ID: 1158014736

View in Genome Browser
Species Human (GRCh38)
Location 18:52770946-52770968
Sequence CCTCACATGCTGAGGAAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158014730_1158014736 25 Left 1158014730 18:52770898-52770920 CCTTCAAAGCACATAGTCCAGAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1158014736 18:52770946-52770968 CCTCACATGCTGAGGAAGACGGG 0: 1
1: 0
2: 0
3: 17
4: 194
1158014729_1158014736 29 Left 1158014729 18:52770894-52770916 CCATCCTTCAAAGCACATAGTCC 0: 1
1: 0
2: 1
3: 8
4: 166
Right 1158014736 18:52770946-52770968 CCTCACATGCTGAGGAAGACGGG 0: 1
1: 0
2: 0
3: 17
4: 194
1158014731_1158014736 8 Left 1158014731 18:52770915-52770937 CCAGAGATCATTTCGTTTTCTAT 0: 1
1: 0
2: 1
3: 21
4: 306
Right 1158014736 18:52770946-52770968 CCTCACATGCTGAGGAAGACGGG 0: 1
1: 0
2: 0
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158014736 Original CRISPR CCTCACATGCTGAGGAAGAC GGG Intronic
901057690 1:6456335-6456357 CCTCAGAGGCTGAGGCAGCCTGG - Intronic
902470068 1:16643035-16643057 CCTCAGATGCTGAGAAATCCAGG - Intergenic
902472830 1:16661067-16661089 ACTCACATGCTGGTGAAGAAGGG - Intergenic
902476663 1:16692120-16692142 CCTCAGAGGCTGAGGCAGCCTGG + Intergenic
902485973 1:16746376-16746398 ACTCACATGCTGGTGAAGAAGGG + Intronic
906940822 1:50253610-50253632 CCCCACTTACTGAGGAAGAATGG + Intergenic
912208258 1:107532002-107532024 CTTCAAATGCTGGTGAAGACAGG - Intergenic
913371383 1:118103435-118103457 CCTCTGCTGCTGAGGAAGGCTGG - Intronic
914859181 1:151372433-151372455 CCAAACTTTCTGAGGAAGACGGG - Intronic
916240284 1:162632434-162632456 CCTCACATTCTGAGGATTCCTGG - Intronic
918608279 1:186456032-186456054 CCTAACATGCAGAGGAATACTGG - Intronic
919499311 1:198315914-198315936 ACCAACATGCTGAGGAACACAGG - Intronic
919513520 1:198494523-198494545 CCTCAACAGCTGAGGAAGCCAGG + Intergenic
921297793 1:213721240-213721262 CATCACATGCTGAAGAAGAAGGG - Intergenic
921901716 1:220458019-220458041 ACACACATGCTGATGAAAACGGG + Intergenic
924626455 1:245699838-245699860 CCACACTGGCTGGGGAAGACTGG - Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
924716887 1:246583803-246583825 CCCCACATTCAGAGGAACACTGG - Intronic
1063955221 10:11259212-11259234 CCTCACATGGTGCTGAAGTCAGG - Intronic
1064369242 10:14736989-14737011 CCTCACTGCCTGAGGAAGGCGGG + Intronic
1068381146 10:56255184-56255206 CCTCACCTGGTGAGGAAGAATGG + Intergenic
1070922198 10:80195030-80195052 CACCACAGGCTGAGGAAGAGAGG + Intronic
1071115507 10:82214407-82214429 CCTGATATGGTGAGGAAGGCAGG + Intronic
1072668146 10:97409443-97409465 CCTCCTAGGCTGAGGAAGACTGG + Intronic
1074851794 10:117445085-117445107 AGTCACAGGCTGAGGAAGATGGG - Intergenic
1075192126 10:120319271-120319293 GCTCAGGTGCTGAGGAGGACAGG + Intergenic
1075538695 10:123294351-123294373 CCTGAGATGCTGAGGAAGATGGG - Intergenic
1075771820 10:124944907-124944929 CCTCCCATCCTGAGGATGAGGGG + Intronic
1076530081 10:131138369-131138391 CCACACACGGTGAGGAATACAGG + Intronic
1078707975 11:13763786-13763808 ACTCTCAGGCTGAGGAAGCCAGG - Intergenic
1081937380 11:46914563-46914585 CCTCACAGGCTGAGGAGGGGAGG + Intronic
1083421118 11:62553821-62553843 CCTCAAATGCTGAGGGATAAGGG - Intronic
1084179990 11:67441380-67441402 CCTTGCATGCTGAGCAAAACAGG + Exonic
1089201165 11:116725589-116725611 CCTGACAGGCTGAGGAACAAGGG + Intergenic
1089385575 11:118065309-118065331 GCTCACAGGAGGAGGAAGACAGG + Intergenic
1090351449 11:126110994-126111016 CCTCACATGGTAAGGGAGGCAGG + Intergenic
1092501074 12:9048761-9048783 CCTCAAATCCTGAACAAGACGGG + Intergenic
1095665759 12:44795837-44795859 CCTCACATGTTAAGGGAGATGGG + Intronic
1097998193 12:65913362-65913384 ACTCAGTGGCTGAGGAAGACTGG - Intronic
1099758825 12:86892665-86892687 CCTCACCTGGTGAAGAAGAGTGG - Intergenic
1101760824 12:107657403-107657425 ACACACCTGCTAAGGAAGACTGG - Intronic
1102414396 12:112748003-112748025 ACTCACATTCTGATGGAGACAGG + Intronic
1104295843 12:127512214-127512236 CCTGACATGCTGAGAAAAAGTGG + Intergenic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1106079314 13:26487490-26487512 CCTCTCATCCTGAGGAAGCAGGG - Intergenic
1106789792 13:33143017-33143039 CCTCACATGCAGAGAGAGAGAGG - Intronic
1107804533 13:44141752-44141774 CCTCACAGGCTGTGGAATCCGGG - Intergenic
1109736872 13:66497551-66497573 CCTGACAAGCTGAGAAAGAAAGG - Intronic
1109946881 13:69445955-69445977 CCTCACATGGTGAGCAATAGAGG + Intergenic
1112315650 13:98360048-98360070 ACTCACATTCTGAGGAATTCAGG - Intronic
1115427041 14:33272142-33272164 CCTAAGATGCTGAGCAAAACAGG - Intronic
1115470511 14:33764051-33764073 CCTCTAAAGCTGAGGAAGACAGG + Intronic
1117218426 14:53576285-53576307 CTGCACATGGTGAGGAAGAGAGG - Intergenic
1118447631 14:65866279-65866301 TCTCTCAGGCTGAGGAAGAGGGG + Intergenic
1121856085 14:97271414-97271436 CCTATCAGGCTGAGGAAGAGGGG + Intergenic
1122054642 14:99085961-99085983 GCTCACATTTTGAGGAAGACTGG - Intergenic
1122130311 14:99601386-99601408 GCTGACATGCTGAGCCAGACTGG + Intronic
1122764480 14:104056068-104056090 CCTCAGATGCTGAGGACCATTGG + Intergenic
1122899114 14:104774839-104774861 CCTCACGTGCCCAAGAAGACAGG + Intronic
1124060896 15:26292883-26292905 CCTCACATGCTGGAGAGGGCTGG - Intergenic
1124585562 15:31002871-31002893 CCTCACATTCAGAAGAAGCCCGG + Exonic
1127499617 15:59544055-59544077 CCACACAGGCAGAGGAAGTCAGG + Intergenic
1128501069 15:68228104-68228126 ACTCACAGGCCGAGGGAGACAGG + Intronic
1129681189 15:77659348-77659370 CCTGACTTGCTGAGAGAGACAGG + Intronic
1132775919 16:1593948-1593970 TCTCCCATGCTGAAGAAGCCCGG - Intronic
1134389030 16:13801481-13801503 TCTAACATGCTGAAGAAGACAGG + Intergenic
1134809736 16:17157299-17157321 CCTCCCATGCTGTGGATAACTGG + Intronic
1135704981 16:24667308-24667330 CCTCTCATCCTGCAGAAGACAGG + Intergenic
1140931541 16:79632816-79632838 CCTCAGATTCGGAGGAAGAGGGG - Intergenic
1141821556 16:86449643-86449665 CCTCCTCTGCTAAGGAAGACAGG + Intergenic
1142022879 16:87795070-87795092 CCTCCCAAGCTCATGAAGACTGG - Intergenic
1142356017 16:89602446-89602468 CCTCACAGGCTGAGGACGCGGGG + Intergenic
1143668554 17:8380243-8380265 CCTCACAAACTGAGGACCACTGG - Intronic
1148739724 17:49885932-49885954 CCTCTAATGCTGAGGCAGGCAGG + Intergenic
1151599494 17:75097562-75097584 CCCAACATCCTCAGGAAGACTGG - Intronic
1153286239 18:3457404-3457426 CCTGACATGCTGAGAAAGGATGG + Exonic
1156368966 18:36455690-36455712 CCTCAGAGCCTGAGGAAGGCAGG - Intronic
1156681786 18:39598836-39598858 ACTCACACTCTGAGGAGGACAGG + Intergenic
1158014736 18:52770946-52770968 CCTCACATGCTGAGGAAGACGGG + Intronic
1158070229 18:53462005-53462027 TCTCACATGCTCAGGAAAAGTGG - Intronic
1158116430 18:54001287-54001309 TTTCACATTCTGAGGAAGAAAGG + Intergenic
1160418409 18:78727639-78727661 CCTGACATGCTGAGGACAACAGG + Intergenic
1164625612 19:29725721-29725743 CCCCACATGCTGAGGCACTCAGG - Intergenic
1166908946 19:46137255-46137277 CCTGACATGCTGAGAAAGGATGG - Intergenic
1202710684 1_KI270714v1_random:17961-17983 CCTCAGAGGCTGAGGCAGCCTGG + Intergenic
926888321 2:17617760-17617782 CCTGACAAGCTGAGGATGAACGG - Intronic
927210541 2:20636392-20636414 CCTCCCAGGCTGATAAAGACTGG + Intronic
927743737 2:25596080-25596102 CCTTACCTGCTGTGGAAAACAGG + Exonic
927981520 2:27377768-27377790 CGTCACATGCTGCGGCACACAGG - Exonic
930173886 2:48281498-48281520 CCTCATGTGCTCAGGGAGACAGG - Intergenic
934522737 2:95030197-95030219 CCTCACAGGAAGAGGAAGGCAGG + Intronic
935793411 2:106615230-106615252 ACTCACAGGCTGAAGAAAACTGG + Intergenic
936065282 2:109326860-109326882 CCTCACCTGCTGGGGAACACTGG - Intronic
937260109 2:120579997-120580019 CCTCACAAGCTGTGGATGAAGGG - Intergenic
937706990 2:124932434-124932456 TGTCACATGCTGAGAAACACTGG - Intergenic
940557844 2:155254971-155254993 CTCCACATGCCAAGGAAGACTGG - Intergenic
942780927 2:179641916-179641938 CCACACATGCTAAGGAATAATGG - Intronic
943802162 2:192074300-192074322 CCTCATATGTTGAGGAAAAGGGG + Intronic
945070441 2:205983628-205983650 CCTCATAGGCTGAGGACGATGGG + Intergenic
946940969 2:224769920-224769942 CATTAAATGCTGAGGAACACTGG - Intronic
946961978 2:224995062-224995084 ACCCACCTGCTGAGGAAGTCAGG - Intronic
947713390 2:232328365-232328387 CCTGAGATGCAGAGGAAGAAGGG - Intronic
1172530202 20:35625796-35625818 CCTCCCAAGCTGAGGACTACAGG + Intergenic
1172971029 20:38873108-38873130 CCTCACACGGTGGGGAAGCCTGG + Intronic
1174102134 20:48135844-48135866 GTTAACATGCTGAGGAAGGCAGG - Intergenic
1175114280 20:56671149-56671171 CCTGACAGGCTGAGAAAAACTGG + Intergenic
1177474937 21:21607766-21607788 CCTCAAGTGATTAGGAAGACTGG - Intergenic
1179107596 21:38417001-38417023 CCTCACATGCTCTGAAATACTGG + Intronic
1179942543 21:44649338-44649360 CCTCACATGCTCATCAATACAGG + Intronic
1181465730 22:23109672-23109694 TCTGAGATGCTGAGGGAGACAGG - Intronic
1181634444 22:24168069-24168091 CCTCACAAGCTGAGGCTGGCAGG - Intronic
1183065272 22:35358340-35358362 CCTCACTTGCAGAGGAGGAAGGG + Intergenic
950249775 3:11454601-11454623 CCTCATATGCCCAGAAAGACCGG - Intronic
951266596 3:20575126-20575148 CCTGACATGCTGAGGAGAACTGG + Intergenic
954299365 3:49691218-49691240 CCTCAGATGCTGAGAAATCCAGG + Exonic
956173260 3:66449798-66449820 CCTCACATAGTGAGGAAGCTAGG - Intronic
956470294 3:69559465-69559487 CCTCACATGGTGAGAAGGAGTGG - Intergenic
956952156 3:74295177-74295199 CCTCAATTTCTGAGGAAGATAGG + Exonic
958913734 3:100024690-100024712 CCACACATGCTGAATAAGAGAGG - Intronic
959895869 3:111605270-111605292 CTTCTCAAGCTGAGGAAGCCTGG - Intronic
960877323 3:122309932-122309954 CCCCAAATGCTCAGGGAGACTGG + Intergenic
962003774 3:131327675-131327697 ACTCAAATGCAGAGGAAGCCAGG - Intronic
965031339 3:163371785-163371807 TCTAACAAGCTGAGGAAGATGGG + Intergenic
965436141 3:168654153-168654175 TATCATATGCTGAGGATGACTGG - Intergenic
965832873 3:172814963-172814985 GCTGACATGCTGGGGAGGACAGG - Intronic
966170689 3:177076616-177076638 CCTTCCATGCTGTAGAAGACAGG + Intronic
969277736 4:6148374-6148396 CCTCATTTGCTTAGGAAGAAAGG - Intronic
970289123 4:14552539-14552561 CCACACAGGCTGGAGAAGACAGG + Intergenic
970765667 4:19545748-19545770 GCTCACATGATTATGAAGACTGG - Intergenic
970882531 4:20948558-20948580 CCTCACATTCTGTGGGAAACAGG + Intronic
974063405 4:57055404-57055426 ACTCAGATGATTAGGAAGACAGG + Intronic
974152983 4:58033758-58033780 GCTCACATGATTATGAAGACGGG + Intergenic
974384806 4:61190403-61190425 CCTCACATGTAGATGATGACTGG - Intergenic
977159883 4:93620606-93620628 CCTAACATGTTGAGGAACATAGG + Intronic
978699134 4:111621915-111621937 CCCCACATGTTGAGGGAGAAAGG - Intergenic
979425343 4:120557549-120557571 ATTCACATTCTGGGGAAGACAGG + Intergenic
980483888 4:133427186-133427208 CCCCAAATGCTGAAGAAGCCAGG - Intergenic
982557523 4:156886813-156886835 GTTCACAGGCTGAGGATGACAGG + Intronic
985729792 5:1540776-1540798 TCTCATGTGCTGAGAAAGACAGG - Intergenic
987089191 5:14496322-14496344 CCTCACATAGTTAGGGAGACTGG + Intronic
987557551 5:19473708-19473730 CCACAATTGCTGAGGAAGAATGG + Exonic
987834933 5:23147622-23147644 CTTTACATGGTGAGGAAAACAGG - Intergenic
994904375 5:105817879-105817901 CCTCATGTGCTGAGGAAGTCAGG - Intergenic
996508587 5:124294217-124294239 CCTCACATGTTGAGGGAGGGAGG + Intergenic
1001563678 5:172686265-172686287 ACTCAGATGCCGAGGAGGACTGG - Exonic
1009601367 6:65804707-65804729 CCTGCCATGCTCAGGAAGACAGG - Intergenic
1010290459 6:74130734-74130756 CCTCACATGGTGAGCCACACAGG + Intergenic
1011712612 6:90069977-90069999 CCTCTGGAGCTGAGGAAGACAGG - Intronic
1013091880 6:106907594-106907616 GGTCACATTCTGAGGAACACAGG - Intergenic
1013460755 6:110372831-110372853 GCTCAGATGCTGAGGGAAACAGG - Intergenic
1016067781 6:139701656-139701678 CTTCACATGCTGAGAAAAAGGGG + Intergenic
1016227563 6:141758627-141758649 CATCACATGGTGAGGAAGCATGG - Intergenic
1016378062 6:143444300-143444322 CCTGCCATGCTGAGGATGAGTGG + Intronic
1017142754 6:151206710-151206732 CCTCACGTGGAGAGGAAGAGAGG - Intergenic
1019601967 7:1889318-1889340 CCTCAGATGCTGAGGAGGCTGGG + Intronic
1021227971 7:18050893-18050915 CCACAAATTCTGAGGAAGAAAGG - Intergenic
1021470907 7:21001664-21001686 CCTCTCATCCTCAGGTAGACAGG + Intergenic
1021799959 7:24295380-24295402 TCTCCCATGCAGAGGGAGACAGG + Intergenic
1022397659 7:30004520-30004542 ACTCACTAGCTGAGGAAAACAGG + Intergenic
1023819987 7:43975262-43975284 CATCTCCTGCTGAGGAAGCCTGG + Intergenic
1024628035 7:51225161-51225183 ACTCACAGGCAGAGGAAGCCAGG - Intronic
1025052889 7:55743788-55743810 CCTCCCACGCTGAGGAAGGTCGG - Intergenic
1025078249 7:55962105-55962127 CCTCACAGGCTGAGTAATATGGG + Intronic
1026180294 7:68033608-68033630 CCTCCATTGCTGAGCAAGACAGG - Intergenic
1026387192 7:69861788-69861810 CCTCACATTCTGGGGAAGATAGG + Intronic
1027765626 7:82337707-82337729 CTTCACATGCTGTGCAAAACTGG + Intronic
1028308132 7:89291951-89291973 CCTTACATGACGAGAAAGACAGG + Intronic
1028417717 7:90596898-90596920 CCCCAGATCCTGAGGAAGAGGGG - Intronic
1028424275 7:90668972-90668994 CCTCCCATGCTTAGGATTACAGG + Intronic
1029748263 7:102528715-102528737 CATCTCCTGCTGAGGAAGCCTGG + Intergenic
1029766210 7:102627802-102627824 CATCTCCTGCTGAGGAAGCCTGG + Intronic
1032177998 7:129648690-129648712 CCTTACATGGTGAGGGAGTCAGG - Intronic
1034434864 7:151058611-151058633 TCTGACATGCTGAGGAAAACTGG + Exonic
1035174038 7:157037814-157037836 CCTCTCAAGCTGTGGAAGGCAGG + Intergenic
1036240159 8:7074448-7074470 CCTCACATCCAGAGGGAGAGAGG - Intergenic
1036820609 8:11936564-11936586 CCTCACATCCAGGGGAAGAGAGG + Intergenic
1038431481 8:27503742-27503764 GCTCTCATGCTCAGGAAGAAAGG + Exonic
1039662043 8:39478330-39478352 ACACACATACTGAGCAAGACTGG - Intergenic
1040681052 8:49809746-49809768 CCTCACATGTTGAGGGAGGGAGG + Intergenic
1040721334 8:50328645-50328667 CCCCACATGCTGAGGGAGGGAGG - Intronic
1041317547 8:56580043-56580065 CATCACATGCTGAGGAATTTGGG + Intergenic
1043354888 8:79400766-79400788 CCTCAGATGCAGTGGAAGCCTGG - Intergenic
1043644550 8:82500312-82500334 CCCCACATGTTGAGGGAGAGAGG - Intergenic
1047307409 8:123663846-123663868 CCCCACATGCTGAGGCAGCCAGG + Intergenic
1047920098 8:129626559-129626581 CCTCACATGCTCATCAATACTGG - Intergenic
1048544117 8:135370173-135370195 CTTCACATTCTGAAGAAGAATGG + Intergenic
1049252690 8:141597608-141597630 GCCCCCATGCTGATGAAGACAGG - Intergenic
1049741952 8:144245142-144245164 GCTCAGGTGCTGAGGAAGAGGGG - Exonic
1049800499 8:144515449-144515471 CCTCACTTGCTGGGGCAGGCAGG + Exonic
1050704970 9:8386546-8386568 CCTCCCTTTATGAGGAAGACTGG + Intronic
1051540009 9:18205016-18205038 TCTCACAATCTGAGGAAGAGTGG + Intergenic
1052542282 9:29826672-29826694 CCCCACACTCTGAGGTAGACCGG + Intergenic
1052696754 9:31888429-31888451 CCTCCGCTGCTGAGGCAGACAGG - Intergenic
1052745272 9:32434245-32434267 CCTCAGATGCTAAGGACAACTGG - Intronic
1052855525 9:33404055-33404077 CCTCCCTTCCTGAGGAAGAAAGG - Intergenic
1057014729 9:91641943-91641965 CCTCCCTTGCTGAGGTAGAGGGG - Intronic
1060778467 9:126393828-126393850 CCTCAGAAGCCGAGGAGGACAGG - Intronic
1062034548 9:134377102-134377124 CCCCAAAGGCTGAGCAAGACTGG - Intronic
1062070230 9:134551433-134551455 CCTCACCTGCGGAGGATGCCAGG - Intergenic
1062338715 9:136084039-136084061 CCCCACAGCCTGAGGAAGAGCGG + Intronic
1062430903 9:136526494-136526516 GCTCACCTGCTGGGCAAGACGGG + Intronic
1062488443 9:136792474-136792496 AGTCACATGCTGAGGAGGCCGGG - Intronic
1189943964 X:46157859-46157881 CCTCAGATCATGAGGAAGAATGG - Intergenic
1190577658 X:51857137-51857159 CCTCAGATGGTAAGTAAGACTGG - Intronic
1192357879 X:70420874-70420896 CCTCAGGGGCTGAGGAACACAGG - Intergenic
1193211591 X:78812132-78812154 CCTCACAGGCTAAGAAAGAAAGG + Intergenic
1195208337 X:102625930-102625952 CCTCACAGGCTGAGACACACTGG - Intergenic
1196778121 X:119359705-119359727 CCTCCCATCCTGGGGAGGACTGG + Intergenic
1198053848 X:132974874-132974896 TGTCACATGCAGAGGAAGACAGG - Intergenic
1198363173 X:135915660-135915682 CCTCACATGTTGAAGAAGCATGG - Intergenic
1199389575 X:147263467-147263489 CATTACTTGCTGAGGAAGAAAGG - Intergenic
1199735976 X:150687060-150687082 CCTCATATGGTGAGGAAGCTAGG + Intergenic