ID: 1158014052

View in Genome Browser
Species Human (GRCh38)
Location 18:52763419-52763441
Sequence TGGGATTCAAAGGATGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158014052_1158014058 12 Left 1158014052 18:52763419-52763441 CCAGGAGCATCCTTTGAATCCCA 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1158014058 18:52763454-52763476 CACTCCATGAGCCAACCTTGTGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158014052 Original CRISPR TGGGATTCAAAGGATGCTCC TGG (reversed) Intronic
901959241 1:12811224-12811246 TGGGATTCCAAAGCTTCTCCAGG - Intergenic
901974496 1:12933354-12933376 TGGGATTCCAAAGCTTCTCCAGG - Intronic
902010675 1:13268413-13268435 TGGGATTCCAAAGCTTCTCCAGG + Intergenic
903195413 1:21683168-21683190 TGGGCTTCAAGTGATTCTCCTGG - Intronic
904796423 1:33059706-33059728 TGGCATTCAAAAGATTCCCCAGG + Intronic
905684027 1:39896149-39896171 TGGGTTTTAAAGGAGCCTCCAGG - Exonic
905725365 1:40246695-40246717 TGGGGTTCAAGCGATTCTCCTGG - Intronic
907627068 1:56040592-56040614 TAGATTTCAAAGGATGCCCCCGG - Intergenic
908982851 1:69979266-69979288 TGGGCTTCAAAGGAAGCACAAGG + Intronic
911413618 1:97542462-97542484 TGGGATTTAAAGAAGGCTACTGG - Intronic
915825509 1:159071809-159071831 TAGGATTCAAAGTATGCTTTTGG - Intronic
916397964 1:164412692-164412714 TAGATTTCAAAGGATGCCCCAGG + Intergenic
918306393 1:183250595-183250617 TGGGATTAAATGGCTGGTCCAGG - Exonic
1063787253 10:9399966-9399988 TAGGATTCAGAGGAGGCTCAAGG - Intergenic
1066003116 10:31123056-31123078 TGGGGTTCAAACGATTCACCTGG - Intergenic
1068797420 10:61098993-61099015 AGGGATTCAGAGGATGCTAAAGG + Intergenic
1069778648 10:70941350-70941372 TGGGTTTCCAAGCATGCTCAGGG + Intergenic
1070264997 10:74893561-74893583 TGGGGTTCAAGCGATTCTCCTGG + Intronic
1070397828 10:76027185-76027207 TGGAATTCAAACAAAGCTCCAGG + Intronic
1072228421 10:93391499-93391521 TTGGATTCAAGTGATTCTCCTGG - Intronic
1073327426 10:102650797-102650819 TGGGATGGAAAGGAGGCTGCTGG + Intronic
1075608676 10:123834577-123834599 TGGAACAAAAAGGATGCTCCTGG + Intronic
1085608187 11:77921935-77921957 CCGGATTCAAATGATTCTCCTGG - Intronic
1085703048 11:78762283-78762305 TGTGGTTCAAGGGAGGCTCCTGG - Intronic
1086345580 11:85892373-85892395 TGTGATTCAGATGATGCTTCTGG - Intronic
1091251365 11:134146865-134146887 AAGGATTCAAAAAATGCTCCTGG - Intronic
1091989282 12:4941562-4941584 AGGGATCCAAGGGATGCTGCAGG + Intergenic
1097012984 12:55966462-55966484 TGGTTTCCAAAGGAGGCTCCTGG + Intronic
1098231548 12:68376305-68376327 TGGGCTTCAAAGGATGCATATGG - Intergenic
1102435491 12:112919537-112919559 TGGCATTCAGAGGATGGTGCAGG - Exonic
1102586347 12:113925757-113925779 TTGAATTCAGAGGATGCTCTTGG + Intronic
1103935055 12:124471202-124471224 TGGGTTTTGAAGGACGCTCCAGG - Intronic
1106579105 13:31002471-31002493 TTGGATTCAAAGGATATTCAGGG + Intergenic
1107415276 13:40194170-40194192 TTGGATTCTACGGAAGCTCCTGG + Intergenic
1107975267 13:45682199-45682221 TGGGCTCCAAAGGATGCACAAGG + Intergenic
1108148752 13:47508463-47508485 TGGAATTCAAAGTGTGGTCCTGG + Intergenic
1108401303 13:50047103-50047125 TGGAATTCAAGTGATTCTCCCGG + Intergenic
1108560936 13:51643332-51643354 AGTGATTCAGAGGATGCCCCTGG - Intronic
1109067444 13:57716522-57716544 TGTGATTCAAAGGCTGATCAGGG - Intronic
1114973928 14:28070182-28070204 TTGGACTCAAATGATTCTCCTGG + Intergenic
1117955757 14:61122598-61122620 TGGGACCCATAGCATGCTCCAGG + Intergenic
1118648227 14:67861270-67861292 TGTGATTCAAATGATTCTCATGG - Intronic
1119542234 14:75447749-75447771 TGGGGTTCAAGTGATTCTCCTGG + Intronic
1123010808 14:105348724-105348746 TGGGAATGACAGGATGCTCCTGG + Intronic
1125102154 15:35926610-35926632 TTGGGTTCGAAGGATCCTCCAGG - Intergenic
1131969423 15:97876734-97876756 TGGGATGTTAAGGATGCTCGGGG - Intergenic
1133095419 16:3441884-3441906 CTGGATTCAAACGATTCTCCTGG - Intronic
1135845003 16:25910901-25910923 TGTGAGTCAAACGAAGCTCCTGG - Intronic
1136360841 16:29778735-29778757 AGGGATTTAAACCATGCTCCAGG + Intronic
1136361016 16:29779766-29779788 AGGGATTTAAACCATGCTCCAGG + Intronic
1137507527 16:49067354-49067376 AGGGATTCTAAGTATGATCCTGG + Intergenic
1137834742 16:51580830-51580852 TAGGATTCAAGAGATTCTCCTGG + Intergenic
1138285846 16:55809737-55809759 TGGGATCCAGAGGATTGTCCAGG - Intronic
1139791009 16:69435356-69435378 TGGTACTCAAAAGATGCTGCAGG - Intronic
1144952461 17:19001658-19001680 TGGGAAGCAAAGGAAGCTCCAGG + Intronic
1146828031 17:36041071-36041093 TGGGATTTGCGGGATGCTCCTGG - Intergenic
1147534410 17:41309643-41309665 TTGGATTCAGAGGATGCCACAGG + Intergenic
1148125613 17:45235019-45235041 AGGGATTCACAAGATGCTCTAGG - Intronic
1150106535 17:62466513-62466535 TGGGTTTCAAGTGATTCTCCTGG - Intronic
1150106980 17:62469459-62469481 TGGGATTACAAGCATGCGCCAGG - Intronic
1150832796 17:68539427-68539449 GGGAATGCAAAGGATGCTGCCGG - Intronic
1151102190 17:71568681-71568703 TGGGATTTAAAGCCTACTCCAGG + Intergenic
1151282850 17:73089476-73089498 TGGGCTGCAGAGGGTGCTCCGGG - Intronic
1152405416 17:80095495-80095517 TGGGATTCAAGGAACACTCCAGG + Intronic
1153482486 18:5561315-5561337 TGGCACCAAAAGGATGCTCCAGG - Intronic
1156128772 18:33941398-33941420 TGGGATTAAAAGGGCTCTCCTGG - Intronic
1157886981 18:51378095-51378117 TGGAATGCAAAGGAAGCTCGTGG - Intergenic
1158014052 18:52763419-52763441 TGGGATTCAAAGGATGCTCCTGG - Intronic
1158034282 18:53005632-53005654 TGGGGTTCAATCGATTCTCCTGG - Intronic
1159210280 18:65311961-65311983 TGAGTGTCATAGGATGCTCCAGG - Intergenic
1159550471 18:69890384-69890406 TGGGGTTTCAAGGATGGTCCTGG - Intronic
1159872972 18:73779225-73779247 TGAGTCTCAAAGGATGCTCATGG + Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1162650574 19:12085899-12085921 TGCCATTCAAGGGTTGCTCCAGG - Intergenic
1163480077 19:17550108-17550130 TGGGATACAAAGGCTGGGCCTGG - Intronic
1166781763 19:45346832-45346854 TGGGATTCTAAGGAGGGTCTGGG - Intronic
1166781772 19:45346861-45346883 TGGGATTCTAAGGAGGATCTTGG - Intronic
1166862635 19:45818863-45818885 AGGGCTTCAAAGGCAGCTCCTGG - Intronic
936697668 2:114969799-114969821 AGGGATCTAAAGGATGCACCTGG + Intronic
938893510 2:135728413-135728435 TGGGATTCAAAGCTGGCCCCTGG + Intergenic
940047047 2:149420945-149420967 TGGGATTTTAAGAATCCTCCAGG - Intronic
943955399 2:194182441-194182463 TAAGATTTAAAGTATGCTCCTGG + Intergenic
944183719 2:196926033-196926055 TGGGAAGCAAAGGAAGGTCCTGG + Intronic
945239144 2:207660505-207660527 TGGGGTTCAAGCGATTCTCCTGG - Intergenic
946337960 2:219050870-219050892 TGGGGTTCAAGGGACCCTCCAGG - Intergenic
1169111789 20:3038839-3038861 TGGGAATGAAAGGAGGGTCCTGG - Intronic
1172315533 20:33951304-33951326 TGGGATGATAAGGATGATCCAGG - Intergenic
1173970356 20:47147751-47147773 TGGGGTTTAAAGAATGGTCCAGG + Intronic
1175899978 20:62356130-62356152 TGGGATGCACAGGAAGATCCTGG + Intronic
1177231708 21:18330195-18330217 TGGGGTTCAAAGGATGTTGGAGG - Intronic
1177233544 21:18355389-18355411 TGGAATTCAAGGTAAGCTCCTGG - Intronic
1179955235 21:44734748-44734770 TGGGATTCAAGGCATGATACGGG + Intergenic
1180041090 21:45280518-45280540 AGGGGCTCAAAGGCTGCTCCTGG - Intronic
1182790710 22:32950559-32950581 TGGGAATCAGAAGAAGCTCCCGG - Intronic
1183018999 22:35012266-35012288 TGGTATTGAAAGGAAACTCCTGG - Intergenic
1185058370 22:48592835-48592857 AGGGATTCCAGGGAAGCTCCAGG - Intronic
949230895 3:1749186-1749208 TTGGGTTCAAGGGATTCTCCTGG - Intergenic
951827980 3:26889662-26889684 AGGGATTTGAAGGAAGCTCCAGG - Intergenic
952898623 3:38095492-38095514 GGGCATGAAAAGGATGCTCCGGG + Intronic
955379996 3:58430692-58430714 TGGAATTCAGAGGATGCTAAAGG - Exonic
956426717 3:69143918-69143940 AAGGATTCTAAGGTTGCTCCTGG - Intergenic
959593065 3:108100293-108100315 TGGTTCTCAAAGGATGCTACTGG + Intergenic
962235318 3:133701902-133701924 AGGGATCCAAAGGAAGCCCCAGG - Intergenic
967714798 3:192750367-192750389 AGGAATTCAAAGAATGCTTCAGG + Intronic
968197595 3:196721677-196721699 TGGGATTCAAATGATGCAGGAGG - Intronic
970223498 4:13834199-13834221 TGGGCTTCCAAGGAGCCTCCAGG + Intergenic
970548575 4:17155603-17155625 CAGGATTCAGAGGATGCTGCTGG + Intergenic
976438022 4:85041735-85041757 TGGGATTCATTGTATGCCCCGGG + Intergenic
976640794 4:87335843-87335865 CGGGGTTCAAATGATTCTCCTGG + Intergenic
980759669 4:137214148-137214170 TGGCATTGCAAAGATGCTCCAGG - Intergenic
983988476 4:174089765-174089787 TGTGTTTAAAAGGATGCTTCTGG - Intergenic
984305131 4:177979641-177979663 TGGGCTGCAATGGATGCTACAGG + Intronic
986286905 5:6365808-6365830 TGTGAGTCACAGGATGCTGCTGG + Intergenic
990496766 5:56355937-56355959 TGGGATTTAAAGAATGATCAAGG - Intergenic
996263650 5:121507462-121507484 TGGGGTTCAAATGATTGTCCTGG + Intergenic
999133968 5:149305337-149305359 TGAGCTTCAAAGTATGTTCCAGG + Intronic
1006258711 6:32851250-32851272 TGGGGTTCTAAGGAGGCTGCAGG + Intronic
1006424518 6:33955920-33955942 TGGGATTCTAATCATACTCCTGG + Intergenic
1007229200 6:40336698-40336720 TGGGGGTGTAAGGATGCTCCTGG - Intergenic
1007979331 6:46134440-46134462 TTGAGTTAAAAGGATGCTCCAGG - Intronic
1008100241 6:47382649-47382671 TGGTAATCATAGGATGCTACTGG + Intergenic
1008100253 6:47382768-47382790 TGGTAATCATAGGATGCTACTGG + Intergenic
1008593016 6:53012311-53012333 TGCTATGCAAAGGAGGCTCCTGG + Intronic
1012181276 6:96156073-96156095 TGATGTTCAAAGGATGCTTCTGG + Intronic
1020687834 7:11317564-11317586 TGGGGTTCAATGGCTGGTCCTGG + Intergenic
1023065434 7:36373009-36373031 TGGGATTCAAGCAATCCTCCTGG - Intronic
1024515209 7:50245775-50245797 TAGGATTCAACTGATGCTTCTGG - Intergenic
1029725370 7:102399864-102399886 TGGGATTACAAGCATGCACCTGG - Intronic
1030841162 7:114356064-114356086 TGGAATTCAAAGGAGGCACTTGG - Intronic
1030852950 7:114513545-114513567 TGGGATTCTGATGATGCTCTGGG + Intronic
1030922366 7:115407669-115407691 GGCCATTCAAAGCATGCTCCTGG + Intergenic
1031578127 7:123440296-123440318 TGGAATCCAAAGGATTCTCTGGG - Intergenic
1032223866 7:130014752-130014774 TGGGGTTAAAAGGATGTCCCAGG + Intergenic
1032461145 7:132112434-132112456 AGCTATTCAAAGGATGGTCCAGG + Intergenic
1033528596 7:142241742-142241764 TGGGATTCAAAAGGTGTTGCAGG - Intergenic
1037615337 8:20514152-20514174 TGGGCTTCAAAAGATGCTGGTGG + Intergenic
1043003918 8:74794924-74794946 TGGTATCCACAGGAAGCTCCTGG - Intronic
1043095993 8:75973522-75973544 TGGGATTCAGAGGATGAACCAGG - Intergenic
1044045457 8:87426063-87426085 TGGGAGTGAACGGATTCTCCAGG + Intronic
1045420995 8:102014972-102014994 TGGTATTCAAAGGGTGGTCCAGG - Intronic
1048183171 8:132214851-132214873 TGGGATTCAGTAGGTGCTCCAGG + Intronic
1048519999 8:135144839-135144861 CTGGTTTCAAAGGATGCACCAGG - Intergenic
1048578612 8:135712392-135712414 TGGTATACAAAGGATGTTCCCGG - Intergenic
1049009251 8:139876339-139876361 TGGGATCCACAGCCTGCTCCAGG + Intronic
1051883488 9:21864819-21864841 TGGCATCCACAGGATGCTCCTGG + Exonic
1051968958 9:22863674-22863696 TAGGTTTCAAAGGATGCCCCAGG - Intergenic
1052802745 9:32985294-32985316 TGGGACTCAAAGGCTCCTCAAGG + Intronic
1053301794 9:36957650-36957672 TGGGATAAACAGGATGCTCGTGG - Intronic
1053369823 9:37551410-37551432 TAGATTTCAAAGGATGCTGCAGG - Intronic
1054928711 9:70614404-70614426 TGGGATTCAAGGGATCCTCTGGG - Intronic
1055439353 9:76323300-76323322 TGGGATTCAAAATAGGCTCCGGG + Intronic
1056101909 9:83308106-83308128 TGGTGTTCAAATTATGCTCCTGG + Intronic
1056887564 9:90457851-90457873 TGGAATCCAAAGGATGAGCCTGG - Intergenic
1057008366 9:91580913-91580935 TGGGGCTCAGACGATGCTCCTGG + Intronic
1058537095 9:105972855-105972877 CAGGATTCCAAGGATGCCCCAGG - Intergenic
1058787543 9:108405013-108405035 TAGGATTCAAAGGATGTTTAGGG - Intergenic
1059061740 9:111039817-111039839 TGGTTTTCACAGGATGCTCAGGG + Intergenic
1059529586 9:115023602-115023624 TGGGATTCCAAAGATGCCCCAGG + Intronic
1060885650 9:127150257-127150279 TGGGGCTCAAATGAGGCTCCTGG - Intronic
1061837772 9:133340850-133340872 TGGGAGACCAAGGATGGTCCTGG + Exonic
1062378724 9:136276578-136276600 TGGGAGACAGAGGCTGCTCCCGG + Intergenic
1189143224 X:38628217-38628239 TGGGACTTACAGGATGCTCCTGG - Intronic
1189666224 X:43357669-43357691 TAGATTTCAAAGGATGCTTCTGG - Intergenic
1194701229 X:97117220-97117242 TAGGATTCGAAGGATGTTCCTGG + Intronic
1195650093 X:107274986-107275008 TGTGTTTTAAAGGATCCTCCAGG + Intergenic
1197505733 X:127301736-127301758 TGGTATTCAAAGTATCATCCTGG - Intergenic
1198401693 X:136274896-136274918 TGGGAGTCACAGGATGTTCTAGG - Intergenic
1199082848 X:143595595-143595617 TGGGTTTTAAAGGAGACTCCAGG - Intergenic
1199728765 X:150609928-150609950 TGAGATCTAAAGGATGCTTCTGG - Intronic
1200971419 Y:9156375-9156397 TGGGGTTCAAGGGATTCTCCTGG - Intergenic
1202029790 Y:20559640-20559662 TGGGATTGAAAGGAGGTTCTAGG - Intergenic
1202139607 Y:21707933-21707955 GGGGGTTCAAGGGATTCTCCTGG + Intergenic
1202152529 Y:21856399-21856421 TGGAAGGCAAAGGGTGCTCCAGG - Intergenic