ID: 1157999804

View in Genome Browser
Species Human (GRCh38)
Location 18:52604563-52604585
Sequence TGTGCCTGTCCCTTCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157999804 Original CRISPR TGTGCCTGTCCCTTCTTTGT GGG Intronic
900670130 1:3847424-3847446 TCTGCCCCTACCTTCTTTGTGGG - Intronic
900767135 1:4513140-4513162 TGTGCCTGCCCCCTCTTTCCAGG - Intergenic
901295723 1:8159513-8159535 TGTGCCTGTCCCGTTTGTTTTGG + Intergenic
903006946 1:20304997-20305019 TGTGCCTGGCACTACTCTGTGGG + Intronic
907667757 1:56448229-56448251 AGTGACTGTCCTTTCTTTTTGGG - Intergenic
908321990 1:62987392-62987414 TGTGTCTCTCCTTTCTTTGTGGG + Intergenic
908534500 1:65066125-65066147 TGTGCTTATCCCTGCTTTGAAGG - Intergenic
909326187 1:74353335-74353357 TGTGCCCATCCCTTCCTTGGTGG - Exonic
909893683 1:81038510-81038532 TGTGCCTGCCTCTTCTGTCTTGG - Intergenic
910158041 1:84242593-84242615 TGAGGCTGTTTCTTCTTTGTGGG - Intergenic
910232994 1:85006135-85006157 TGTGCCTGGCCCTTCTAGGAGGG - Intronic
912028625 1:105210273-105210295 TGTTCCTGTACTTTTTTTGTTGG - Intergenic
913055599 1:115156317-115156339 TATGCATTTTCCTTCTTTGTAGG + Intergenic
913333452 1:117686271-117686293 TGTGCCTGGCACTTTTATGTAGG - Intergenic
916053586 1:161052543-161052565 TATGCCCCTCCATTCTTTGTAGG - Exonic
917217261 1:172691235-172691257 TGTGCCTGTTTCTTGGTTGTAGG + Intergenic
918038996 1:180900706-180900728 TTCACCTGTCCCTTCTTTGTTGG - Intergenic
918635665 1:186771418-186771440 TTTACCTCTCCCTCCTTTGTAGG + Intergenic
919806542 1:201384068-201384090 TGTCCCTGTCCCTCCCTGGTTGG + Intronic
921447851 1:215267573-215267595 TGTGCCTGTCTTATCTTTGGTGG + Intergenic
921450732 1:215302707-215302729 TTTGCTTGTCTTTTCTTTGTTGG - Intergenic
922062793 1:222107886-222107908 TATGCTTGTCCCTTCTCTGTCGG - Intergenic
924568572 1:245218237-245218259 TGTGCCTGTGGCTTCTCAGTGGG + Intronic
1066653366 10:37679824-37679846 TGGCCCTGTCCTTTCTTTCTGGG + Intergenic
1068924662 10:62523322-62523344 TGGGCCTGGACTTTCTTTGTTGG + Intronic
1069192361 10:65506692-65506714 TGTGCCTCTTTCTTGTTTGTAGG + Intergenic
1071268096 10:83982184-83982206 GGAGCCTGTCACTGCTTTGTGGG - Intergenic
1071360087 10:84837884-84837906 TGAGCCTGTCCCTTCCTCGAAGG - Intergenic
1072701306 10:97643278-97643300 CATGCCTGTCCTTTTTTTGTGGG + Intronic
1073714774 10:106091581-106091603 TGCGCCTGGCCCTTCTTCTTTGG - Intergenic
1074571089 10:114624970-114624992 TGTGAATTTCCCATCTTTGTGGG - Intronic
1074627312 10:115204896-115204918 TGTTCCTGGGCTTTCTTTGTTGG + Intronic
1074628017 10:115215246-115215268 TGTGCTGGTCCTTTATTTGTTGG - Intronic
1075193088 10:120329462-120329484 TCTTTCTCTCCCTTCTTTGTCGG + Intergenic
1076055922 10:127372841-127372863 TGTGCATGTCTCATCTTTATGGG + Intronic
1076538935 10:131201309-131201331 TGTCGCTGTCCCTGCCTTGTGGG - Intronic
1077820679 11:5736847-5736869 TATGCCATTCACTTCTTTGTGGG + Exonic
1078637895 11:13068945-13068967 TGAGACTGTATCTTCTTTGTGGG - Intergenic
1078803586 11:14672422-14672444 TGTGATTTTCCCTTCTTAGTAGG - Intronic
1080051540 11:27863906-27863928 TGTCCCTTCCCCTTCTTTGTGGG - Intergenic
1081763879 11:45595776-45595798 TCTCCCAGTCCCTCCTTTGTGGG + Intergenic
1082783996 11:57306868-57306890 TCTGCCTTTCCGTTCTGTGTGGG - Intronic
1083087025 11:60159813-60159835 TGTGCCTGTTCCTGCTGTGGTGG + Intergenic
1084335074 11:68452559-68452581 TGTTCCTGGGCTTTCTTTGTTGG - Intergenic
1088446156 11:109930839-109930861 TCTGCCTGTCCCTTTTATTTTGG - Intergenic
1091675343 12:2485092-2485114 TGTGTCTTTACCTTCTGTGTGGG - Intronic
1092001448 12:5035825-5035847 TTTGCCAGTCATTTCTTTGTCGG + Intergenic
1092275658 12:7059142-7059164 TGTGCCTGTGTCTTCTTTCTTGG + Intronic
1092405385 12:8218346-8218368 TCAGCCTGTCCCTTCTTTCCAGG - Intergenic
1096378535 12:51135133-51135155 TGTGCCTGGCCCTGAATTGTAGG - Intronic
1097030984 12:56089081-56089103 TGTTCCTGTCCCTTGTTCCTTGG - Intronic
1097153558 12:56996443-56996465 TGTGCCTTTTCCTTCACTGTTGG - Exonic
1100404003 12:94257257-94257279 TTTGCCTGTTGCTTTTTTGTAGG - Intronic
1101243818 12:102865557-102865579 TTTGCCTGTACCTGCTTTGATGG + Intronic
1102109899 12:110357168-110357190 TGTGCCTGGCCCTCTTTTGAAGG - Intergenic
1104277050 12:127338955-127338977 AGTGGCTGTCCAATCTTTGTTGG - Intergenic
1106502723 13:30344997-30345019 TGTCCCTGTTCCATCTTGGTGGG - Intergenic
1108263149 13:48678452-48678474 TCTGCCTGTCCCTTAATTGTTGG + Intronic
1114182687 14:20379179-20379201 TGTGCCTTGGCCTTCTTTTTGGG - Intronic
1114852058 14:26393283-26393305 TGTCCATGCCACTTCTTTGTGGG - Intergenic
1115080780 14:29447738-29447760 TGTCCCTGTCCCAACTTTGCTGG - Intergenic
1115839292 14:37449050-37449072 GCTGCCATTCCCTTCTTTGTTGG - Intronic
1116739463 14:48735822-48735844 TGTGTCTGTCACTGCTTTTTGGG + Intergenic
1117105599 14:52394653-52394675 TGTGCCTGCCCCTTCCTTTGGGG + Intergenic
1117178655 14:53170572-53170594 TGTTCCTGTCCGATCTTTGATGG + Intergenic
1119275042 14:73347771-73347793 ACTGCCTGTCCCCTCTATGTTGG + Intronic
1119903482 14:78281542-78281564 TGTGCCTGCCCCTTTTTCCTGGG - Intronic
1120466848 14:84869331-84869353 TGTGACTGTCCCTTCTGGGCTGG - Intergenic
1121135524 14:91494569-91494591 CGTGCCTGGCCCTTATTTGTGGG - Intronic
1121155496 14:91680365-91680387 TGTGCCTGTCCTTGATTTGGAGG - Intronic
1121865584 14:97359600-97359622 TGAGCCTGTGCCTTCAGTGTGGG - Intergenic
1122349463 14:101079025-101079047 TGTGCCTGTGGCTCCTTGGTGGG + Intergenic
1122372338 14:101235590-101235612 GGTGCCTGTCCCTTCCAGGTGGG + Intergenic
1124699430 15:31899585-31899607 TGGGCCTGGGCTTTCTTTGTGGG + Intergenic
1125967900 15:43888889-43888911 AGTGCCTGTCACCTCATTGTGGG + Intronic
1127382990 15:58445458-58445480 TGGGCTTGACCCTTCTATGTGGG - Intronic
1128307624 15:66610372-66610394 TGGTCCTGTCCCTTTTTCGTTGG - Intronic
1129126458 15:73446042-73446064 TGTGCCTGTACCTACTTCATAGG + Intronic
1129275765 15:74444281-74444303 TTTCCCTTTCCCTTCTTTGTTGG - Intergenic
1131022333 15:89109399-89109421 TGTGGCAATCCCTTCTCTGTCGG - Intronic
1132323853 15:100949397-100949419 TGGGCCTGGCTTTTCTTTGTGGG - Intronic
1135330154 16:21554097-21554119 TGTTCCTGGCCCTTGTTGGTTGG - Intergenic
1135969764 16:27063734-27063756 TGTGCCTGTCTCTTCCTTGCCGG + Intergenic
1137395622 16:48114674-48114696 TCTCCCTCTCTCTTCTTTGTAGG - Intronic
1141915453 16:87093548-87093570 TGTCCATGTCCCTTCTGTGTTGG - Intronic
1143024627 17:3934343-3934365 TGTGCCTGTAGCTTCTTGGGAGG - Intronic
1143360495 17:6365252-6365274 TGTGCCTCTCCCTGCACTGTGGG - Intergenic
1146237929 17:31185603-31185625 TGTGCCTCTTTCTTTTTTGTAGG - Intronic
1149070441 17:52536047-52536069 TGTCCCTGTCCCTCCTTCTTTGG - Intergenic
1150428118 17:65093557-65093579 AGTGGCTTTCCCTTCTGTGTTGG + Intergenic
1152154248 17:78622576-78622598 TGAGCCCCTCCCTTCTTTCTTGG - Intergenic
1153188424 18:2511597-2511619 TGTGACTGTGCCATCTGTGTGGG + Intergenic
1153409142 18:4774084-4774106 CATGGCTGTCCATTCTTTGTTGG - Intergenic
1154350496 18:13579399-13579421 TGGGCCTGTCCCTTTTTACTAGG + Intronic
1155033802 18:22007187-22007209 TGTGCAAGTCCATTCTTTGTAGG + Intergenic
1155074830 18:22345540-22345562 TGTGCCTCTCCCTTCTCCCTTGG + Intergenic
1156335538 18:36168267-36168289 TTTGCCTGTTCTTTCTTTCTTGG + Intronic
1157999804 18:52604563-52604585 TGTGCCTGTCCCTTCTTTGTGGG + Intronic
1162437627 19:10671672-10671694 TGTGCGTGTGCCTTCTCAGTAGG + Intronic
1163176111 19:15564978-15565000 TCTGCCTGGCCCATCTCTGTGGG + Intergenic
1163362879 19:16859027-16859049 TGTACCTGTACCTACTTTGGAGG + Intronic
1163430674 19:17265349-17265371 TCTGCCTGTCTCTTCATTGTGGG + Intronic
1164807480 19:31128087-31128109 TGTGCTTGTCCCTGCTTTTCTGG + Intergenic
1165354140 19:35293470-35293492 TGTGCCTGCCCCTTCTGGCTGGG + Intronic
1165964259 19:39562343-39562365 TGTACCTGTCCTTTTTTTGAAGG + Intergenic
1166558047 19:43714649-43714671 TGTGTCTTTCCCTTCTCTCTTGG + Intergenic
1168316661 19:55487569-55487591 TGTGCCTGTCTCTTCTCTGATGG + Intergenic
1168612745 19:57814339-57814361 TGATCCAGTCCCTTCTTTCTTGG + Intronic
925362808 2:3291165-3291187 TGTGCCTGTAGCTTCATTCTGGG - Intronic
927460304 2:23292958-23292980 TGTCCCTGTCCCCTCATTTTGGG - Intergenic
928493274 2:31805171-31805193 TGAGCCTATCCCTTGTTTTTAGG + Intergenic
930536656 2:52652611-52652633 TGTGCCTCTTTCTTCGTTGTAGG + Intergenic
931317641 2:61147659-61147681 TTTGCCTTTCCCTTTTTTATAGG + Intronic
931713713 2:65011557-65011579 TGCGCCTGGCCCTTTTATGTAGG + Intronic
933098198 2:78214849-78214871 TGTGCCTGTCTGTTTTTTTTAGG - Intergenic
934607734 2:95710252-95710274 TCTCCCTGTCCCCTCGTTGTTGG - Intergenic
936840557 2:116763505-116763527 TCTGCCTTTTCCTTCTTTCTGGG - Intergenic
937255763 2:120554351-120554373 TGTGGCTGTCCTTTCTTTCGAGG + Intergenic
938138090 2:128775423-128775445 TCTGCCTGTCACTTCTTTATTGG - Intergenic
939147330 2:138431664-138431686 TCTGCCTTTCCCATCTGTGTGGG - Intergenic
940184912 2:150973103-150973125 TGTGCCTGTTCTGTTTTTGTGGG + Intergenic
940838330 2:158550009-158550031 TGTGCCTGACCCTCCTATGTTGG - Intronic
941780031 2:169433642-169433664 TCTGCCTTTGCCTTCTTTGTAGG + Intergenic
942592928 2:177565295-177565317 TGTGCCCATCCCTTTTTTTTAGG + Intergenic
943914706 2:193615307-193615329 AGTTCCTGTCACATCTTTGTGGG + Intergenic
944910799 2:204308784-204308806 TGTTCCTGTCCCTTGTCTTTGGG - Intergenic
946623382 2:221583680-221583702 TATGCCTTTCCTCTCTTTGTTGG - Intergenic
947265580 2:228275934-228275956 TGTGCATGTGCCTTTTTTGGTGG + Intergenic
947697725 2:232206155-232206177 TGCTCCTGGCACTTCTTTGTGGG - Intronic
947740885 2:232484337-232484359 ACCCCCTGTCCCTTCTTTGTGGG - Intronic
947801529 2:232931295-232931317 TGTGCCTCTCCGTTATTTGGTGG + Intronic
948822584 2:240557576-240557598 TGTCCCTGTCCCTTCGTGGGCGG + Intronic
1169656696 20:7931895-7931917 TGTTTCTGTCCCTGTTTTGTGGG - Intronic
1171444062 20:25191146-25191168 AGTGCCTGGCCCTGCTTTTTGGG - Intergenic
1171452611 20:25247128-25247150 TCTGCCTTTCCCTTCGTTCTTGG - Intergenic
1171464817 20:25320026-25320048 TCTGCCTTTCCCTTCGTTCTTGG + Intronic
1172114710 20:32566827-32566849 TGGGCCTGTTCCTTGTTTATTGG + Intronic
1173073661 20:39795170-39795192 TGTACCTGTCCACTCTTTCTTGG - Intergenic
1173944511 20:46940185-46940207 TGTTCCTGCACATTCTTTGTAGG - Intronic
1174501683 20:50989560-50989582 TCTGCCTCTCCCTTCTCTCTTGG - Intergenic
1175558317 20:59891735-59891757 AGTTCCTGTCTCTTCTTTTTAGG - Intronic
1177933747 21:27317281-27317303 TGTGCCTGTTTCTTAGTTGTAGG + Intergenic
1177940951 21:27410831-27410853 TGTGCCTGTTTCTTGGTTGTAGG + Intergenic
1178783551 21:35630065-35630087 TTTCCCTGACCCTTCTTGGTGGG - Intronic
1178867127 21:36338108-36338130 TGTCCCTTTCTCTTCTCTGTTGG + Intronic
1178967508 21:37135802-37135824 TGTGCCTGTACTTTCTTCCTGGG - Intronic
1179616346 21:42585926-42585948 TGTGGCTGTCACTTCGTCGTGGG - Intergenic
1182481372 22:30611133-30611155 TGGGCCTGTCACCACTTTGTGGG + Intronic
1182828140 22:33283348-33283370 TCTGCCTGTCCCCTCTTTTCAGG - Exonic
1182915529 22:34025956-34025978 TCTCTCTTTCCCTTCTTTGTGGG + Intergenic
1183025972 22:35066220-35066242 GGTACCTCTCCCTTCCTTGTGGG - Exonic
1184856793 22:47150733-47150755 TGAGCCAGACCCTTCTCTGTGGG + Intronic
949751282 3:7355214-7355236 TGTGCCTCTTCCTTGTTTGTAGG - Intronic
949870806 3:8586663-8586685 GGTGCCTGTCCTTTCTTTCAAGG + Intergenic
951003572 3:17592502-17592524 TGTGCCTCTTTCTTGTTTGTAGG - Intronic
951791699 3:26492724-26492746 TGTGCCTGCTCCTTCATTCTGGG - Intergenic
952407116 3:33014673-33014695 TGCGCCTGGCCCATCTTTCTTGG - Intronic
953810042 3:46104496-46104518 TGGACCTGTCCCTTCTATATTGG - Intergenic
955019413 3:55104645-55104667 TGTCCTTTTCCCTTCTTTGTAGG - Intergenic
955594613 3:60574980-60575002 TGTGCCTGTCACATCTTTATGGG + Intronic
956109653 3:65857760-65857782 TGTGTCTGTCCCATCTATGTGGG - Intronic
956705040 3:71992372-71992394 TGTGCCTCTCTCTTCTCTGCTGG + Intergenic
960157285 3:114308875-114308897 GGTGCCAGGGCCTTCTTTGTGGG - Exonic
962285710 3:134084274-134084296 TGTGCCTGTGCCTACTTTGGGGG - Intronic
967726257 3:192865055-192865077 TCAGCCTCTCCCTTCTCTGTAGG - Intronic
968052110 3:195662189-195662211 TGTGCCTGTTCTCTCTCTGTTGG + Intergenic
968103703 3:195986149-195986171 TGTGCCTGTTCTCTCTCTGTTGG - Intergenic
968302004 3:197623742-197623764 TGTGCCTGTTCTCTCTCTGTTGG - Intergenic
969687849 4:8686192-8686214 TGTCCCTGTCCCTCCTCTGGGGG + Intergenic
969760732 4:9179625-9179647 TCAGCCTGTCCCTTCTTTCCAGG + Intergenic
971490377 4:27205961-27205983 TGTGCCTCTCCCTGCTTTATAGG + Intergenic
971794183 4:31204978-31205000 TATGCCTGTGGCTTCTCTGTTGG + Intergenic
975905490 4:79206574-79206596 TGTGCCTCTTCCTTATTTGAAGG + Intergenic
977462161 4:97338626-97338648 GGTACCTGGCCTTTCTTTGTAGG - Intronic
979605909 4:122638864-122638886 TGCCCCTGCCCCTTCTTAGTTGG - Intergenic
981051150 4:140310749-140310771 TCTTCCTGTCCCTTCTTCTTCGG + Intronic
981138162 4:141236611-141236633 TGTCCCTGTTGTTTCTTTGTAGG + Intergenic
985266548 4:188156763-188156785 TGTGTCTGTCCCTTCGGTGTGGG - Intergenic
985576539 5:675842-675864 TGTGGCTGGCCCCTCTGTGTAGG - Intronic
985752788 5:1691611-1691633 AGTGCCTGTTCCTAGTTTGTCGG + Intergenic
986415111 5:7520362-7520384 GATGCCTGTCCCTCCTCTGTGGG + Intronic
987061271 5:14246488-14246510 TGTGGCTGTCACTTCTCTTTTGG + Intronic
987254910 5:16140634-16140656 TGTGCATGTGCTGTCTTTGTAGG - Intronic
987391555 5:17380932-17380954 TGGGGCTGTCCTTTCTTTGGTGG + Intergenic
988067606 5:26241528-26241550 TGTGCTTGTTTCTTCTTTGGAGG - Intergenic
989637377 5:43550620-43550642 TGTGCCTGTTTCTTCTATGCAGG - Intronic
989992153 5:50779666-50779688 TGTTCCTGTCCCTTGATTCTGGG - Intronic
990443938 5:55875480-55875502 TGGGCCTGGGCTTTCTTTGTGGG + Intronic
990554618 5:56918609-56918631 TGTGCTTGTCCCTGCTCTGAAGG + Intergenic
991345602 5:65663322-65663344 TGTGCATGTCCCTGGTGTGTAGG - Intronic
992543631 5:77787837-77787859 TGTGTATGTCTCTTCTTTGGAGG + Intronic
993202502 5:84834272-84834294 TGTTCCTGTTCCTTATTTGAAGG + Intergenic
993659462 5:90613570-90613592 TGTACCTGTCCCTTCTCTCCAGG - Intronic
994507369 5:100659134-100659156 TGGACCTGTGACTTCTTTGTAGG - Intergenic
997048811 5:130353504-130353526 TGAGCCTGGGCTTTCTTTGTGGG + Intergenic
1001220879 5:169899719-169899741 TGTTCCTTTCCATTCCTTGTTGG + Intronic
1002594735 5:180314634-180314656 TGTGTCTGTCCCAGCTTTGCAGG + Intronic
1002907843 6:1465357-1465379 TGTTCCAGTGCCTTCTTTCTGGG + Intergenic
1004950335 6:20663107-20663129 TGAGTCTGTCCCTTCTTTAAAGG + Intronic
1005158384 6:22834402-22834424 GGAGCCTGTCCCTTCTTGGCTGG - Intergenic
1005265558 6:24108683-24108705 TTTGCCCCTCCCTTCCTTGTTGG + Intergenic
1005815066 6:29543923-29543945 TGGGCCTGGGCCTTTTTTGTGGG + Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1008888363 6:56456326-56456348 AGTGTCTTTGCCTTCTTTGTGGG + Intergenic
1011908029 6:92397203-92397225 TTTGCCTGTCCTCTCTTTGAGGG - Intergenic
1014416937 6:121195043-121195065 TGTGCCTCTTTCTTGTTTGTAGG - Intronic
1015017313 6:128429175-128429197 TGTTCCTGTCCCTCCTTTTAAGG - Intronic
1019287752 7:232027-232049 TCGGGCTGTCCCTGCTTTGTGGG + Intronic
1019781689 7:2944119-2944141 TGTGCCTGCACCTGCTTTATGGG + Intronic
1020795040 7:12668639-12668661 TGTGTCTCTGCCTTCTTTATGGG - Intergenic
1023861210 7:44218578-44218600 GGTGTCTGTCCCTTCTCTGCTGG - Exonic
1023981877 7:45075172-45075194 AGTGCCTGCCCCTTCTGTGCTGG + Intronic
1024308797 7:47950272-47950294 GCTGCCTGTTCCTTCCTTGTGGG + Intronic
1025095860 7:56094861-56094883 CGTGCCTGGCCCTTTTTTTTGGG + Intergenic
1029557371 7:101279733-101279755 TGTGCCTGGCACTACTCTGTGGG + Intergenic
1032213770 7:129940609-129940631 TTTGCCTCTCCCTGCTTTGTAGG - Intronic
1032507450 7:132446315-132446337 AGTGCCTGTGCCTAGTTTGTTGG - Intronic
1032513644 7:132491467-132491489 TCTGACTGTCCCTACTCTGTAGG - Intronic
1034530736 7:151694949-151694971 CATGCCTGTCCCTTCCTTCTGGG + Intronic
1034639383 7:152590378-152590400 TGTTCCTGTCCTTTTTTTTTTGG - Intergenic
1035010162 7:155708503-155708525 CGTGCTCTTCCCTTCTTTGTGGG - Intronic
1036845774 8:12169293-12169315 TCAGCCTGTCCCTTCTTTCCAGG - Intergenic
1036867140 8:12411612-12411634 TCAGCCTGTCCCTTCTTTCCAGG - Intergenic
1039545986 8:38412009-38412031 TGTGTCTGCCCCCTCTATGTGGG - Exonic
1040089255 8:43379637-43379659 TGTGCCTGTCCTTTATTTGAAGG - Intergenic
1041644079 8:60233691-60233713 TGGGCCTAGACCTTCTTTGTTGG - Intronic
1041740773 8:61154049-61154071 TTTGCCGCTCTCTTCTTTGTGGG - Intronic
1043349353 8:79341538-79341560 TGTGTCCTTCCCTTCTCTGTTGG + Intergenic
1044484957 8:92741428-92741450 TTTGCCCGTACCTTGTTTGTTGG - Intergenic
1045314453 8:101030991-101031013 TCTGCCTTTTCCTTCTTTGATGG - Intergenic
1045364893 8:101466901-101466923 GGTGCCTGTCACTTTATTGTTGG - Intergenic
1049676172 8:143890250-143890272 TATGCCTGTCCTTTCTTGCTTGG - Intergenic
1051065617 9:13098928-13098950 TGAGCCTCTGCCTGCTTTGTTGG - Intergenic
1051103944 9:13556243-13556265 TGTTCCTGTCTCCTGTTTGTCGG - Intergenic
1057369373 9:94456218-94456240 TGTGCCTGTCCTGTCATTGCAGG + Exonic
1058019847 9:100075730-100075752 TGTGCCTGTTTCTTGGTTGTAGG - Intronic
1058082843 9:100717638-100717660 TGTGCCTGTGACCTATTTGTGGG + Intergenic
1062575315 9:137204169-137204191 TGTGAGTGGCCCATCTTTGTTGG - Exonic
1186666146 X:11719726-11719748 TGTGTCTCTCCCTTTTTTATAGG - Intergenic
1190290283 X:48987941-48987963 TGTGTGTGTCCTTTCTTTCTTGG - Intronic
1192680074 X:73242887-73242909 TGTGCCTGTCCTTTTGTTGAAGG - Intergenic
1193531415 X:82659008-82659030 TGTGCCTGTTCCTTGGCTGTGGG + Intergenic
1194841559 X:98750899-98750921 TGTGCCTGTCCCTCTTGTGGAGG + Intergenic
1196763982 X:119226352-119226374 ACTGCCTGCCACTTCTTTGTTGG + Intergenic
1197405038 X:126038846-126038868 TGTGCCTCTTTCTTGTTTGTAGG - Intergenic
1198996146 X:142576811-142576833 TGTGCCCTTCCCTTTTTGGTTGG + Intergenic
1201772165 Y:17625585-17625607 GCTGCCTGGCCCTTCTTTTTTGG + Intergenic
1201829390 Y:18280401-18280423 GCTGCCTGGCCCTTCTTTTTTGG - Intergenic