intronic
1022478124 7:30725207-30725229 ATGGAGACGCAGGCAGAGGTTGG + Intronic
1022482487 7:30753017-30753039 CTGGAGGAGCAGGCCGGTGTGGG + Intronic
1022530886 7:31066199-31066221 ATGGAGGATCAGGCTGAGGTGGG + Intronic
1023262865 7:38375640-38375662 CTGGAGAAGAAGGCTGCTGCGGG + Intergenic
1023370974 7:39511989-39512011 CTGGTGAAGAAGGTTGGGGTGGG - Intergenic
1023777795 7:43625788-43625810 CAGCAGAAACAGGCTGTGGTTGG - Exonic
1023988547 7:45112976-45112998 TTGGTCAAGCTGGCTGAGGTGGG + Intergenic
1024954162 7:54898736-54898758 CTGGAGAAGCAGGTCGTGCTCGG - Intergenic
1026380207 7:69791964-69791986 CTGGAGTAGGAGGCTGGGGAAGG + Intronic
1026405994 7:70065952-70065974 CCTGAGAAGGAGGCTGAGGCAGG - Intronic
1026699284 7:72625548-72625570 CAGGAGCGGGAGGCTGAGGTGGG + Intronic
1026735328 7:72945386-72945408 TGGGAGAAGCAGGCTGAGCTGGG + Intronic
1026766084 7:73160736-73160758 CTGGAGAGACAAGGTGAGGTGGG - Intergenic
1026785668 7:73300316-73300338 TGGGAGAAGCAGGCTGAGCTGGG + Intergenic
1027042559 7:74970432-74970454 CTGGAGAGACAAGGTGAGGTGGG - Intronic
1027081084 7:75231925-75231947 CTGGAGAGACAAGGTGAGGTGGG + Intergenic
1027108398 7:75419620-75419642 TGGGAGAAGCAGGCTGAGCTGGG - Intronic
1027250737 7:76397435-76397457 CTGGAGGAGGAGGCTTCGGTGGG - Intronic
1028231807 7:88314633-88314655 CTTTAGAAGCAGGGGGAGGTAGG + Intergenic
1028548994 7:92035793-92035815 TGGGAGAAGCAGGCTGTAGTGGG + Intronic
1029431995 7:100537305-100537327 TGGGAGATGGAGGCTGAGGTGGG + Intergenic
1029479081 7:100802203-100802225 CTGGAGAGGGAGGCTGGGGCAGG - Intergenic
1029821255 7:103149553-103149575 CTGGAGAGGCAGCCTGAAGGAGG - Intronic
1030091461 7:105862325-105862347 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1030127680 7:106169763-106169785 CTGAGGTAGGAGGCTGAGGTAGG + Intergenic
1032090919 7:128911057-128911079 CAGAAGAAGCAGACTGAGCTGGG + Intergenic
1032131357 7:129230984-129231006 CTGAGAAAGCAGCCTGAGGTGGG + Intronic
1032555932 7:132835080-132835102 CTGGGGAGGGAGGCTCAGGTGGG - Intronic
1033074294 7:138234149-138234171 CTTGGGAGGAAGGCTGAGGTGGG + Intergenic
1033741226 7:144277208-144277230 CTGGAGCAGCAGTTTGAGGCGGG + Intergenic
1033752677 7:144372406-144372428 CTGGAGCAGCAGTTTGAGGCGGG - Exonic
1033807872 7:144975313-144975335 CATGAGAAGCAGGATGGGGTGGG + Intergenic
1033965832 7:146974197-146974219 CTGGGCAGGGAGGCTGAGGTGGG + Intronic
1034069901 7:148174424-148174446 CTGAAGCACCAGCCTGAGGTGGG - Intronic
1034523034 7:151635453-151635475 ATGGTGAAGCGGGCTGTGGTAGG + Intronic
1035233226 7:157479030-157479052 CCGGTGGAGCAGGCTGAGGAGGG + Intergenic
1035300392 7:157893590-157893612 CGGGAGAAACAGGCTGCGGCAGG + Intronic
1035609138 8:948685-948707 CTGGAGCAGCAGGGAGACGTGGG - Intergenic
1035756640 8:2037724-2037746 CTGCAGAAGCATGATCAGGTGGG + Intergenic
1035831115 8:2695304-2695326 CTGAAGAAGAAGGCAGAGGTTGG - Intergenic
1036096895 8:5734165-5734187 CTGCAGAAGCAGGCTTGGGCTGG - Intergenic
1036544092 8:9749714-9749736 CTGAGGAAGGAGGCTGAGGGAGG - Intronic
1036619653 8:10416077-10416099 CTGGGGAAGCAGGCTCAGGCAGG - Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1037130384 8:15401763-15401785 CTGTAAAAGCAGGCTGATATAGG - Intergenic
1037316996 8:17608497-17608519 CTGGGGAAGGAGGCAGAGGGAGG + Intronic
1037497639 8:19455717-19455739 CTGGAGCAGGAGGCTGAGTAGGG - Intronic
1037879620 8:22566346-22566368 CTGGAGCTCCAGGCTGAGGCCGG - Exonic
1038692821 8:29778677-29778699 CCGGAAAAGGAGGCTGAGATAGG + Intergenic
1038785620 8:30612636-30612658 CAGGAGAGGGAGGCTGAGGCAGG - Intronic
1038888390 8:31691027-31691049 CTTGAGAATGAGACTGAGGTTGG + Intronic
1038939773 8:32291648-32291670 CTTGAGAGGAAGGCTGAGGCAGG - Intronic
1038972894 8:32657357-32657379 CTGGAGAAGAAGGAATAGGTGGG - Intronic
1039318845 8:36405578-36405600 CTGGGGAATCAGGCTGAGAGAGG + Intergenic
1039734823 8:40320543-40320565 CCTGAGAAGCAAGCTGAGGCTGG + Intergenic
1039862228 8:41468866-41468888 CTGGAGAGACAGGGTGAGGCTGG - Intergenic
1039965380 8:42280253-42280275 CAGGGGAAGCAGGTTGTGGTGGG - Intronic
1040625840 8:49149229-49149251 CTGGGGCAGCATTCTGAGGTGGG + Intergenic
1041305003 8:56448594-56448616 CAGGAGCGGGAGGCTGAGGTAGG + Intergenic
1042235896 8:66613107-66613129 CGGGAGAAGCCGGCGGAGGGCGG - Exonic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1044857701 8:96493670-96493692 CCGGAGAAGCAGGCTCAGGAGGG + Exonic
1044871199 8:96621609-96621631 CTGGAGAAGAATTCTGAGGTTGG - Intergenic
1045296007 8:100872159-100872181 CTGGAGAAGGGGGCTGGGGGTGG - Intergenic
1045931552 8:107633097-107633119 CTGGAGAAGCAGGCCCTGGAGGG + Intergenic
1046674710 8:117094839-117094861 CATGGGAAGGAGGCTGAGGTGGG - Intronic
1047602868 8:126444335-126444357 CTCCAGAAGGAGGCTGAGGCAGG - Intergenic
1047731605 8:127733478-127733500 CTGGGGTATCAGGCTGAGGTAGG + Intergenic
1049202744 8:141349913-141349935 CTGGAGAGGATGGTTGAGGTGGG + Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049415226 8:142491970-142491992 CAGGAGGAGCAGGCAGAGGCAGG + Intronic
1049675830 8:143888608-143888630 CTGAAGGAGCAGGGAGAGGTCGG + Intergenic
1049753100 8:144294934-144294956 GTTGAGAAGCTGGCTGAGGGAGG - Intronic
1049937107 9:509906-509928 CTCGGGAGGCAGGCTGAGGCGGG - Intronic
1049989479 9:977612-977634 CGGGAGAAGCCGGCTGAGTCTGG + Intronic
1050799864 9:9597143-9597165 CTGTGGAAGCAGGCTGAGGGTGG + Intronic
1051400094 9:16671662-16671684 TTTGAGAAGCAGGCTCTGGTTGG + Intronic
1051895248 9:21979788-21979810 CTGGAGAACCCAGCTGAGGGTGG + Intronic
1053109003 9:35440464-35440486 CTAGAGAAGCTGGTTTAGGTAGG + Intergenic
1053443640 9:38135596-38135618 CTGGAAAAGCAGGGTGAGGGGGG - Intergenic
1054337225 9:63817734-63817756 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057337092 9:94164813-94164835 ATGATGAAGTAGGCTGAGGTGGG - Intergenic
1057495036 9:95553846-95553868 GTGGAGAGGCAGGCAGAGATTGG + Intergenic
1057886626 9:98834576-98834598 CTGAAAAAGCAGCCTGAGGCTGG + Intronic
1059678693 9:116565578-116565600 CAGGAGACTGAGGCTGAGGTGGG - Intronic
1059750090 9:117239430-117239452 CCAGAGAAGCAGGCAGATGTTGG + Intronic
1060300720 9:122373165-122373187 GTGGAGCAGGAGGCTGAGGTTGG + Intronic
1060304919 9:122402749-122402771 CTGGTGAAGGAGGCAGAGCTTGG - Intergenic
1060371594 9:123078608-123078630 GTGCTGAACCAGGCTGAGGTGGG - Intronic
1060694827 9:125699742-125699764 CTGTAGTTCCAGGCTGAGGTAGG - Intronic
1061025881 9:128049146-128049168 GTGGAGAAGTTGGCTGAGGGCGG + Intergenic
1061917203 9:133761519-133761541 CTGAGGTAGGAGGCTGAGGTGGG - Intergenic
1062036437 9:134384645-134384667 CTGGAGGAAGAGGCTGCGGTGGG + Intronic
1062464190 9:136673973-136673995 CCAGGGCAGCAGGCTGAGGTGGG - Intronic
1062547137 9:137068971-137068993 CTGGAGAATATGGCTGAGGTGGG + Intronic
1203377132 Un_KI270442v1:385055-385077 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1185504707 X:623893-623915 CTGGAGACGCAGGCGGGGCTGGG - Intergenic
1186477615 X:9870150-9870172 CGGGAGGTGCAGGCTGTGGTGGG + Intronic
1186519770 X:10195081-10195103 CTGGTGAATCAGTCAGAGGTGGG + Exonic
1186552337 X:10519732-10519754 CTGGAGTAGATGGCTTAGGTAGG + Intronic
1187564562 X:20435586-20435608 CTGGAGAGGCACGGTGAGGGTGG + Intergenic
1188053077 X:25510296-25510318 CTGGGTAAACAGGCAGAGGTTGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188532326 X:31155881-31155903 CAGGAGGAGGAGGCTGGGGTGGG + Intronic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1189225459 X:39409666-39409688 CTTGAAAAGCAGGTAGAGGTCGG + Intergenic
1195221364 X:102747405-102747427 CTGTATAAGCAGGCTGACATAGG + Intronic
1195615814 X:106911079-106911101 CTTTAGAAGCAGGCCTAGGTTGG + Intronic
1195776157 X:108408202-108408224 CTCGGGAGGGAGGCTGAGGTGGG + Intronic
1195900380 X:109791300-109791322 CTTGAGAAGCAGGTTGAGAGAGG + Intergenic
1196024705 X:111029061-111029083 CAGGAGATGCAGGCTGCTGTGGG + Intronic
1196357308 X:114809628-114809650 CTGGATTGGGAGGCTGAGGTGGG - Intronic
1196761137 X:119202079-119202101 CTGGAGAAGAAGCTTTAGGTTGG - Intergenic
1197774867 X:130112036-130112058 CAGGAGAAGCAGGCCGATGCTGG - Intergenic
1198093003 X:133350410-133350432 CTAGTCAGGCAGGCTGAGGTGGG + Intronic
1199600629 X:149539565-149539587 CTGGAGATGCAGGGTGAGCAGGG - Intergenic
1200834329 Y:7718137-7718159 CTGGAGCATTATGCTGAGGTGGG - Intergenic
1201294348 Y:12450954-12450976 CAGGACCAGCAGACTGAGGTGGG + Intergenic