ID: 1157999074

View in Genome Browser
Species Human (GRCh38)
Location 18:52595005-52595027
Sequence TAAGACTACCTGAAGGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157999074 Original CRISPR TAAGACTACCTGAAGGATCA AGG Intronic
908832562 1:68193757-68193779 TAAGACTACCTCAAGGAACCTGG + Intronic
917595428 1:176524563-176524585 AAAGACTTCCTGAAGGAGGAAGG + Intronic
920439389 1:205969081-205969103 TGAGATTACCTGCAGAATCATGG - Intergenic
921334238 1:214070372-214070394 TCAGAGAACCTGAAGAATCATGG - Intergenic
922243900 1:223776500-223776522 GAAGGGTAGCTGAAGGATCAGGG + Intergenic
922533421 1:226362045-226362067 TAATGTTAGCTGAAGGATCAGGG + Exonic
924186338 1:241495237-241495259 TAAGCAAACCTGAAGGACCAGGG - Intergenic
1063678577 10:8164044-8164066 TAATTCTGCCTGAAGGATTAGGG + Intergenic
1064390092 10:14934679-14934701 TAAGTCTGCCTGGAGGAACAGGG - Intronic
1064581667 10:16799090-16799112 TAAGACTACGTGAGGGCTAAAGG + Intronic
1067319932 10:45208512-45208534 TAAGACTACGTGAGGGCTAAAGG + Intergenic
1071170165 10:82854969-82854991 AAAGGCTACCCAAAGGATCAAGG - Intronic
1076729367 10:132430846-132430868 TGAGTTTACCTGAAGGCTCAGGG - Intergenic
1079374111 11:19876750-19876772 TCAGCATACCTGGAGGATCAGGG - Intronic
1084533424 11:69742826-69742848 TAAGATGGCCTGCAGGATCAGGG + Intergenic
1085356640 11:75844091-75844113 TAACTCTACCTGCAGCATCAGGG - Intronic
1093539356 12:20262747-20262769 TAAGATTTGCTGAAGGATCATGG + Intergenic
1094585342 12:31772562-31772584 TGAGCCTGCCTGGAGGATCAAGG + Intergenic
1095451519 12:42336487-42336509 TAAGAATGCCTGGAGGCTCAGGG + Intronic
1095769361 12:45935532-45935554 TATGTCTAGCTGAAGGAACATGG - Intronic
1096872796 12:54604674-54604696 TGTGACTACAAGAAGGATCATGG - Intergenic
1097357968 12:58623277-58623299 TAGGACCACCTGAAGGCTCATGG - Intronic
1098932376 12:76434393-76434415 TAAAACTACCAGAAGGAAAAGGG + Intronic
1100810104 12:98329308-98329330 TAAGAGTGCTTGAAGGATCTTGG - Intergenic
1106154265 13:27137971-27137993 TAAGACTAAGTGAAGGCTCTAGG - Intronic
1110022605 13:70494121-70494143 AAATACTACCTGTAGGAACATGG + Intergenic
1111644337 13:91011447-91011469 TAAAACTGCATGAATGATCATGG - Intergenic
1113777844 13:112958823-112958845 TAAGAGCACCTGGAGGCTCAAGG + Intronic
1114201365 14:20524027-20524049 TGAGGATACCTGAAGGAACATGG - Intergenic
1115438745 14:33407420-33407442 TGAGACTAACTGAAGATTCAGGG - Intronic
1117505963 14:56403338-56403360 TAAGGCTTCCTGATAGATCATGG + Intergenic
1118144736 14:63123284-63123306 TAATACTAGCTGAAGGGTCAGGG - Intergenic
1121685069 14:95829681-95829703 GAATTCTACCTGGAGGATCAGGG - Intergenic
1127685158 15:61336321-61336343 TCAGCCTACTTGAAGGGTCATGG - Intergenic
1130894965 15:88162851-88162873 TCAGACTTCCAGGAGGATCAGGG + Intronic
1131997850 15:98148922-98148944 TTGGACAACCTGAAGGATTATGG + Intergenic
1135661250 16:24298874-24298896 CATGATTACATGAAGGATCATGG + Intronic
1140583336 16:76256818-76256840 AAAGTCTACCTGAAGCATTAGGG - Intergenic
1143050513 17:4121696-4121718 AAAGACAACCTGAAGGAGAATGG + Intronic
1143233047 17:5373885-5373907 TAAGGCTACGTGAAAGAACATGG - Intronic
1145912685 17:28551846-28551868 CAAGTCTTCCTGGAGGATCAGGG + Intronic
1146209409 17:30930426-30930448 TCAGACTACCTGAAGGACAGTGG + Intronic
1147494465 17:40902787-40902809 TAAGACTTCTTGAAGCATTATGG + Intergenic
1149306314 17:55349880-55349902 TTATACTAACTGAAGTATCAGGG - Intergenic
1154072935 18:11170332-11170354 TAAGACTCCTTGAAGAAACATGG + Intergenic
1156865627 18:41885921-41885943 TAAAACTACCTGAAGGACAGAGG + Intergenic
1157999074 18:52595005-52595027 TAAGACTACCTGAAGGATCAAGG + Intronic
1159270455 18:66142391-66142413 CATGAAGACCTGAAGGATCACGG + Intergenic
926098361 2:10097444-10097466 AAACACGACCTGAAGGAACAGGG - Intergenic
928466083 2:31523878-31523900 TGAGAATACCTGAATTATCAAGG + Exonic
928828187 2:35445677-35445699 TAAGACTAACTGCAGGGGCAGGG - Intergenic
930450308 2:51527619-51527641 TGAGCCTACCTGAATGATCCAGG + Intergenic
931514410 2:63037137-63037159 TAAGACTAGCAGGAAGATCAGGG - Intronic
937644186 2:124247874-124247896 AAAGACTACATGTAGGAACATGG + Intronic
938789686 2:134665551-134665573 TAATGCCACCTGGAGGATCAGGG + Intronic
943748551 2:191487493-191487515 TCAGACTACCAGAAGGCCCATGG - Intergenic
948240446 2:236428987-236429009 TAAGACTATATGAAGAATCAGGG - Intronic
1172721761 20:37004388-37004410 TAGGACTTCCTGAAAGATCCAGG - Intronic
1177165493 21:17598549-17598571 TAGGACTACCTGAAAGGTCCTGG + Intronic
1178367574 21:32000090-32000112 TATGCCTTCCAGAAGGATCAGGG - Exonic
1180963182 22:19771789-19771811 TCAGCCTAACTGAAGGATCTTGG + Intronic
1183777007 22:39972863-39972885 TAAGACATCCAGGAGGATCAAGG + Exonic
1184751844 22:46490840-46490862 TTGGACTGCCTGGAGGATCAGGG - Intronic
1185021490 22:48379334-48379356 TAAGAAGACATGAAGGATCTAGG + Intergenic
953046438 3:39297546-39297568 TAACACAACCTGAAAGTTCAGGG - Intergenic
953735543 3:45491325-45491347 TAATATTATCTGAAGGAGCAAGG + Intronic
958904814 3:99930187-99930209 TTAGACTACAAGAAGGATGAAGG - Intronic
959358164 3:105358283-105358305 CAAGACTACCTGATCAATCATGG + Intergenic
959551619 3:107665983-107666005 AAAGACTACATGAAGGTGCAAGG - Intronic
961707407 3:128798101-128798123 TAAGACTAAATGAACTATCAAGG - Intronic
962864809 3:139439423-139439445 TGAGACAACCTGAGGGCTCATGG - Intergenic
963177073 3:142310171-142310193 TAAGACTACTTTAAGAGTCATGG + Exonic
964877536 3:161385259-161385281 TAGGCCTTCCTGAAAGATCACGG - Intergenic
966500154 3:180630246-180630268 TAAAAGTTCCTGAAGGATAAAGG - Intronic
966512674 3:180781656-180781678 CAAAGCTACCTGAAGGAGCAAGG + Intronic
967470203 3:189852074-189852096 TAAGACTACATGAAGGCAGAGGG + Intronic
968312551 3:197696011-197696033 TAAGACTTCCTGAAGAAGCCTGG - Intronic
970169968 4:13279532-13279554 TAAGTCTACCTGAAGTCCCAAGG + Intergenic
970198980 4:13582661-13582683 TAGCACTACCTCAAGGGTCATGG - Exonic
971511895 4:27436785-27436807 TAGGATTACCACAAGGATCAAGG + Intergenic
973822906 4:54678400-54678422 TAAGGCAACGTGAAGGAGCAGGG - Intronic
975973438 4:80069961-80069983 TAAGACTACTTAAAGAGTCATGG + Intronic
977005322 4:91561489-91561511 AATGACTACATGAGGGATCAGGG - Intronic
979013672 4:115403585-115403607 TAAGACTACCTAATTGATCCAGG + Intergenic
992531604 5:77657901-77657923 TAATACTACCTCAAAGGTCAAGG - Intergenic
993959167 5:94275738-94275760 AAGGACTACCTGAGGGAGCAAGG - Intronic
995096541 5:108241675-108241697 AAAGACTACCTTAATGAACAAGG + Intronic
995895858 5:117009440-117009462 TAAGACAACCAGAACCATCAAGG - Intergenic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
1000530144 5:162409549-162409571 TAAGTCTACGTGAAGAATAATGG + Intergenic
1003130763 6:3393498-3393520 TAAGAGAACCTGCAGCATCAAGG - Intronic
1006416339 6:33906325-33906347 GAAGACAACCTGAAAGAGCAAGG - Intergenic
1007724482 6:43906781-43906803 TCACACTGCCTGAGGGATCATGG + Intergenic
1013233789 6:108178783-108178805 TAAAAGTACATGAAGAATCAAGG - Intronic
1013968458 6:115985153-115985175 GAACACTCCCTGCAGGATCATGG + Intronic
1014978812 6:127922131-127922153 TAAGACTACATGAAGAGCCACGG + Intergenic
1015121329 6:129704582-129704604 TGAGAATACCTGAAGATTCAAGG - Intronic
1017539458 6:155385371-155385393 TAAGACTTCCTGGAGGAGCTAGG - Intergenic
1019074106 6:169373217-169373239 AAAGACTCCCTGTAGGATCTTGG - Intergenic
1022759968 7:33338053-33338075 TAAGACATACTGAAGGATCAAGG - Intronic
1026412355 7:70137610-70137632 TAAGACTACCTGTATGACCTTGG + Intronic
1038696868 8:29813952-29813974 TAGGATTACCTGAAGGATGGTGG + Intergenic
1040431160 8:47343805-47343827 TAAGAATACAGGGAGGATCAGGG + Intronic
1041698974 8:60766669-60766691 TAAGACTAAGTGAAGGGTCAAGG + Intronic
1042966834 8:74362581-74362603 AAAGAGTAGCTGAAGGGTCAGGG - Intronic
1043505236 8:80895928-80895950 TAGGACAACCTGAAGGAAAAAGG - Intergenic
1043564293 8:81531242-81531264 GAAGACTACATGAAGGAGCTGGG - Exonic
1043766178 8:84134979-84135001 TAGAACTACCTGAAGGCTTAGGG + Intergenic
1046851668 8:118981269-118981291 TAAAACTATCTGCAGAATCATGG + Intergenic
1048570358 8:135649226-135649248 TAAGACTCTCTGGAAGATCAGGG - Intronic
1050899436 9:10927572-10927594 TTAGACTACCTGATTGATTACGG + Intergenic
1052491673 9:29177694-29177716 TAAGAATACCTAAAGTATTATGG - Intergenic
1056050534 9:82763824-82763846 TAAAACAACCTCAAGGAGCACGG - Intergenic
1062391191 9:136334604-136334626 TACTTCTACCTGAAGGAGCACGG + Exonic
1186439290 X:9571509-9571531 AAAGACGACCTGAAAGATCTTGG + Intronic
1191784036 X:64897969-64897991 TGAGACTACATGAAGGAGCAAGG + Intergenic
1197644209 X:128999930-128999952 TCCAACTACCTGAAGGATGAAGG + Intergenic
1199145434 X:144360555-144360577 AAAGACTTCCTGAAGGGACAAGG + Intergenic
1199550596 X:149057104-149057126 CAAGACTACCCGAAGGAAAAAGG + Intergenic
1201584958 Y:15549899-15549921 TGAGATTACCTGAAGGTTGAAGG + Intergenic
1201931751 Y:19357730-19357752 TAAAACTACCTAGAGGAGCATGG - Intergenic