ID: 1158007424

View in Genome Browser
Species Human (GRCh38)
Location 18:52688559-52688581
Sequence ATGCACAACATGAGGACTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 10, 2: 45, 3: 57, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158007424 Original CRISPR ATGCACAACATGAGGACTAT AGG Intronic
906488852 1:46252021-46252043 GTGCACAACAGGAGACCTATGGG + Intronic
907674440 1:56505849-56505871 TTGAACAACATGGGGACTAGAGG - Intronic
908857271 1:68444992-68445014 ATGCACAACATGAAGAATAAAGG + Intronic
908948206 1:69525447-69525469 ATGGACAACCTCTGGACTATGGG + Intergenic
908966780 1:69774458-69774480 ATGTACAGCATGAGGACTATAGG + Intronic
909680238 1:78283726-78283748 ATGTGCAACATCAGGAGTATAGG - Intergenic
909757903 1:79250156-79250178 CTGCACAACAAGAGGTCTTTAGG - Intergenic
909903621 1:81169585-81169607 ATGTACAATATGAGGACTATAGG - Intergenic
910206037 1:84749628-84749650 GTGAACAACATGAGAACTACAGG + Intergenic
910896758 1:92078004-92078026 ATGTACAGCATGAGAACTATAGG - Intergenic
911047924 1:93643711-93643733 ATGGACAACATGAGGACTATAGG + Intronic
911453707 1:98096925-98096947 ATGATGAACATGAGGACTAGAGG + Intergenic
911594696 1:99786914-99786936 AAGCACAAGATTAGGATTATTGG - Intergenic
912574421 1:110652607-110652629 AAGCACAAAATGAGAACAATTGG + Intergenic
912574430 1:110652777-110652799 AAGCACAAAATGAGAACAATTGG + Intergenic
913461802 1:119094749-119094771 AAATACAACATGAGGACTATAGG - Intronic
913482523 1:119302475-119302497 AAATACAACATGAGGACTACAGG + Intergenic
916509494 1:165459331-165459353 GTGTGCAACATGAGGACTGTAGG + Intergenic
916820208 1:168390870-168390892 CTATACAACATGAGGACTATAGG + Intergenic
918967253 1:191367345-191367367 ATGTACAATATAAGGATTATAGG + Intergenic
922823076 1:228497624-228497646 ATGTACAACAGGAGGAATGTAGG + Intergenic
924292272 1:242548639-242548661 ATGCACAACATAAGAACTACAGG + Intergenic
924800249 1:247324391-247324413 TTGCACAACATGGTGACTATAGG + Intronic
1063342037 10:5275006-5275028 TTGAGCCACATGAGGACTATAGG + Intergenic
1063922714 10:10948185-10948207 ATACAGAACTGGAGGACTATGGG - Intergenic
1064718776 10:18206504-18206526 ATGCACAGCATGAGGGGAATGGG - Intronic
1064798869 10:19045982-19046004 ATGTACAGCATGAGTACTATAGG - Intergenic
1065639167 10:27764126-27764148 ATGTACAAGATGAGGATTATAGG + Intergenic
1065877411 10:30009584-30009606 ATGCACAACATGAAGAAGAGGGG - Intergenic
1067915100 10:50388922-50388944 ATGTACAATATGAGGATGATAGG + Intronic
1068163540 10:53299094-53299116 ATGTACAGCATGAGGACTATAGG - Intergenic
1070946889 10:80399638-80399660 ATGCACAGCATGAGGATTATAGG - Intergenic
1071274838 10:84044146-84044168 ATGAACAACATGAGAACCATAGG - Intergenic
1071362237 10:84860298-84860320 ATGTACTGCATGAGGACTATGGG - Intergenic
1075964695 10:126601270-126601292 ATGTACAACATGAGGACTCTAGG + Intronic
1077741665 11:4853126-4853148 ATGTACAGCATGATGATTATAGG + Intronic
1081156114 11:39693234-39693256 TTGAACAACATGAGGATTAGGGG - Intergenic
1082614785 11:55345836-55345858 ATATACAGCATGAGGACAATAGG - Intergenic
1082710477 11:56548480-56548502 ATGAACAACATGAGGACTAGGGG - Intergenic
1082801169 11:57416011-57416033 ATGCACAGCACGAAGACTGTAGG - Intronic
1082926856 11:58557627-58557649 ATGTACAACATAAGAACTATCGG + Intronic
1083131400 11:60626498-60626520 ATGTACAGCATGAGGACTATAGG + Intergenic
1086276809 11:85139695-85139717 ATGTACACCATGAGGACTGTAGG - Intronic
1087867637 11:103251600-103251622 ATGTACAACATGAGGACTGTAGG - Intronic
1088275070 11:108076350-108076372 ATGTACAGCATGAGAACTATAGG - Intronic
1090964968 11:131590546-131590568 CTGCACGACAAGAGGACAATTGG + Intronic
1091164497 11:133462580-133462602 ATGCTCAACATGCTAACTATTGG + Intronic
1092321445 12:7480606-7480628 ATGTACAACATGAGGATTATAGG + Intronic
1092599631 12:10045382-10045404 ATGCACAAAATGGAGACTCTGGG - Intronic
1092927616 12:13286287-13286309 ATTTACAGCATGAGAACTATTGG + Intergenic
1094482865 12:30898775-30898797 AGGCACAAAATTAGGATTATGGG + Intergenic
1095047052 12:37518491-37518513 ATATACAACATGAGGACTATAGG + Intergenic
1095346212 12:41151486-41151508 AGGCACATCATTAGGAATATTGG - Intergenic
1098101844 12:67026308-67026330 ATGTAGAATATGAGAACTATGGG - Intergenic
1098597669 12:72293556-72293578 ATGCAAAACTTGAGAACTTTTGG - Intronic
1098606308 12:72395106-72395128 TTGTACAACATGGAGACTATAGG - Intronic
1098795545 12:74884011-74884033 ATGTACAACATGAGGACTATTGG + Intergenic
1099793855 12:87371122-87371144 ATGTACAACATGAGGATTAAAGG - Intergenic
1100048824 12:90418675-90418697 ATGTACGACATGAGGACTATAGG + Intergenic
1100949266 12:99827459-99827481 AAGTACAACATGAAGACTACAGG + Intronic
1101133304 12:101711606-101711628 ATGTACAACCTGAGGGGTATAGG + Intronic
1101482712 12:105116544-105116566 ATGTACAACATGAAGATTACAGG + Intronic
1101653599 12:106699957-106699979 AGGCACAACAAGAGGAATAAAGG - Intronic
1101784407 12:107870376-107870398 ATGCACAGCAAGAGCACTACAGG + Intergenic
1101784410 12:107870429-107870451 ATGCACAACAGGAGTACTACAGG + Intergenic
1103425854 12:120832917-120832939 AGGCACCACATCAGCACTATGGG + Intronic
1106966369 13:35074876-35074898 ATGTACAACATGAGGACTGTAGG - Intronic
1107539353 13:41371781-41371803 ATGAACAACATGAGCATTAGGGG - Intronic
1108219204 13:48216311-48216333 ATGCAAATCATGAAGACAATGGG + Intergenic
1109316135 13:60752309-60752331 TTGGACACCATGAGGACTTTGGG - Intergenic
1109757523 13:66780026-66780048 ATATACAACATGAAGATTATAGG + Intronic
1110004839 13:70253557-70253579 TTGCACAACCTTATGACTATAGG - Intergenic
1110151452 13:72259786-72259808 ATGCAGAAAATGAGAACTCTAGG + Intergenic
1110165953 13:72443399-72443421 ATGCAAAACATGTACACTATTGG + Intergenic
1112601568 13:100860637-100860659 ATGTACAACACGAGTACTGTAGG - Intergenic
1114877040 14:26733020-26733042 TTGTACAACATGGTGACTATAGG - Intergenic
1116140616 14:40989197-40989219 ATCAACAACAAGAGGAATATTGG - Intergenic
1116167555 14:41352450-41352472 TTGTCCAACATGAGGCCTATGGG + Intergenic
1116290188 14:43024510-43024532 ATGTACGATGTGAGGACTATGGG + Intergenic
1116342947 14:43749745-43749767 ATTCACAACATGACCACCATGGG - Intergenic
1117077219 14:52116675-52116697 ATGCACACCATGATGACCTTTGG + Intergenic
1117251305 14:53942049-53942071 AAGCACAACGGGACGACTATAGG - Intergenic
1120055825 14:79923110-79923132 ATGCAAAACATGAGGATTTAAGG + Intergenic
1120909256 14:89650902-89650924 ATTCACAACATGGGTCCTATTGG - Intergenic
1120931742 14:89855688-89855710 AGGTACAACATGAGCACTACAGG - Intronic
1121735341 14:96214167-96214189 ATGGAAAACATGAGGACTGGCGG - Intronic
1121903704 14:97720015-97720037 ATGTACAACATAAGGACTACAGG - Intergenic
1125598482 15:40902555-40902577 CTGCCCAACATGGAGACTATGGG - Intronic
1125647758 15:41286891-41286913 ATGTACAACATGACAACTATAGG - Intergenic
1127050071 15:55072811-55072833 AGGTACAACATAAGAACTATAGG + Intergenic
1129573851 15:76719473-76719495 ATGTACAACAGGAGGGCTATAGG + Intronic
1129601474 15:77001333-77001355 CTGCCCAACCAGAGGACTATGGG - Intronic
1131915265 15:97258175-97258197 CTGGACACCATGAGGACTACTGG - Intergenic
1133564356 16:6979087-6979109 ATGTTCAACATGATGATTATGGG + Intronic
1133847634 16:9470487-9470509 ATGTACAACATGAAGACTATAGG - Intergenic
1134419684 16:14073854-14073876 AATCACACCATGAGGACTACTGG - Intronic
1139173635 16:64662047-64662069 ATGAACAATATTAGAACTATAGG + Intergenic
1139626242 16:68191269-68191291 ATGCACAGAATGAGGTGTATGGG - Exonic
1143120497 17:4603602-4603624 AGGGACAGCATGAGGACTCTAGG - Intronic
1146118772 17:30170382-30170404 ATGTACCACATGAGGACAATAGG - Intronic
1147239959 17:39084252-39084274 CTGTATAACATGAGGACTGTAGG + Intronic
1150928559 17:69559887-69559909 TCAAACAACATGAGGACTATAGG - Intergenic
1151406583 17:73891383-73891405 ATGCACAGCATGAAGGCTGTGGG - Intergenic
1153571810 18:6480954-6480976 ATGTGTAACATGAGGACTATAGG + Intergenic
1154406634 18:14097795-14097817 ATGAAAAACATGAGCAGTATTGG - Intronic
1155591412 18:27431645-27431667 ATGTACAACATGAGAAATATAGG + Intergenic
1155678951 18:28466064-28466086 ATGTAGAGCATGATGACTATAGG - Intergenic
1155821627 18:30385219-30385241 ATGCACGAGATGAGGTCTCTAGG + Intergenic
1155837330 18:30602429-30602451 ATGTACAACATGAAGACTAGAGG - Intergenic
1156268826 18:35512824-35512846 CTCCATAACATGGGGACTATGGG - Intergenic
1156862826 18:41858065-41858087 ATGCACAGCATGGTGGCTATAGG + Intergenic
1156893835 18:42220800-42220822 ATATATATCATGAGGACTATAGG - Intergenic
1158007424 18:52688559-52688581 ATGCACAACATGAGGACTATAGG + Intronic
1159253130 18:65908086-65908108 ATGGACAACTTGTAGACTATGGG + Intergenic
1159306220 18:66646505-66646527 GTGTACAACATGAGGACTATAGG - Intergenic
1162198634 19:9005309-9005331 ATGTACAGCATGGTGACTATAGG + Intergenic
1164731629 19:30509743-30509765 ATGTGCAACATGAGAACTGTAGG - Intronic
1165598249 19:37030020-37030042 TTATACAACATGAGGAGTATAGG - Intronic
928614215 2:33020281-33020303 CTATACAACATGAGGTCTATAGG + Intronic
931449709 2:62358418-62358440 ATGCACAACAAAGGGACTTTAGG + Intergenic
932687393 2:73883622-73883644 ATGTACACCCTGAGGACTATAGG + Intergenic
932954942 2:76340571-76340593 ATGTACAACATAAAGACTACAGG - Intergenic
933378903 2:81517708-81517730 AGGTACAACATGAGGGCTATAGG + Intergenic
933587206 2:84192248-84192270 ATGCAGAACAGGAGGAACATTGG + Intergenic
934087579 2:88523013-88523035 ATGCACAAGAGGATGACTAGTGG - Intergenic
935037302 2:99390971-99390993 TTGAACAACATGAGGGCTAGGGG + Intronic
936626170 2:114151771-114151793 ATGTACAGCATGGAGACTATAGG - Intergenic
937074358 2:119090206-119090228 ATGAACAAGATGAGAACTAAGGG + Intergenic
938955679 2:136295858-136295880 ATGTACAACATGAGTATTGTAGG - Intergenic
939127346 2:138193322-138193344 CTGCAGAACATGAGGACTTTTGG - Intergenic
939365092 2:141220393-141220415 AAACAAAACATGAGAACTATGGG + Intronic
939440300 2:142240019-142240041 GGGAACAACATGAGGACTATAGG + Intergenic
939503302 2:143012766-143012788 ATGTACAGCATGAGGACTATGGG - Intronic
940062786 2:149591045-149591067 ATGTACAACATGAGAATTCTGGG - Intergenic
941435565 2:165466882-165466904 ATGTACAACATGAGGACTACAGG - Intergenic
942055211 2:172175927-172175949 AAATACAACATGAGGATTATAGG - Intergenic
942311235 2:174658840-174658862 ATACACAAAATGAAAACTATGGG + Intronic
943166982 2:184341834-184341856 ATGTAAAGCATGAGGAATATAGG - Intergenic
943512794 2:188846962-188846984 ATGTACAACATGAGGACTACAGG + Intergenic
943551617 2:189347272-189347294 TTGCAAAACATGAGAATTATGGG + Intergenic
943687149 2:190830451-190830473 ATGTATAGCATGAGGACTATAGG - Intergenic
944359545 2:198836889-198836911 ATGTACACCATGAAGACTATAGG + Intergenic
945159929 2:206879184-206879206 ATGTACAACGTGAGGACTATAGG - Intergenic
947566397 2:231196687-231196709 ATGAACAACATGAGGCATACGGG - Intergenic
948081657 2:235210754-235210776 ATGAACAAGATGAAGACTTTTGG - Intergenic
1168944422 20:1739780-1739802 AAGCAAAACATGAGGACAACAGG - Intergenic
1169976583 20:11335830-11335852 ATGAACAACATTAGGAGTTTAGG - Intergenic
1170724225 20:18911810-18911832 ATGTATAACACGAGGACTACAGG - Intergenic
1171321892 20:24253192-24253214 ATGCACAGCATGTGGAATAAGGG + Intergenic
1171541621 20:25962137-25962159 ATATACAACATGAGGACTATAGG + Intergenic
1171799444 20:29598212-29598234 ATATACAACATGAGGACTATAGG - Intergenic
1171844606 20:30258276-30258298 ATATACAACATGAGGACTATAGG + Intergenic
1174537600 20:51264121-51264143 ATGCAAAACATGGGGATTATGGG + Intergenic
1175492256 20:59387141-59387163 GTGCCCAACATGAGGACAATTGG - Intergenic
1175538480 20:59732631-59732653 ATGGCCAACATGAGGTCTAGAGG + Intronic
1176636598 21:9249572-9249594 ATGTACAACATGAGGACTGTAGG - Intergenic
1183743938 22:39682688-39682710 ATGCCCAAGATGAGGGCTGTGGG - Intronic
951617473 3:24564012-24564034 ATATACAACATGAGAATTATAGG - Intergenic
955760889 3:62280929-62280951 ATATCCAACATGAGGACTACAGG + Intronic
957104165 3:75865692-75865714 ATGCACAACATGAGGACTGTAGG + Intergenic
957865855 3:86021903-86021925 ATACACAACATGAGAACTATAGG + Intronic
958148873 3:89663229-89663251 AGGCACAACATGGGGGCTGTAGG - Intergenic
958537848 3:95426756-95426778 ATGCACAAGTAGAGGAATATTGG - Intergenic
958626709 3:96635156-96635178 ATATACCACATGAAGACTATAGG - Intergenic
958641251 3:96809126-96809148 ATGCAAAACAAGAGGACACTTGG - Intergenic
959676994 3:109047168-109047190 ATGTACAATATGAGGACTGTAGG - Intronic
963548237 3:146687824-146687846 TTGCACAGCATGCTGACTATAGG - Intergenic
965810451 3:172586441-172586463 ATCCAGAACATTAGGACTAGTGG - Intergenic
966319394 3:178684420-178684442 ATGTAAAACATGAGCACTATAGG + Intronic
971103102 4:23491193-23491215 ATGTACAACATGAGGGCTACAGG + Intergenic
971619961 4:28843784-28843806 ATGTACAACACGAGGACTGAAGG - Intergenic
972555321 4:40175480-40175502 ATGCAAAACATGAGAACTGTAGG + Intergenic
973024042 4:45244298-45244320 ATGTACAACATGAGATCTCTAGG - Intergenic
974220601 4:58965005-58965027 ATGTACAACAGGAGGACTATAGG + Intergenic
974264543 4:59567522-59567544 ATGTACAACATGAGGACTACAGG + Intergenic
974909665 4:68101901-68101923 ATGTACAACATGAGGACTATAGG - Intronic
975448300 4:74493912-74493934 ATGAACAACATGAGGACTATAGG - Intergenic
975954273 4:79818494-79818516 ATGCATACCATGAAGACAATGGG + Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977197907 4:94084290-94084312 ACACACAACATGGGGACTCTGGG + Intergenic
977901979 4:102432905-102432927 ATGCAGAAAATCAGGACTTTGGG + Intergenic
979430910 4:120629248-120629270 ATGTAAAACATGAGGACTATAGG + Intergenic
981414543 4:144476327-144476349 ATGAACAACTTGAGGAGTCTAGG - Intergenic
981703773 4:147637510-147637532 TTGTACAACATGAGGATTTTAGG + Intronic
981860789 4:149353857-149353879 ATGCTCAACCTGAGGACCACAGG + Intergenic
982132049 4:152238223-152238245 ATGTTCAACATGAGCACTAAAGG + Intergenic
982376835 4:154700829-154700851 ATGTACATCATGAGGAATACAGG + Intronic
982879686 4:160697155-160697177 TGGTACAACATGACGACTATAGG + Intergenic
984216710 4:176922278-176922300 AGGTACAACATGAGGACTATAGG - Intergenic
984745366 4:183210368-183210390 ATGTACAACATGAGGACTATAGG + Intronic
1202751486 4_GL000008v2_random:8011-8033 ATGTACAACATGAGGACTGTAGG - Intergenic
988218870 5:28315490-28315512 ATGCCAAACATGAGGCCTTTGGG - Intergenic
989181745 5:38584782-38584804 ATGTAAAAAATGGGGACTATAGG + Intronic
990229715 5:53699565-53699587 ATGTACAACATGAGAACTACAGG + Intergenic
992138064 5:73767903-73767925 CTGCACAACATGGGGACCCTGGG - Intronic
992821492 5:80501507-80501529 ATGTGCAACATGAGGACTCCAGG + Intronic
993210325 5:84941349-84941371 ATGTACAACATGAGGAATATAGG - Intergenic
994381115 5:99072754-99072776 AGGTACAACATGAGGACTATAGG - Intergenic
994895628 5:105698291-105698313 GCGCACAGCATGAGGACTCTAGG + Intergenic
995167115 5:109056643-109056665 ATTTACAACATGTGAACTATAGG + Intronic
995943331 5:117611728-117611750 ATGCACTGCAGGAGGACTCTTGG - Intergenic
996321844 5:122226405-122226427 ATGTACAGCAAGAGGACTATAGG + Intergenic
997065272 5:130552425-130552447 ATGTACAACATGAAGACTATAGG + Intergenic
998824782 5:146090140-146090162 ATGCACAAAATCAGGATGATGGG + Intronic
999022402 5:148182380-148182402 ATATACAACATGAGAACTACGGG - Intergenic
999420955 5:151442702-151442724 AGGGACAACATAAGGACTATAGG - Intronic
999939389 5:156524654-156524676 ATATACAACATGGTGACTATAGG - Intronic
999990736 5:157047660-157047682 ATGCACAGGATGAGGTATATGGG - Intronic
1000680731 5:164180950-164180972 ACGTACAATATGGGGACTATAGG + Intergenic
1001127449 5:169033015-169033037 ATGTACAACCGGAAGACTATGGG - Intronic
1003745037 6:8991236-8991258 ATGTACAACTTCAGGACTGTAGG + Intergenic
1004402388 6:15300668-15300690 ACACACAACATGAGGACACTGGG - Intronic
1005733302 6:28720205-28720227 TTGTACAACATGATGACTATAGG - Intergenic
1007567915 6:42867126-42867148 ATGCCCAACATGATGACAATGGG - Exonic
1008282310 6:49611460-49611482 ATGCACAGCATGAGGATTATAGG - Intronic
1008458349 6:51738429-51738451 ATTCACAACGTGAGGACCCTAGG + Intronic
1010006842 6:71004693-71004715 ATATACCACATGAGGACTATAGG - Intergenic
1010165354 6:72908283-72908305 ATGTACAACATGAGAACTAAAGG + Intronic
1010342500 6:74771394-74771416 AGGCACAACATAAAAACTATAGG - Intergenic
1010837217 6:80603851-80603873 ATGAACAACAAGAGGAATTTTGG - Intergenic
1010895821 6:81362004-81362026 ATGCATAATATTAAGACTATAGG + Intergenic
1011890792 6:92156918-92156940 ATGCACAGCATAAGGACTGTAGG + Intergenic
1012502063 6:99899189-99899211 ATGTACAACATGAGGACTATAGG - Intergenic
1012532528 6:100255132-100255154 ATATACAACATGAGGAGGATGGG + Intergenic
1014273533 6:119361450-119361472 ATTCACAACATGAGGGGCATTGG - Intergenic
1014289301 6:119539835-119539857 ATGGACAACAGGAGGACCAGTGG + Intergenic
1016746653 6:147588263-147588285 ATGCACAATATGAATAATATCGG + Intronic
1018666344 6:166141786-166141808 ATGCCCAACAAAAGGACAATTGG - Intergenic
1018946523 6:168350315-168350337 GTGTACAACATGAGGACTGCGGG - Intergenic
1019255060 7:44298-44320 ATGGACGACATAAGGACTGTTGG + Intergenic
1019255069 7:44363-44385 ATGGACAACACAAGGACTGTTGG + Intergenic
1019255095 7:44555-44577 ATGGACGACATAAGGACTTTTGG + Intergenic
1019926547 7:4196736-4196758 ATGCACCACGTGAGGACAAGTGG + Intronic
1020588490 7:10103847-10103869 ACGTACAATATGAGGTCTATAGG + Intergenic
1020832151 7:13106018-13106040 ATGGAAAGCATGAGGCCTATGGG - Intergenic
1021178148 7:17474595-17474617 ATGCAGAAGATGAAGACTTTCGG + Intergenic
1021893263 7:25208650-25208672 ATGTACAACATGAGGACTGTAGG - Intergenic
1023463650 7:40429202-40429224 ATGTACAACATAAATACTATAGG - Intronic
1023634613 7:42197324-42197346 ATCCACAAGGTGAGGCCTATTGG - Intronic
1023974096 7:45014958-45014980 ATGCACAACATGAATATTCTTGG - Intronic
1024143863 7:46490970-46490992 ATGCACAACATGAAATCTAACGG - Intergenic
1024161099 7:46677285-46677307 ATGTACAACATGGTGGCTATAGG + Intronic
1025008128 7:55371089-55371111 AGGCACAACATGAAAACTACAGG - Intronic
1025293056 7:57748339-57748361 ATATACAACATGAGGACTATAGG + Intergenic
1026364377 7:69633033-69633055 ATGTACAACATGAGGACTAAAGG - Intronic
1027637804 7:80697373-80697395 ATGCACAACATGAAGACAATGGG + Intergenic
1027991229 7:85363669-85363691 TTGTACAACATGATGACTGTAGG - Intergenic
1028593017 7:92518533-92518555 ATGTACAACCTGACAACTATAGG - Intronic
1028878242 7:95848294-95848316 TTGTATAACATGATGACTATAGG - Intronic
1032695468 7:134332222-134332244 ATGTACAACATGAGGACTATAGG - Intergenic
1038042485 8:23736508-23736530 ATGAACAACGTAAGGACTATGGG - Intergenic
1038871575 8:31500527-31500549 ATGCACAAGATGAAGACTATAGG - Intergenic
1039140293 8:34379830-34379852 ATGTACAACATGGGCACTATAGG + Intergenic
1040421844 8:47247742-47247764 ATGTACAACATGAGGACTACAGG - Intergenic
1040987909 8:53316831-53316853 AAGCCCAGCATGAGGACTGTGGG + Intergenic
1042796669 8:72670989-72671011 AGGCAGAATATGAGCACTATGGG - Intronic
1044049073 8:87476967-87476989 ATGTATAACAGGAGGACTATAGG + Intronic
1044059264 8:87614439-87614461 ATGAACAACATTAAGAATATTGG + Intronic
1044145056 8:88702718-88702740 ATGTACTACTTGAGGACTATAGG - Intergenic
1045792726 8:106003883-106003905 ATGTACAACATGAGAACTACAGG + Intergenic
1046495215 8:115005348-115005370 ATATACCACATGAGGACTATAGG - Intergenic
1047601565 8:126430773-126430795 ATGCAAAACATCTAGACTATGGG + Intergenic
1048434811 8:134406331-134406353 ATGTACAACAGGAGGACTGTAGG - Intergenic
1048710933 8:137209677-137209699 ATGCAGGACATGTGGACTAGTGG + Intergenic
1050762963 9:9096151-9096173 ATGTGCAACATGAGGACTATAGG + Intronic
1051436606 9:17040323-17040345 ATGAACAACATGAGGACTACAGG - Intergenic
1053413678 9:37932474-37932496 ATGCACAACACGAGGACCACAGG + Intronic
1053619718 9:39802795-39802817 ATGCACACCATGAGCAGTAATGG + Intergenic
1053877893 9:42562111-42562133 ATGCACACCATGAGCAGTAATGG + Intergenic
1053894761 9:42732255-42732277 ATGCACACCATGAGCAGTAATGG - Intergenic
1054163477 9:61697560-61697582 ATATACAACATGAGGACTATAGG - Intergenic
1054233802 9:62539583-62539605 ATGCACACCATGAGCAGTAATGG - Intergenic
1054264441 9:62904648-62904670 ATGCACACCATGAGCAGTAATGG - Intergenic
1055727623 9:79248664-79248686 ATGGAAAAGATGTGGACTATGGG + Intergenic
1055870153 9:80867438-80867460 ATATACAACAGGAGGACTATAGG - Intergenic
1056429818 9:86516258-86516280 ATGTACAACATGGGGACTATAGG - Intergenic
1058610494 9:106770731-106770753 ATGCACCACATAAGGATGATAGG - Intergenic
1058733360 9:107871605-107871627 ATGTACAACATGAGGACTATAGG - Intergenic
1058983574 9:110192052-110192074 ATTCACAACCTGAGGGCTGTGGG - Intronic
1059054219 9:110961879-110961901 TCCCACAACATGAGGATTATGGG + Intronic
1059141809 9:111860230-111860252 ATGTACAACATAAGGATTATAGG - Intergenic
1059637968 9:116189198-116189220 ATGTATAGCATGAGGACTATAGG + Intronic
1059899137 9:118903255-118903277 ATATACAACATGAGGACTCTAGG + Intergenic
1060151387 9:121290785-121290807 ATGTGCAACATGAGGACTATAGG - Intronic
1203718937 Un_KI270742v1:185540-185562 ATGTACAACATGAGGACTGTAGG + Intergenic
1203653171 Un_KI270751v1:149215-149237 ATGTACAACATGAGGACTGTAGG + Intergenic
1185988116 X:4859454-4859476 CTGCACAATATGGTGACTATAGG + Intergenic
1186179972 X:6963799-6963821 ATGCACAATATTTGGGCTATTGG + Intergenic
1187377158 X:18765379-18765401 GTGTACAACACGAGGACTATAGG + Intronic
1187621125 X:21056410-21056432 GTGTACAACATGAGAACTATAGG - Intergenic
1189169020 X:38891198-38891220 ATCTACAAAATGAGGATTATAGG + Intergenic
1189780523 X:44509942-44509964 ATCAACAACGTAAGGACTATAGG - Intergenic
1190124548 X:47692141-47692163 ATGTACAACATGAGGACTATAGG + Intergenic
1192629954 X:72769622-72769644 ATGCACACAATGAGGAGGATGGG - Intergenic
1192651756 X:72951182-72951204 ATGCACACAATGAGGAGGATGGG + Intergenic
1193842739 X:86428125-86428147 ATGCACAAAATTAGGAAAATAGG + Intronic
1194178609 X:90685244-90685266 ATGTGCAACATGAGGAGTACTGG - Intergenic
1195929240 X:110057093-110057115 ATGTACAGCATGGCGACTATAGG - Intronic
1196051121 X:111305469-111305491 ATATAAAATATGAGGACTATAGG - Intronic
1196361148 X:114861105-114861127 ATGTACAACATGTGGACGATAGG - Intronic
1197179293 X:123517238-123517260 ATGTACATCATGAGTACTCTGGG + Intergenic
1197299901 X:124765326-124765348 AAGCACAACATTAGGCCTGTTGG - Intronic
1198207477 X:134481175-134481197 ATGTACAACATGAAGTATATAGG - Intronic
1200525273 Y:4267407-4267429 ATGTGCAACATGAGGAGTACTGG - Intergenic