ID: 1157999283

View in Genome Browser
Species Human (GRCh38)
Location 18:52597357-52597379
Sequence GCCCAACTTGGTATTCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157999283 Original CRISPR GCCCAACTTGGTATTCAGAG TGG Intronic
900940236 1:5793725-5793747 GCCCAACACAGTATTTAGAGTGG + Intergenic
901531038 1:9852672-9852694 GCCCAGCTTGCTAATCAGAAGGG + Intronic
916657941 1:166894027-166894049 ACCCATCTTGGGATTCAGGGAGG + Intergenic
1064117631 10:12592482-12592504 GGCCAGCGTGGTATTTAGAGGGG + Intronic
1065098847 10:22313144-22313166 ACCAAACTGAGTATTCAGAGGGG - Intergenic
1069809545 10:71148277-71148299 CCCCATCTGTGTATTCAGAGTGG + Intergenic
1070543317 10:77433022-77433044 CCGCAACTTCATATTCAGAGAGG + Intronic
1071224402 10:83511243-83511265 GACCAATTTGGTATTCATAGGGG + Intergenic
1071332071 10:84570727-84570749 GCTCAACTTGGAATTTACAGTGG + Intergenic
1071559861 10:86637074-86637096 GCCCAACTGGGTATTGAAGGTGG - Intergenic
1072026111 10:91459277-91459299 GCCAAACTTGTTTTCCAGAGTGG - Intronic
1072208348 10:93224217-93224239 GCCCACCATGGTGTACAGAGTGG + Intergenic
1072945192 10:99803701-99803723 CCCCAACTTGGTAGTCACGGTGG + Intronic
1075147801 10:119897377-119897399 GCCCAACTTGATGTTCACTGTGG - Intronic
1077578661 11:3403093-3403115 ACCCAACTGGGGATTCAGGGCGG - Intergenic
1077581706 11:3421528-3421550 GCCCAAGTTAGCATTCAGCGTGG + Intergenic
1079296477 11:19239626-19239648 GAACAACTTGGAATTCAGAAAGG - Intronic
1081035293 11:38136790-38136812 GCACAACTTGGTACCAAGAGAGG + Intergenic
1084235694 11:67786607-67786629 ACCCAACTGGGGATTCAGGGCGG - Intergenic
1086535761 11:87843183-87843205 GACCAGCATGGTATTCAGAGAGG - Intergenic
1088795277 11:113262121-113262143 GTCCAACTTGTAATTCAGAGAGG - Intronic
1089135358 11:116244945-116244967 CCCCAAGTTGGTACTGAGAGGGG + Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1092409302 12:8241969-8241991 GCCCAAGTTAGCATTCAGCGTGG + Intergenic
1093196914 12:16140446-16140468 ACCCAATTTAGTTTTCAGAGAGG - Intergenic
1094024180 12:25945187-25945209 GCCCAACCTGGAATGCAGTGGGG + Intergenic
1100291579 12:93220103-93220125 GCCCTACTTGGTGATGAGAGGGG + Intergenic
1101394513 12:104333867-104333889 GCCCAAGTTGTCATTCACAGTGG + Intronic
1107518870 13:41159790-41159812 ACCCAACTTGGTATTTACAGGGG - Intergenic
1107670306 13:42739133-42739155 GACCAAATTGTTATACAGAGTGG + Intergenic
1114372514 14:22105760-22105782 ACCCTCCTTGGTATTAAGAGTGG - Intergenic
1117681630 14:58208675-58208697 GCCCAAGTTGGAGTGCAGAGGGG - Intronic
1122344426 14:101049838-101049860 GCACAAGTTGGCATTCAAAGAGG - Intergenic
1123470741 15:20550341-20550363 GCCCAACTTATTAATCAGAAAGG + Intergenic
1123647319 15:22450362-22450384 GCCCAACTTATTAATCAGAAAGG - Intergenic
1123665233 15:22603626-22603648 TCCCATCTTCTTATTCAGAGAGG - Intergenic
1123731042 15:23145318-23145340 GCCCAACTTATTAATCAGAAAGG + Intergenic
1123749181 15:23342744-23342766 GCCCAACTTATTAATCAGAAAGG + Intergenic
1123752527 15:23369026-23369048 TCCCATCTTCTTATTCAGAGAGG + Intergenic
1124281553 15:28366627-28366649 GCCCAATTTGTTAATCAGAAAGG + Intergenic
1124301150 15:28544993-28545015 GCCCAATTTGTTAATCAGAAAGG - Intergenic
1124319062 15:28698048-28698070 TCCCATCTTCTTATTCAGAGAGG - Intergenic
1124327745 15:28782305-28782327 GCCCAATTTATTAATCAGAGAGG + Intergenic
1124760115 15:32441249-32441271 TCCCACCTTCTTATTCAGAGAGG - Intergenic
1124975363 15:34524632-34524654 TCCCACCTTCTTATTCAGAGAGG - Intergenic
1126425875 15:48526737-48526759 GGCCAACTTGGTGTTCTCAGTGG + Intronic
1128602798 15:69011780-69011802 GCCCAGCGTGGGATTCAGAGTGG - Intronic
1129039049 15:72670240-72670262 TCCCATCTTCTTATTCAGAGAGG + Intergenic
1129210782 15:74066676-74066698 TCCCATCTTCTTATTCAGAGAGG - Intergenic
1129399561 15:75274090-75274112 TCCCATCTTCTTATTCAGAGAGG + Intronic
1129403229 15:75298653-75298675 TCCCATCTTCTTATTCAGAGAGG + Intergenic
1129476709 15:75790779-75790801 TCCCATCTTCTTATTCAGAGAGG + Intergenic
1130282336 15:82530204-82530226 TCCCATCTTCTTATTCAGAGAGG + Intergenic
1130412195 15:83656023-83656045 GCCCTACTCAGGATTCAGAGAGG - Intronic
1132184990 15:99796625-99796647 TCCCATCTTCTTATTCAGAGAGG + Intergenic
1132431998 15:101767929-101767951 TCCCATCTTCTTATTCAGAGAGG - Intergenic
1133347268 16:5079243-5079265 ACCCAACTGGGGATTCAGGGCGG - Intronic
1133350275 16:5096771-5096793 GCCCAAGTTAGCATTCAGCGTGG + Intronic
1144302041 17:13930411-13930433 GACCAACTTGGTATCCAAAAAGG + Intergenic
1154053222 18:10983393-10983415 GCACAACTTGGTATCAACAGAGG + Intronic
1157999283 18:52597357-52597379 GCCCAACTTGGTATTCAGAGTGG + Intronic
1160985692 19:1837556-1837578 GGCCACCTTGGATTTCAGAGAGG - Intronic
1162626258 19:11887578-11887600 GCCAAACTTGCTATTGATAGAGG - Intergenic
1164683339 19:30150459-30150481 GACAAACCTGGTATTCAGAGAGG - Intergenic
1167963079 19:53123038-53123060 GCCCAGCCTGGGATCCAGAGAGG - Intronic
1168604097 19:57744344-57744366 GCCCCACTTGGCATTTATAGGGG - Intronic
927105156 2:19817860-19817882 TACCAACTTGGTATTAAGTGAGG - Intergenic
935332183 2:101985394-101985416 GTCCCACCTGGTACTCAGAGGGG - Intergenic
940810757 2:158240159-158240181 GCCCAAGTTGGTGTTCAGAGTGG + Intronic
942493206 2:176510646-176510668 GCCCAACTTGGTTTTCTCTGGGG + Intergenic
946846331 2:223861991-223862013 GACCAACTTTGTATCCAGACAGG + Intronic
947632984 2:231665741-231665763 GCCCAGCGTGGCATTCAGAGGGG - Intergenic
947900070 2:233713801-233713823 GCCCAACATGGTCTTCATTGGGG + Exonic
947900779 2:233719630-233719652 GCCCAACATGGTCTTCATTGGGG + Exonic
947902151 2:233729936-233729958 GCCCAACATGGTCTTCATTGGGG + Exonic
947904221 2:233748022-233748044 GCCCAACATGGTCTTCATTGGGG + Intronic
1185172695 22:49303040-49303062 GCCCAGCTTGGAAGGCAGAGCGG + Intergenic
952471858 3:33662920-33662942 GACCAAGTTGGAATTCAGGGAGG - Intronic
952568580 3:34685859-34685881 GCCAAACTTGTTATCCAGAAGGG + Intergenic
953093041 3:39748651-39748673 CCTCAATTTGGGATTCAGAGTGG - Intergenic
954570724 3:51638566-51638588 GCACAACTTGTTATTCCAAGGGG + Intronic
956604905 3:71064662-71064684 ACCCAACTTGGTAAACAGCGAGG + Intronic
957168069 3:76700520-76700542 GCCCAGCTTTGCCTTCAGAGAGG - Intronic
957363251 3:79186548-79186570 GCCCAATTTGGTAATCACTGGGG + Intronic
961300278 3:125917564-125917586 GCCCAAGTTAGCATTCAGCGTGG - Intergenic
961885254 3:130092584-130092606 ACCCAACTGGGGATTCAGGGCGG - Intronic
961888223 3:130110503-130110525 GCCCAAGTTAGCATTCAGCGTGG + Intronic
968997381 4:3954451-3954473 GCCCAAGTTAGCATTCAGCGTGG + Intergenic
969302015 4:6302656-6302678 AACACACTTGGTATTCAGAGTGG - Exonic
969756638 4:9154243-9154265 GCCCAAGTTAGCATTCAGTGTGG - Intergenic
969819491 4:9709450-9709472 ACCCAACTGGGGATTCAGGGCGG + Intergenic
970645366 4:18114464-18114486 CCCCAACTGGGTATTCACAAAGG - Intergenic
980100518 4:128537166-128537188 GCCCATCTTGATAGTCACAGAGG + Intergenic
983270677 4:165558045-165558067 CCCCATCTTGGTTTTCAGACAGG - Intergenic
986685624 5:10273310-10273332 CCCCACCTTGGGACTCAGAGGGG + Intergenic
986685915 5:10275154-10275176 CCCCACCTTGGGACTCAGAGGGG + Intergenic
988925787 5:35990260-35990282 GCCCATTTTGATATTCTGAGAGG - Intronic
993486479 5:88493743-88493765 TCCCAACATGGTATTTAGTGGGG - Intergenic
995657862 5:114447200-114447222 GCCCAGCTTGGTAGCCACAGGGG - Intronic
995781214 5:115777282-115777304 GAGGAACTTGGTGTTCAGAGGGG - Intergenic
995859667 5:116628106-116628128 GCCAAACTTGGTTTACAGAGGGG + Intergenic
997660824 5:135588406-135588428 GCTCAACTTGGTGTTTATAGAGG - Intergenic
998741067 5:145202482-145202504 GCACTACATAGTATTCAGAGTGG - Intergenic
1000049438 5:157549087-157549109 GCCCAAATTGTTCTTCAGTGGGG + Intronic
1001958288 5:175863460-175863482 TCTCCACTTTGTATTCAGAGAGG - Intronic
1002121191 5:177006216-177006238 GCCCAACCTGGCGTTCCGAGGGG + Intronic
1003302844 6:4900100-4900122 GGGGAATTTGGTATTCAGAGGGG - Intronic
1005257352 6:24017252-24017274 TCCCAAATTGGTCTTCAGACTGG - Intergenic
1024784107 7:52886519-52886541 GCCCATCATTGTGTTCAGAGGGG - Intergenic
1036379874 8:8229551-8229573 GCCCAAGTTAGCATTCAGCGTGG - Intergenic
1036849688 8:12193102-12193124 GCCCAAGTTAGCATTCAGTGTGG + Intronic
1036871052 8:12435375-12435397 GCCCAAGTTAGCATTCAGTGTGG + Intronic
1044667758 8:94648477-94648499 GCACAAGTTGATATTCAGATTGG - Intronic
1049282099 8:141754798-141754820 GACCAACTTGTTTTTCAGAATGG + Intergenic
1051230309 9:14948909-14948931 CCCCAACTTGAAGTTCAGAGAGG + Intergenic
1051716909 9:19994637-19994659 GCCCAAGTTGGCAAGCAGAGTGG + Intergenic
1053056483 9:34996042-34996064 GCACAACTTGAGATTCAAAGAGG - Intronic
1055361198 9:75492219-75492241 GCAAAACTTGAGATTCAGAGAGG + Intergenic
1058651617 9:107180210-107180232 TCCCAACTTGGTATTAAGCCTGG + Intergenic
1186537813 X:10368072-10368094 ACTTAACTTGCTATTCAGAGTGG + Intergenic
1194077464 X:89414581-89414603 GCCAAAATTGATATTCAGAATGG - Intergenic
1195396927 X:104421203-104421225 GCCCTAGGTGGAATTCAGAGTGG + Intergenic
1196743240 X:119044101-119044123 GCACAAGTTGGAATTAAGAGTGG + Intergenic
1200303858 X:155005753-155005775 GCCAAAATTGGTTCTCAGAGAGG - Intronic
1200430114 Y:3070120-3070142 GCCAAAATTGATATTCAGAATGG - Intergenic