ID: 1158010322

View in Genome Browser
Species Human (GRCh38)
Location 18:52720730-52720752
Sequence GCTCTGTGTCACAAGTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158010322_1158010323 -10 Left 1158010322 18:52720730-52720752 CCATTTAACTTGTGACACAGAGC 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1158010323 18:52720743-52720765 GACACAGAGCTCTTCCTGTGTGG 0: 1
1: 0
2: 0
3: 30
4: 226
1158010322_1158010325 12 Left 1158010322 18:52720730-52720752 CCATTTAACTTGTGACACAGAGC 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1158010325 18:52720765-52720787 GTTACCAATTCTGTACTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158010322 Original CRISPR GCTCTGTGTCACAAGTTAAA TGG (reversed) Intronic
901201814 1:7471512-7471534 GCTCTGTGTCACAGCTGACAGGG + Intronic
906817580 1:48894986-48895008 GCAGTGTTTCACTAGTTAAAAGG + Intronic
911276207 1:95862185-95862207 TCTCTGTGTCTCCAGTTAGAGGG + Intergenic
913529772 1:119725422-119725444 GCTCTGTCTCACTAGGTCAAAGG + Intronic
914384385 1:147153733-147153755 GTTCTGTGTCAGAAGTTAGAAGG - Intergenic
914760882 1:150597082-150597104 GTTCTGTGTCTCAAGCCAAAAGG - Intergenic
914887455 1:151597085-151597107 GCTCTGGGACATGAGTTAAAGGG + Intergenic
916824697 1:168432189-168432211 GCTCTCTGAGCCAAGTTAAAGGG + Intergenic
920013260 1:202885670-202885692 GCTCTGTGTCACACATTTTAAGG - Intronic
921971971 1:221159801-221159823 GTTATGTGTCCCAAGTTGAATGG - Intergenic
1062949913 10:1491104-1491126 GCTCTGTGGCCCAGGTTGAAGGG + Intronic
1066338751 10:34507890-34507912 GCTCCACTTCACAAGTTAAAAGG + Intronic
1066370159 10:34813956-34813978 ACTGTGTGTCAGAAGTGAAAAGG - Intronic
1067369675 10:45672059-45672081 GATCTGTGTCACAGTTTTAATGG - Intronic
1068722782 10:60264601-60264623 GCTCTGTCACACAGGTGAAATGG - Intronic
1068846030 10:61675389-61675411 GCCCTGTGGTTCAAGTTAAAAGG + Intronic
1069327790 10:67252175-67252197 GCTCTGTTGCCCAAGTTAGAGGG - Intronic
1070261486 10:74860236-74860258 GCTATGTGTCACATACTAAATGG - Intronic
1081027927 11:38038407-38038429 GCTCTCTGTCTCAAGGTGAAAGG + Intergenic
1082634158 11:55576539-55576561 GCTCTGTGCCAAAAGTTGGAAGG - Intergenic
1082867544 11:57913462-57913484 CCTCTGTCTCCCAGGTTAAAGGG - Intergenic
1086485959 11:87301998-87302020 ACTCAGTGTCCCAAGTTAAAGGG + Intronic
1086852153 11:91822555-91822577 GCTCTGGGTCACATACTAAATGG + Intergenic
1088111207 11:106264143-106264165 CCACTGTGTCACAAGGTAAGTGG - Intergenic
1093308718 12:17551329-17551351 CCTCTGAGGCACAATTTAAAGGG - Intergenic
1095189778 12:39244243-39244265 GCACTGGCTCACAGGTTAAAAGG - Intergenic
1096853935 12:54464848-54464870 GTTCTTTGTCACTAGTTAATGGG + Intronic
1100882769 12:99036938-99036960 GCTCTGTGTCACAGATTAATTGG + Intronic
1101623412 12:106414162-106414184 GCACTGTGTCATAATTTAACTGG - Intronic
1103088608 12:118081407-118081429 CCTCTGCGTCCCAAGTTCAAGGG + Intronic
1103669415 12:122600009-122600031 ACTCTGTGTCAAAAATAAAAAGG + Intronic
1105712969 13:23030785-23030807 CCTCTGTCTCCCAAGTTCAAGGG - Intergenic
1109330361 13:60921525-60921547 GCTCTGTGTCACAGGAGATAGGG - Intergenic
1109400597 13:61822958-61822980 GCTCTTTGTACCAAGTTGAAAGG + Intergenic
1112554059 13:100450358-100450380 GCTCTGTCACACAAGCTAGAGGG - Intronic
1112622048 13:101062956-101062978 GCTGTGTGTCAAGGGTTAAATGG - Intronic
1112798956 13:103089370-103089392 CCTCTGTCTCCCAAGTTCAAGGG - Intergenic
1112993581 13:105544684-105544706 ACTCTGTGACACAACATAAAGGG + Intergenic
1118262773 14:64262901-64262923 ACTCTGTCTCAAAAGATAAAAGG + Intronic
1119890567 14:78179172-78179194 CATCTGTGTCACAGGATAAAGGG + Intergenic
1120162667 14:81162536-81162558 GCTTTGGGTCAAATGTTAAAGGG - Intergenic
1121713729 14:96058001-96058023 GCTCTGTGTAACACGTTCAACGG - Intronic
1122006649 14:98710846-98710868 GCCCTGTGACACAAGTTCAGTGG - Intergenic
1123693131 15:22855863-22855885 GCTATGTATCACACGTTAATTGG - Intronic
1127329095 15:57921542-57921564 GCTCTGAGTCACAGGGTACAGGG + Intergenic
1127900813 15:63339546-63339568 GCTCTGAGTCACCTGGTAAATGG - Intronic
1130829439 15:87584452-87584474 GCTCTGTGTCCCAATTAATATGG + Intergenic
1133479712 16:6158338-6158360 GTTCTGTGTCAGAAGTTCAGTGG + Intronic
1137863999 16:51875147-51875169 TCTCTGTGTCTTAATTTAAAAGG + Intergenic
1138903166 16:61298799-61298821 ACTCTGTCTCACAAGCTGAAAGG + Intergenic
1146249555 17:31326637-31326659 GCTCTGTCTCAAAAAATAAAAGG + Intronic
1146394689 17:32454923-32454945 GCTTTGTGACACAAGATGAAAGG - Intronic
1150043891 17:61892375-61892397 GCTATATCTAACAAGTTAAAAGG - Intronic
1152136062 17:78504373-78504395 GCACTGTGTTTCCAGTTAAAAGG - Intronic
1155608884 18:27640464-27640486 CCTCTGGGTTAGAAGTTAAAAGG - Intergenic
1156409982 18:36818368-36818390 GCTCTGTCTCCCAGATTAAATGG - Intronic
1157509446 18:48259762-48259784 GTTCTGTGTCATTAGTTATAAGG + Intronic
1157993615 18:52527935-52527957 CCTCTGTATTACAAGTAAAATGG - Intronic
1158010322 18:52720730-52720752 GCTCTGTGTCACAAGTTAAATGG - Intronic
1159524685 18:69572808-69572830 CCTCTGTGTCATAAATGAAATGG - Intronic
1159701618 18:71636626-71636648 GATCTGTGTCAAAAGGCAAAAGG + Intergenic
1161938909 19:7390159-7390181 GCTCTGTGGCACAGGCTAGAGGG - Intronic
1162950224 19:14067670-14067692 CCTCTGCCTCACAAGTTCAAGGG + Intergenic
1163225694 19:15959569-15959591 GCTCTGTCACCCAGGTTAAAGGG + Intergenic
1164325203 19:24185175-24185197 GCTCTATGTCAAAATTAAAACGG + Intergenic
1165753293 19:38275126-38275148 GCTCTGTATCGTAAGTTATATGG + Intronic
1166810593 19:45512137-45512159 ACTCTGTCTCAAAAGATAAATGG + Intronic
1168011375 19:53536145-53536167 TCTCTGTCTCCCTAGTTAAAAGG + Intronic
931620045 2:64200665-64200687 CCTCTGTGTCCCAAGTTCAAGGG + Intergenic
933527643 2:83463723-83463745 GCTATGTGTCATAAATTAAGTGG + Intergenic
935680981 2:105636769-105636791 ACCCTGTGTCACAACTTAGAAGG - Intergenic
936682460 2:114789809-114789831 GCTCTGTGTCACAAGGAATTGGG - Intronic
937141912 2:119609276-119609298 GCTCTGTGTCTGAATTTAATTGG + Intronic
937653996 2:124353834-124353856 TCTCTGTGACACAATTAAAATGG - Intronic
938742028 2:134241561-134241583 GCTGTGTATTACAGGTTAAATGG + Intronic
940350689 2:152683403-152683425 GCTTTATTTCACAAATTAAATGG + Intronic
942131793 2:172887101-172887123 GCTCTGAATCACAGGTTCAAGGG - Intronic
946260162 2:218482868-218482890 GTTCTGTGTGAGAAGTGAAAAGG - Intronic
946688393 2:222293532-222293554 GCTCTGGGTTACAAATTGAAGGG - Intronic
946795008 2:223341183-223341205 TGTCTGTGTCACATGTAAAATGG + Intergenic
947558837 2:231127195-231127217 GATTTGAGTAACAAGTTAAAAGG + Intronic
1169462535 20:5808194-5808216 CCTCTGTGTCCCAGGTTCAAGGG - Intronic
1173265618 20:41477205-41477227 GCTCTGTCTCCCAAGCTAGAGGG - Intronic
1174988921 20:55487651-55487673 GCTCTGTGGCCCAGGCTAAAGGG - Intergenic
1175585654 20:60137472-60137494 GCTCTGTGTGAGAAGTTCTAAGG + Intergenic
1176665831 21:9686677-9686699 GCTCTGTTTCTGAAGTTTAAAGG - Intergenic
1179669869 21:42939133-42939155 GCTCAGTGGCACAAGGAAAAGGG - Intergenic
1181535205 22:23538434-23538456 AATCTGTGTCACAAGTTCAAGGG - Intergenic
1182861636 22:33564847-33564869 GCTGTGTTCCACAAGTTCAAAGG - Exonic
1183356361 22:37361902-37361924 GCACTATCTCACAACTTAAAGGG + Intergenic
951509803 3:23487690-23487712 GCTCTGAGTTACAAGGTAAGTGG + Intronic
952000553 3:28780992-28781014 GCTCTGTGTCTTAAGTAAATTGG + Intergenic
952108799 3:30098701-30098723 GTGCTGAATCACAAGTTAAAGGG + Intergenic
952595519 3:35013292-35013314 GCTCTGTGTTATAGATTAAATGG - Intergenic
956836987 3:73103536-73103558 GCTCTGTGTCATTATTTTAATGG - Intergenic
960772177 3:121206778-121206800 GCTCTGTTGCACAGGTTGAAGGG - Intronic
963714948 3:148792491-148792513 GCTCTTTGTCCGAAGTTTAATGG + Intronic
964887376 3:161500116-161500138 CCTCAGTGTCACATGTCAAAAGG + Intronic
967275919 3:187774413-187774435 ACTCCATGTCAGAAGTTAAAAGG - Intergenic
967538757 3:190640189-190640211 TCTCTGTGCCACAGTTTAAAAGG + Intronic
967560139 3:190907516-190907538 GCTCTTTGTCACAAATTAAGTGG + Intergenic
971170982 4:24232322-24232344 GCTCTGCATCACTAGTTAAACGG - Intergenic
971893406 4:32556231-32556253 GGTCTGTGTCATAAGAGAAATGG - Intergenic
974015895 4:56648874-56648896 CCTCTGTGGCACAAGTGGAAAGG + Intronic
975816629 4:78223666-78223688 GCTCTGTTTGGCAAGTGAAATGG - Intronic
976133514 4:81910208-81910230 GCTCTGTATCACATGTTATCAGG + Intronic
976338878 4:83922714-83922736 GCTCTGTTTCAAAACTAAAAGGG - Intergenic
976436327 4:85022630-85022652 GCTCTGTGTCTCAAGCTAGAGGG - Intergenic
979757126 4:124354775-124354797 GATGTGAGTCACAAGTTCAAAGG + Intergenic
980227310 4:130003158-130003180 ACACTGTGACAAAAGTTAAAAGG - Intergenic
980668111 4:135966660-135966682 CATATCTGTCACAAGTTAAATGG + Intergenic
981112323 4:140949718-140949740 TCTCTGTGTCACAAATTGAGTGG - Intronic
982661161 4:158208920-158208942 GCTCTGTGGCATAATGTAAAAGG + Intronic
985411560 4:189690935-189690957 GCTCTGTTTCTGAAGTTTAAAGG - Intergenic
992166353 5:74055876-74055898 GCTTTGTGTGAGAAGTGAAAAGG - Intergenic
998050598 5:139029971-139029993 GCTCTGTGTCACAATTTTTTTGG - Intronic
998956940 5:147448305-147448327 TCTCTGTATCAAAAGTTCAAAGG + Intronic
1003093096 6:3120544-3120566 GCTCAGTGTCAGTAGGTAAAAGG + Intronic
1004052320 6:12098119-12098141 GCACTGTGTCATAACTTAATTGG - Intronic
1005646420 6:27843519-27843541 GCTCTGAAACACAAGTTAAAAGG - Intronic
1006321903 6:33324106-33324128 GCTCTGTGACCCTAGTTAAGTGG - Intronic
1009317753 6:62243027-62243049 CCTCTGTGTCTGAAGCTAAAAGG + Intronic
1010488244 6:76442205-76442227 GCTCAGTGTGTCAAGTTACAGGG - Intergenic
1012055126 6:94396634-94396656 GTTCTGTGTCCCCAGTTAAATGG - Intergenic
1012134033 6:95533463-95533485 GCTCTGTGTCAGACTGTAAATGG - Intergenic
1012259620 6:97072508-97072530 GCCCTGTGTACCAAATTAAAAGG - Intronic
1012370924 6:98506230-98506252 TTTCTGTGTGCCAAGTTAAAAGG - Intergenic
1015028043 6:128560997-128561019 ACTGTGTGTCACAAGATAATGGG - Intergenic
1019982765 7:4633604-4633626 GCTCTGTCTCAAAAAATAAAAGG + Intergenic
1024399161 7:48903975-48903997 GCTCTCTGGCACAAGGGAAAAGG + Intergenic
1025113332 7:56237505-56237527 GCTCTGTTTCCCAAGTTGAAGGG + Intergenic
1029091064 7:98048803-98048825 GTTCTTTGTCAGAAGTTAGAGGG - Intergenic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1038992966 8:32889618-32889640 TCTCTGTGTCTCATGTTTAAGGG + Intergenic
1039796319 8:40918464-40918486 GCTCTGTCTCACAATGTAATAGG + Intergenic
1040904128 8:52448031-52448053 CCTCTATGTCCAAAGTTAAAAGG + Intronic
1041315992 8:56563055-56563077 GCTCTGTGCCATCAGTTACAGGG - Intergenic
1042742012 8:72059858-72059880 TCTCTTTGGCAAAAGTTAAAAGG + Intronic
1042757625 8:72234463-72234485 CCTCTTTGGCAAAAGTTAAATGG + Intergenic
1043084476 8:75811194-75811216 GGTCTGTGTCACAAGTTACGAGG - Intergenic
1044585631 8:93867040-93867062 GCTCTGTGGCCCAGGCTAAAGGG + Intronic
1046564032 8:115875590-115875612 GCTCTGTGTCAAATGTTAAGTGG - Intergenic
1050154827 9:2655401-2655423 GCTGTGTGTCACAAGTGAGGTGG + Exonic
1050856016 9:10356761-10356783 CCTCTGTCTCCCAAGTTCAAGGG + Intronic
1051841089 9:21399105-21399127 CCTCAGTGTCACTAGTGAAAAGG + Intergenic
1055295712 9:74830934-74830956 GCAATGTGTCACATTTTAAACGG + Intronic
1055874392 9:80924651-80924673 GCTCTGTTTCACAGTTAAAATGG + Intergenic
1055895408 9:81168835-81168857 GGTAAGTGTCACAAGGTAAAAGG - Intergenic
1056424845 9:86465902-86465924 GCTCTGTGGCCCAAGTTGGATGG + Intergenic
1058190266 9:101905825-101905847 GCTCTGTATGACAATGTAAAAGG - Intergenic
1058764323 9:108166471-108166493 GCTCTGCATAAAAAGTTAAAAGG - Intergenic
1203660269 Un_KI270753v1:35084-35106 GCTCTGTTTCTGAAGTTTAAAGG + Intergenic
1203671036 Un_KI270755v1:12047-12069 GCTCTGTTTCTGAAGTTTAAAGG + Intergenic
1186162234 X:6789445-6789467 GCATTGTGTCCCAAGTTTAATGG + Intergenic
1187045605 X:15645699-15645721 CCTCTGTATTACAAGTGAAAGGG + Intronic
1188462217 X:30441590-30441612 CCTCTGTGTTACAAGGGAAAAGG + Intergenic
1195317151 X:103690306-103690328 CCTCAGTGTCACATATTAAATGG + Intergenic
1196208678 X:112970463-112970485 GCTCTGTGTTACAAGTTATTTGG + Intergenic
1196948487 X:120851989-120852011 GCTCTGTTGCACCAGTGAAAAGG - Intergenic
1199779332 X:151044023-151044045 GTTCTGTGTGACATGTTAAGGGG + Intergenic