ID: 1158015685

View in Genome Browser
Species Human (GRCh38)
Location 18:52780752-52780774
Sequence GTGAAGGTCTTCAGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 2, 2: 17, 3: 66, 4: 378}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158015677_1158015685 7 Left 1158015677 18:52780722-52780744 CCTCCAAGTGTGAGGCAGACCAC 0: 1
1: 0
2: 2
3: 8
4: 107
Right 1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG 0: 1
1: 2
2: 17
3: 66
4: 378
1158015674_1158015685 26 Left 1158015674 18:52780703-52780725 CCTTGTGTGATATTACTTCCCTC 0: 1
1: 2
2: 6
3: 22
4: 179
Right 1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG 0: 1
1: 2
2: 17
3: 66
4: 378
1158015678_1158015685 4 Left 1158015678 18:52780725-52780747 CCAAGTGTGAGGCAGACCACCTG 0: 1
1: 0
2: 4
3: 13
4: 182
Right 1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG 0: 1
1: 2
2: 17
3: 66
4: 378
1158015676_1158015685 8 Left 1158015676 18:52780721-52780743 CCCTCCAAGTGTGAGGCAGACCA 0: 1
1: 0
2: 2
3: 10
4: 128
Right 1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG 0: 1
1: 2
2: 17
3: 66
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158015685 Original CRISPR GTGAAGGTCTTCAGGGGAGA AGG Intronic
900463398 1:2811928-2811950 GGGAAGTTCTTCATGGTAGAAGG + Intergenic
901318547 1:8324794-8324816 CTGAGGGTCCTGAGGGGAGAAGG + Intronic
901326790 1:8371484-8371506 GTGAAGGGCCTTAGGAGAGAAGG + Intronic
902469871 1:16641647-16641669 GTGTAGGGCTTGTGGGGAGATGG + Intergenic
902502952 1:16922627-16922649 GAGAGGGTCTTCAGGGGACATGG - Intronic
902596524 1:17513426-17513448 TTGAATGTATTCAGTGGAGAGGG + Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
906121293 1:43393201-43393223 GTGAAGATCTTCAGGTGAGAAGG + Intronic
906250272 1:44305735-44305757 GTGAAGCTGCTGAGGGGAGAAGG + Intronic
906754185 1:48293017-48293039 TGGGAGGTCTTCAGTGGAGAAGG + Intergenic
907809267 1:57852170-57852192 ATGAGGATCTTCAGGGGAAAAGG - Intronic
908057446 1:60304868-60304890 GTGAAGCTCCTCAGGAGACAAGG + Intergenic
908513744 1:64871570-64871592 GGGAAGGTCTTGGGGGAAGAGGG - Intronic
910689949 1:89955455-89955477 ATGAAGGTCTTCAGGGAAGAGGG - Intergenic
912654395 1:111472584-111472606 GAGAATGTCTTCAGAGAAGATGG - Intergenic
912814134 1:112815451-112815473 GTGAAGGTGAGGAGGGGAGAAGG - Intergenic
912861347 1:113216583-113216605 GTGAGGATGTTCAGAGGAGAGGG + Intergenic
913116206 1:115699653-115699675 GAGAAGATGTTTAGGGGAGAAGG + Intergenic
913184698 1:116359552-116359574 GTGATGGTCTTCAGGGTGGTGGG - Intergenic
914446012 1:147751302-147751324 CTGAAGGTCTTCAGAGGAACGGG - Intergenic
915621746 1:157090446-157090468 GTAAATGTCTCCTGGGGAGAGGG - Intergenic
916282247 1:163064577-163064599 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
917213180 1:172651059-172651081 GAGAAACTCTTGAGGGGAGAAGG + Intergenic
917478494 1:175389387-175389409 ATGAGGGTCCTCAAGGGAGAAGG - Intronic
918733176 1:188023424-188023446 GTGAAGGTATTCCAGGCAGAAGG - Intergenic
919906347 1:202081117-202081139 ATGAGGGTCTTTAAGGGAGAAGG - Intergenic
920031220 1:203038549-203038571 GAGAAGGGCATCAGGGGAGGGGG - Intronic
920773765 1:208915307-208915329 ATGAAGGTCTGCAGGGAAGAAGG + Intergenic
920911926 1:210226792-210226814 GTGAAGGTCTGCATGAGATAGGG - Intergenic
921345262 1:214177075-214177097 GTGAAGGTCATGATGGGTGAGGG + Intergenic
921950878 1:220928533-220928555 GTCATGGTCTTTAGGGGAAAAGG + Intergenic
1063046601 10:2398705-2398727 ATGAAGGTCTTCAAAGGAGAGGG + Intergenic
1063937420 10:11092732-11092754 GTGAATTGCTTCAGGGAAGAAGG + Intronic
1064354723 10:14606239-14606261 GTGAAGGTCTGCTAGGCAGAGGG - Intronic
1064971392 10:21070747-21070769 TTGAATTTCTTCAGGGGATAAGG + Intronic
1064973394 10:21088974-21088996 GTGAAGCTCTAGAGGGGAGATGG + Intronic
1065225450 10:23538920-23538942 GAGAAGGTCTGCAGAGGAGATGG - Intergenic
1066654208 10:37683742-37683764 CTGAATGTTTTCCGGGGAGATGG - Intergenic
1068572736 10:58649034-58649056 GAGAAGGTGTTCAGGGTAGTAGG - Intronic
1068803059 10:61163320-61163342 TTGGAGGTCTGCAGGGCAGAAGG + Intergenic
1070331180 10:75418372-75418394 TGGAAGGTGTTCTGGGGAGAGGG + Intergenic
1070766762 10:79061333-79061355 GTGAAGGTCTTGTGGGGGAAAGG - Intergenic
1071033693 10:81216379-81216401 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1072044726 10:91643519-91643541 GTGAAGGACTTCCAGGGAGATGG - Intergenic
1073294875 10:102432770-102432792 GTGAAGGTCTTGAGAGGGGGTGG + Intergenic
1075180931 10:120210211-120210233 GTGAAGGTTTTCAGGTGATGAGG - Intergenic
1075514572 10:123098888-123098910 GTGAAGGACTCCAAGGTAGAGGG - Intergenic
1075829773 10:125398381-125398403 GTGAAAGTCTTCTTTGGAGAAGG - Intergenic
1076252138 10:128993494-128993516 GTGACCGTCTGCAGGGCAGAGGG + Intergenic
1077020229 11:414017-414039 GGGAAGGTGTGCAGGGGAGAGGG - Intronic
1077020277 11:414170-414192 GGGAAGGTGTGCAGGGGAGAGGG - Intronic
1077020333 11:414338-414360 GGAAAGGTGTGCAGGGGAGAGGG - Intronic
1077040785 11:521161-521183 GTGAAGGTCTGGAGCGGGGAGGG - Intergenic
1077156220 11:1092951-1092973 GTGAAGGTGGTCAGGGTGGACGG - Intergenic
1077303176 11:1856422-1856444 TTGAAGGTCTGCAGAGGAGCAGG - Intronic
1079183088 11:18210927-18210949 GAGAAGGTCCTCAGGGGCCAGGG + Intronic
1080708248 11:34719952-34719974 GTGAAGTTCTTGAGTGGTGAGGG + Intergenic
1083285116 11:61653680-61653702 ATAGGGGTCTTCAGGGGAGAAGG - Intergenic
1083929464 11:65832932-65832954 GTTGAGGTCTGCTGGGGAGAAGG - Intronic
1084144257 11:67255758-67255780 TTGAAGCTCTTCAGAGGAGCTGG + Exonic
1084889080 11:72227956-72227978 GTGTAGGTCTGGTGGGGAGACGG + Intronic
1086429511 11:86721648-86721670 TTGATGGTCTTTAAGGGAGAAGG + Intergenic
1086641989 11:89170053-89170075 ATGAAGGTCCTCTGGGGAAAAGG + Intergenic
1087623038 11:100564334-100564356 ATGGAGGTCTTCGGGGGAGGAGG + Intergenic
1087779325 11:102286414-102286436 ATGAGGGTGTTCAAGGGAGAAGG - Intergenic
1087903011 11:103663830-103663852 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1088746136 11:112806528-112806550 GTGAAGGTCTTAGGGGGCCAAGG - Intergenic
1089165474 11:116472799-116472821 GTGAGGGTTTTCAGGGGAGGAGG - Intergenic
1089194053 11:116681572-116681594 ATGGAGGTCTTCAGGAGGGATGG + Intergenic
1089895530 11:121926867-121926889 ATGAGGGTCTTCAAAGGAGAAGG + Intergenic
1091298296 11:134488782-134488804 GGGAGGGTCTTCAGTGCAGAGGG - Intergenic
1091597940 12:1891241-1891263 GTGAAGTTTTTCTGGGGACAAGG - Intronic
1091963355 12:4718127-4718149 GTGAAGGTCTCTTGGGGAGCTGG - Intronic
1096826630 12:54283542-54283564 GTGAAGGCCTTCAAGGCTGAAGG + Intronic
1096881837 12:54679496-54679518 GGCAAGGTCTGCATGGGAGAAGG - Intergenic
1097323049 12:58246647-58246669 ATGAAGGTCTTCCAGGGAGAAGG - Intergenic
1097689934 12:62725352-62725374 GTGACCTGCTTCAGGGGAGAGGG - Intronic
1098618401 12:72558792-72558814 GAGAAGGTCTTCACTGGAGAAGG + Intronic
1099612265 12:84889000-84889022 ATGAGGATCTTCAAGGGAGAAGG - Intronic
1101673006 12:106894238-106894260 TGGAAGGTCTTCAGGGGCAATGG - Intergenic
1104076106 12:125391553-125391575 CTGCAGGTCTGCAGGGGAGTAGG - Intronic
1104435059 12:128749041-128749063 GCGGAGGGGTTCAGGGGAGAGGG - Intergenic
1105412319 13:20180917-20180939 GTCAAGTTATTTAGGGGAGAAGG - Intergenic
1105847313 13:24304556-24304578 GTGGGGGGCTGCAGGGGAGAAGG - Exonic
1106846721 13:33744847-33744869 ATGAAAATCTTCAGGGGAGGAGG + Intergenic
1107173127 13:37367170-37367192 GTGATGGACTCCAGTGGAGAAGG + Intergenic
1107386405 13:39914469-39914491 GAGAAGGCCTACAGAGGAGAAGG + Intergenic
1109344444 13:61098476-61098498 ATGAGGGTCTTCAAGTGAGAAGG - Intergenic
1111079587 13:83285701-83285723 GTGATGGTCTGCAGGGGGAAAGG + Intergenic
1112131661 13:96531559-96531581 GTGCAGGTCAGCAGGGCAGAGGG + Intronic
1112471789 13:99695860-99695882 ATGAGGGTCTTCAGGGGAGGAGG + Intronic
1112730491 13:102355045-102355067 GTGACAGTCTTCAGGGAAAAAGG + Intronic
1113460106 13:110476291-110476313 GTGAAGAGCTCCAGGGGAAATGG - Intronic
1114002798 14:18278545-18278567 TTTAAGGTCTACAGTGGAGAAGG - Intergenic
1114774581 14:25466672-25466694 GTAAAGGTCCTAAGGAGAGAAGG + Intergenic
1115172232 14:30522537-30522559 ATGAAGGCCTTCAAGAGAGAAGG - Intergenic
1115523614 14:34257611-34257633 ATGAGAGTCTTCAGGGGAGAAGG - Intronic
1116478320 14:45367037-45367059 ATGAAGGTCTTCAAGGGAGAAGG - Intergenic
1117049118 14:51843156-51843178 GGAAAGGTCTTCAGGGGAGAGGG + Intronic
1117210926 14:53498873-53498895 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1118591199 14:67402560-67402582 GTGAGGGGCTGCCGGGGAGATGG - Intronic
1118682803 14:68260680-68260702 ATGAGGGTCTTCAAGAGAGAAGG + Intronic
1118861754 14:69669618-69669640 TTGAAGATGTTTAGGGGAGAAGG - Intronic
1119165884 14:72492426-72492448 ATGAGGGTTTTCAAGGGAGAAGG + Intronic
1120242603 14:81966647-81966669 GTGAAGATTTTGAGGGTAGAGGG + Intergenic
1120242665 14:81967215-81967237 ATGAGGATCTTCAAGGGAGAAGG - Intergenic
1121005206 14:90486121-90486143 GTGAAGAACTAGAGGGGAGAGGG + Intergenic
1121756222 14:96404758-96404780 GAGAAGGTCTTCTCGAGAGATGG - Exonic
1121774833 14:96583844-96583866 GTCAAGGTCATCTAGGGAGATGG - Intergenic
1122225933 14:100279601-100279623 GTGGAGGTCTTCAGTGCCGAGGG + Exonic
1122494546 14:102143507-102143529 TTGAAAGTCTTTTGGGGAGAGGG - Intronic
1122601199 14:102922814-102922836 GTGAAGATCTTCCGAGGAGTGGG + Intronic
1124992719 15:34691892-34691914 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1126049505 15:44673464-44673486 GTGAAGTTCTTGAGGGGAAAAGG - Intronic
1126807595 15:52367554-52367576 GTGAAAGCATTCAGAGGAGAAGG - Intronic
1127211257 15:56777133-56777155 ATGAGGGTTTTCAAGGGAGAGGG - Intronic
1127575990 15:60292869-60292891 GTGATGGTTTGCAGGGGAGTGGG + Intergenic
1127625513 15:60776348-60776370 GGCAAGGTCTTCAGGAGAGGAGG + Intronic
1127775766 15:62263361-62263383 GTGAACAGCTTCAAGGGAGAAGG + Intergenic
1127959777 15:63882205-63882227 ATGAGGGTCTTCCAGGGAGATGG + Intergenic
1128186546 15:65647639-65647661 GTGACAGTCTTCAGAGTAGAGGG + Intronic
1128276299 15:66356594-66356616 ATGAAGTTCTTGCGGGGAGAGGG - Intronic
1128468600 15:67933268-67933290 CTGAGGGTTTTCAGGAGAGAAGG - Intergenic
1128578299 15:68791067-68791089 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1128694956 15:69754654-69754676 GTGAAGGTCTTGAAGCAAGAGGG - Intergenic
1128797046 15:70473651-70473673 GTGATGGTGTACAGGGGAGATGG - Intergenic
1128895952 15:71374159-71374181 GTCAAGGACATCAGGGCAGAAGG - Intronic
1129599881 15:76992492-76992514 GGGAAGGTCTCCTGGGGAGCTGG + Intergenic
1130688503 15:86059927-86059949 GAGAAGGTCTTCTGGTTAGAAGG + Intergenic
1131551017 15:93357148-93357170 GTGAAGGAGTTCAGTAGAGACGG + Intergenic
1131901028 15:97088014-97088036 TTGACTGTCTTCAGGGGAGAGGG + Intergenic
1132060279 15:98687006-98687028 CTGAAGGTTTTGAGAGGAGAGGG + Intronic
1132180615 15:99750140-99750162 ATGAGGGTCTTCACGGGAGAAGG - Intergenic
1133450095 16:5896717-5896739 GCATAGCTCTTCAGGGGAGAGGG + Intergenic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135063897 16:19293003-19293025 GAGAAGGTCTTCATGGGAGAAGG + Intronic
1135705509 16:24671305-24671327 CTTAAGGTCTCCAGGAGAGAGGG + Intergenic
1136103125 16:28010048-28010070 AGGAAAGGCTTCAGGGGAGAGGG + Intronic
1136228191 16:28872713-28872735 GAGCAGGTCTGCAGGGGAGGAGG + Intronic
1136703560 16:32165802-32165824 GTGATGGTCTGCAGGGGAACCGG + Intergenic
1136764142 16:32761800-32761822 GTGATGGTCTGCAGGGGAACCGG - Intergenic
1136803956 16:33108586-33108608 GTGATGGTCTGCAGGGGAACCGG + Intergenic
1137808258 16:51328494-51328516 GTGGGGGTAGTCAGGGGAGATGG - Intergenic
1138633835 16:58320638-58320660 GAGAGGGTGTTCAGGGGAGGAGG + Intronic
1139657754 16:68399308-68399330 GTGAAGGTCAGGAGGTGAGAAGG + Intronic
1140122521 16:72096018-72096040 GTCCTGGTCTTAAGGGGAGATGG + Intronic
1140335133 16:74097942-74097964 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1140964084 16:79947278-79947300 TTGAAGGCCTTCTGGGAAGATGG + Intergenic
1141611339 16:85182707-85182729 GTGCAGGTCTTCAGGGAGGCAGG + Intronic
1142020779 16:87780883-87780905 GTGAAGGACTTGTGGGCAGAGGG - Intergenic
1142311858 16:89318778-89318800 GTGAAGTTATTCTGGAGAGAGGG + Intronic
1203066496 16_KI270728v1_random:1023922-1023944 GTGATGGTCTGCAGGGGAACCGG - Intergenic
1143792385 17:9307912-9307934 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1144410060 17:14992118-14992140 ATGAACTGCTTCAGGGGAGAAGG + Intergenic
1144429719 17:15180329-15180351 GTCGAGGTCTTCAGGGCAGTGGG + Intergenic
1144433384 17:15216910-15216932 TTAAGGGTCTTCAGGAGAGAAGG - Intergenic
1146279477 17:31536017-31536039 GTGCTGGTGTTCAGGGGAGTTGG + Exonic
1147693569 17:42334085-42334107 GTGAATGTATACAGGTGAGATGG + Intronic
1148162040 17:45455781-45455803 CTGAGGGACTACAGGGGAGAAGG - Intronic
1149359958 17:55884784-55884806 GTGATGGTATTCAGAGGTGAGGG + Intergenic
1149436231 17:56635731-56635753 GTGCAGGTCTCTAGTGGAGACGG + Intergenic
1150100076 17:62415581-62415603 GGGAAGGTGTTCCAGGGAGAGGG - Intronic
1150719499 17:67602445-67602467 GTGAAGGTCGTTGGAGGAGAAGG + Intronic
1153250716 18:3118929-3118951 GTGATGGTCTTCAAGGGCAAAGG + Intronic
1153333319 18:3896860-3896882 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1153694415 18:7626103-7626125 GTGAATGTCATCAGAGGAAAAGG - Intronic
1154534330 18:15383320-15383342 TTTAAGGTCTACAGTGGAGAAGG + Intergenic
1155538474 18:26842276-26842298 GTGATTGCCTTTAGGGGAGAGGG + Intergenic
1155936399 18:31759349-31759371 GAGAAGGTCCTCAGGGGCCAGGG - Intergenic
1156580696 18:38371342-38371364 TTGAAGGTCTTCAGGGAAGCTGG + Intergenic
1157015203 18:43703891-43703913 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1157015954 18:43713045-43713067 AAGAAGGTCTTCAAGGAAGAAGG + Intergenic
1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG + Intronic
1160705305 19:526865-526887 GATATGGTCCTCAGGGGAGAGGG - Intergenic
1161290622 19:3491804-3491826 GTGCAGACCTGCAGGGGAGAGGG + Exonic
1162625612 19:11882199-11882221 TTGGAGTTCTTTAGGGGAGAGGG - Intronic
1162823185 19:13235720-13235742 ATGAAGTTATTCTGGGGAGATGG + Exonic
1163379014 19:16952069-16952091 TTGAAGGTCTTCAGCAGGGAGGG + Exonic
1163581786 19:18143833-18143855 CTGATGGTATTCAGGAGAGATGG - Exonic
1163636568 19:18439663-18439685 ATGAGGGTCTTCAAGGGAGCAGG - Intergenic
1164717242 19:30401802-30401824 GTAAAGGACTTCAAGGGAAAAGG + Intronic
1164742417 19:30585732-30585754 GGGAAGGTCATCAGGGGAGATGG - Intronic
1164825533 19:31282463-31282485 GTGAAGGCCACCAGGTGAGAGGG + Intronic
1166287060 19:41837717-41837739 GTGAGGGGCCTCTGGGGAGAAGG - Intronic
1167293884 19:48638361-48638383 TTGAAGGTCTTCATGGGGGGGGG + Intronic
1167700134 19:51038522-51038544 ATGAGGGTCTTCAGGGGAAAAGG - Intergenic
1168628991 19:57942536-57942558 GGGTTGGTCTTCTGGGGAGAAGG + Exonic
925052871 2:830951-830973 GTGAGTGCCTTCAGGGGACAGGG - Intergenic
925590404 2:5503482-5503504 ATGAAGTTCTTCAAGGAAGAAGG - Intergenic
925876687 2:8317319-8317341 GTCAAGGTTTTCAGGAGAGAGGG + Intergenic
925978860 2:9160990-9161012 GTGAAAGTCAGCAGGGGAGTAGG - Intergenic
926552422 2:14316375-14316397 CTGACGTTCTTCAGAGGAGATGG - Intergenic
926662390 2:15481913-15481935 ATAAGGGTCTTCAAGGGAGAAGG - Intronic
926987712 2:18641642-18641664 GGGAAGGGAATCAGGGGAGAAGG + Intergenic
927617876 2:24618460-24618482 CTGAAGGTCTTCAGACCAGATGG - Intronic
928219692 2:29393415-29393437 ATGAAGGTCTTCAAGGCAGCAGG - Intronic
928394948 2:30936293-30936315 GGGCAGGAATTCAGGGGAGAAGG + Intronic
929261022 2:39866608-39866630 GAGAAGGTGTCCAGGGCAGATGG - Intergenic
929789694 2:45013764-45013786 GTGAAGGCCTGGAGGGCAGAGGG - Intergenic
930109494 2:47666468-47666490 ATGAAAGTCTTCAGGCAAGAAGG - Intergenic
930466181 2:51752821-51752843 GAGAAGGTATTCTGGGGACATGG - Intergenic
931027864 2:58134247-58134269 ATGAGGGTCTTAAAGGGAGAAGG - Intronic
931374553 2:61695517-61695539 GTGAAGGAATTCAGTGAAGAGGG - Intergenic
932126756 2:69151735-69151757 GTGAATGGGTTCAGGGGAGCAGG + Intronic
932184192 2:69677879-69677901 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
932827653 2:74956609-74956631 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
933750502 2:85599860-85599882 TTTAAGGTTTGCAGGGGAGAAGG + Intronic
934054639 2:88241379-88241401 GTGTAAGTCAGCAGGGGAGAGGG + Intergenic
935685403 2:105678525-105678547 GGGAAGGGCCTCCGGGGAGAAGG - Intergenic
936585691 2:113756234-113756256 GTGAAGGTCTCTAGGGGCGGAGG - Intronic
936611804 2:114008970-114008992 GTGAAGGGGTTCAGGAGAGCGGG - Intergenic
936634578 2:114241012-114241034 GGGAAGGCCTCCAGAGGAGATGG - Intergenic
937353342 2:121182680-121182702 CTGAAGGACTTCATGGGAGCTGG - Intergenic
937891819 2:126944940-126944962 TTGAGGGTCTTCAGGGCAGAAGG + Intergenic
937914768 2:127093435-127093457 ATGAGGGTCTTCAGGGGTGAAGG - Intronic
938768797 2:134482383-134482405 GTGTTGGTCTTTAGGGGAAAGGG - Intronic
938904524 2:135825750-135825772 GTGCAGGTGCTCCGGGGAGAGGG + Intronic
938937233 2:136137772-136137794 ATGAAGGTCTTCAAAGGAGAAGG + Intergenic
938942132 2:136178623-136178645 ATTAAGGTCTTCAAGGGAGAAGG + Intergenic
939232907 2:139454176-139454198 GTGAAGTTTTTCTGGGGACAGGG + Intergenic
939865903 2:147472048-147472070 GAGAAGGTCCTGAGAGGAGAAGG - Intergenic
940117990 2:150231130-150231152 GTGAATGTAGTCAGAGGAGATGG + Intergenic
940223813 2:151381596-151381618 ATGAGGGTCTGCAAGGGAGAAGG - Intergenic
941877292 2:170447053-170447075 ATGAGGGTCTTCAGGGGAGAAGG + Intronic
942649197 2:178149284-178149306 GGGCAGGTGTTCAAGGGAGAGGG + Intergenic
943082007 2:183267052-183267074 ATGAGGGTCTTCCAGGGAGAAGG + Intergenic
943491158 2:188557930-188557952 GTGAAGCTGTTCAGGGCAGTGGG + Intronic
945189506 2:207172214-207172236 ACGAAGGTCTTCAGGGCAAAAGG - Intergenic
945218473 2:207460457-207460479 ATGAGGGTCTTCAAGGAAGAAGG - Intergenic
945754799 2:213832563-213832585 ATAAAGGTCTTCAAGGAAGAAGG - Intronic
945966158 2:216189310-216189332 GTGAATGGTTTCAGGGGACAAGG + Intronic
947367099 2:229407779-229407801 TTGAAGAACTGCAGGGGAGAGGG + Intronic
947614738 2:231548549-231548571 GTGGGTGTCTCCAGGGGAGACGG + Intergenic
947797501 2:232904224-232904246 GTGAGGCTCTCCAGGGGAGCAGG - Intronic
948648533 2:239424525-239424547 GGGAGGGTCTCCAGGGGAGCTGG - Intergenic
948880748 2:240856051-240856073 GGGAAGGTCTTCAGGGGCCAAGG + Intergenic
1168833034 20:857758-857780 GTGAAGGACGTGAGGGGAGAGGG + Intergenic
1168954030 20:1821661-1821683 GTGAATGTCTGCAGGGAGGAAGG - Intergenic
1169048596 20:2558203-2558225 CAGGAGGTCTTCAAGGGAGACGG + Intronic
1170468284 20:16643028-16643050 CTGAAGGACTACAGGGGAGCTGG - Intergenic
1170795054 20:19539954-19539976 ATGAGAGTCTTCAAGGGAGATGG + Intronic
1170985823 20:21257306-21257328 GGGAAGGACTTCAGGGAAGAGGG + Intergenic
1171092208 20:22296005-22296027 CTGAATGTCTTTAGGGGAGATGG + Intergenic
1175039623 20:56035905-56035927 GTGAACATCTTTAGGGGTGAGGG + Intergenic
1175302144 20:57950553-57950575 GTGAATGTTTACAGGGGACAGGG + Intergenic
1175590785 20:60190274-60190296 ATGAGGAACTTCAGGGGAGAAGG - Intergenic
1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG + Intronic
1176889192 21:14293835-14293857 ATGATGGTCTTCAAGAGAGACGG + Intergenic
1178195198 21:30337026-30337048 GTGAAGATCTGTAGGGGAGATGG - Exonic
1178350570 21:31870570-31870592 GGGGAGGTCTTCATGGGAAAGGG + Intergenic
1179468506 21:41594776-41594798 ATGAGAGTCTTCAGGAGAGAAGG + Intergenic
1180427312 22:15209340-15209362 TTTAAGGTCTACAGTGGAGAAGG - Intergenic
1180510562 22:16083727-16083749 TTTAAGGTCTGCAGTGGAGAAGG - Intergenic
1181930063 22:26393945-26393967 GAGAAAGTTTTCAGGGCAGATGG + Intergenic
1182440545 22:30361398-30361420 ATGAGGGTCTTCAGGGGAGGAGG + Intronic
1182510399 22:30815614-30815636 GTGTATGTCCTGAGGGGAGATGG - Intronic
1183027877 22:35079750-35079772 GTGAAGGTGATCTGGGGAGAGGG + Intronic
1183441764 22:37827025-37827047 CTGAAGGTTTTCAGGAGAGGAGG + Intergenic
1183730320 22:39614825-39614847 GTGGCTGTCTTCTGGGGAGAGGG - Intronic
1183890119 22:40920396-40920418 GAGGAGGCTTTCAGGGGAGATGG + Intronic
1184305986 22:43602195-43602217 GAAAAGGTCTGCAGGGGATAAGG - Intronic
1184921762 22:47610205-47610227 GGAAAGGTCTTCAGGGAAGTGGG + Intergenic
1184925718 22:47635673-47635695 GTGAAGGGCATCAGAGCAGAGGG - Intergenic
949152073 3:781373-781395 GTGACCTACTTCAGGGGAGAAGG - Intergenic
950858112 3:16124316-16124338 GTGATGGTCTGCAACGGAGAGGG - Intergenic
951311877 3:21136784-21136806 GTGAAAGTCTTCAGCACAGAAGG - Intergenic
951755363 3:26085490-26085512 ATGAGGATCTTCATGGGAGAAGG - Intergenic
952233692 3:31456996-31457018 GTGCTTGTCTTCAGGGGAGGTGG + Intergenic
952406345 3:33008513-33008535 GATGAGGTCTTCAGTGGAGAGGG + Intronic
953403184 3:42644784-42644806 GTGGAGATCTGCAGGGTAGATGG - Intronic
954706391 3:52482996-52483018 GAGAAGGTCTGCAGTGGAGGTGG + Intronic
955060780 3:55489757-55489779 GTCAAGGTTTACAGAGGAGAAGG - Intronic
955229362 3:57085304-57085326 GGAATGGTCTTCAAGGGAGATGG - Intergenic
955715825 3:61828727-61828749 GTGAAGACCTCCAGGGGACAGGG + Intronic
957219494 3:77363738-77363760 ATGAGGGTCTTCAAGGAAGAAGG + Intronic
957654343 3:83054060-83054082 ATGAAGGTATTCAGCGTAGATGG + Intergenic
957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG + Intronic
958192942 3:90206081-90206103 TTGAAGGTCTTCATGGGAGATGG + Intergenic
958416242 3:93877033-93877055 TTGAAGGTCTTCATGGGAGATGG + Exonic
958437203 3:94111710-94111732 TGGAAGGTCTTCAGGGGAAGTGG + Intronic
958521594 3:95196237-95196259 ATGAAAGTATTCATGGGAGATGG - Intergenic
959822607 3:110754460-110754482 GTGGAGGTCTGAAGGAGAGAGGG + Intergenic
960425496 3:117502059-117502081 ATGAGGGTCTTCAAGGGAAAAGG - Intergenic
960507671 3:118513165-118513187 AAGAGGGTCTTCAGGGGAGAAGG - Intergenic
960953356 3:123013809-123013831 GGGAAAGGCTTCAGGGAAGAGGG + Intronic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
961053591 3:123767800-123767822 GTGGGTGTCTTCAGGGGAGTGGG + Intronic
961125001 3:124409459-124409481 GTGAAGCTCTTCATGCCAGAGGG + Intronic
962686892 3:137856604-137856626 CTTAAGATCTTCAGGGGTGATGG - Intergenic
962878237 3:139552415-139552437 CTCAAGATGTTCAGGGGAGAGGG + Intergenic
963637016 3:147810895-147810917 ATAAGGGTCTTCAGGGGAAAGGG + Intergenic
963783371 3:149509347-149509369 GGGAAGGTGGGCAGGGGAGAAGG - Intergenic
964760117 3:160127472-160127494 ATGAAGGTCCTCAAGAGAGAAGG + Intergenic
964764905 3:160170266-160170288 ATGAAGGTCTTCAAGGGAGAAGG + Intergenic
965125682 3:164626585-164626607 ATGAAGGTTTTCAGGGAAGAAGG - Intergenic
965183896 3:165438345-165438367 TTTATGATCTTCAGGGGAGAAGG + Intergenic
965457688 3:168924344-168924366 ATTAGGGTCTTCAGGGGAGAAGG - Intergenic
967474604 3:189902124-189902146 GTGAATGTCTTCAGCAGAAAGGG - Intergenic
967544620 3:190710202-190710224 GTGAAGGTCTAGAGGGGAGTTGG + Intergenic
968062924 3:195739749-195739771 GTGAAGGTGGACAGGGGAGGAGG + Intronic
968609293 4:1549801-1549823 GTGGAGCTTGTCAGGGGAGATGG + Intergenic
968922596 4:3530432-3530454 GTGAAGTTCTTCGGGGGTGAGGG - Intronic
969202363 4:5616199-5616221 GGGAAAGTTCTCAGGGGAGAGGG - Intronic
970526967 4:16942472-16942494 GGGAAGGTGTTCTGAGGAGAGGG + Intergenic
971628784 4:28961480-28961502 GTGACCTGCTTCAGGGGAGAAGG - Intergenic
971628798 4:28961595-28961617 ATGAGGGTCTTCAAGGGTGAAGG - Intergenic
972180570 4:36459691-36459713 GTGAAGGATTTAAGGAGAGAAGG + Intergenic
973533987 4:51862275-51862297 GAGTAGGTCTGCAGGGCAGAGGG - Intronic
974958662 4:68673547-68673569 GTGCTGGTCTTCTGGGGTGAGGG - Intergenic
975555055 4:75654432-75654454 GTGATGGTGTTAACGGGAGAGGG + Intronic
975630969 4:76401887-76401909 GTGGAGGTGGGCAGGGGAGATGG + Intronic
978227342 4:106353061-106353083 ATGAGGGTCATCAAGGGAGAAGG + Intergenic
979770894 4:124524088-124524110 GTCAAGGTCTTCAGAGGAAGAGG + Intergenic
980515159 4:133847676-133847698 ATGAAGGTCTTCAGGGGAGAAGG + Intergenic
980876050 4:138663368-138663390 GAGAAGGTCTTTAGGCAAGAGGG - Intergenic
981601706 4:146496505-146496527 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
982678204 4:158400140-158400162 ATGAGGGTCTTCAAGGTAGAAGG - Intronic
983640820 4:169942575-169942597 GTGAGGATTTTCAGGGGAGGAGG - Intergenic
984519392 4:180784148-180784170 ATGAAGGTCTTCATGGGAGAAGG + Intergenic
984606935 4:181796498-181796520 CTGAAGATCTTCAAGGCAGAGGG + Intergenic
985052860 4:186010207-186010229 ATGAAGATCATCAAGGGAGAAGG + Intergenic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
986131408 5:4935480-4935502 GTGAAGGTCCTCTGGGGATGGGG - Intergenic
986212871 5:5690592-5690614 ATGAGGGTCTTCGAGGGAGAAGG + Intergenic
989941253 5:50152999-50153021 TTGGAGGTCTTCAGTGGAAAAGG - Intergenic
990003581 5:50922029-50922051 GTGGAGCTTGTCAGGGGAGATGG - Intergenic
990052752 5:51528246-51528268 GTGAAGTTGTTGCGGGGAGAAGG + Intergenic
990184923 5:53202135-53202157 GTCCAGGTCTTCTGGGGTGAGGG - Intergenic
992752027 5:79870637-79870659 GTCTAGGTCTTCAGGGGAAATGG + Intergenic
994082170 5:95719036-95719058 GTGAAGGTCATCATGGAAAAAGG + Intronic
994994233 5:107039191-107039213 ATGAGGGTCTTCAGGGGAGAAGG + Intergenic
995083926 5:108086133-108086155 ATGAGGATCTTCAAGGGAGAAGG - Intronic
995083941 5:108086223-108086245 ATGAGGATCTTCAAGGGAGAAGG - Intronic
995289719 5:110437972-110437994 CTGAAGGTTTTCAGTGGATAAGG + Intronic
996783373 5:127212805-127212827 GTCGAAGTCTTCTGGGGAGAGGG - Intergenic
997529121 5:134571359-134571381 CTGGAGGTTTTAAGGGGAGAAGG + Intronic
997639425 5:135438950-135438972 CTTAAGGCCTTCAGGGAAGATGG + Intergenic
998252293 5:140561372-140561394 TGGCAGGTCTTCAGGAGAGATGG + Exonic
998387994 5:141769242-141769264 GAGAAGGAAGTCAGGGGAGATGG - Intergenic
998951582 5:147397901-147397923 CTGAAGGTCTCAAGGAGAGAAGG - Intronic
999356928 5:150943972-150943994 GAGAAGGTCGTGATGGGAGAAGG + Intergenic
1001139867 5:169135791-169135813 GTGAAGGGGTTGTGGGGAGAAGG - Intronic
1002370111 5:178745241-178745263 GTCAAAGTCTTCTGGGGAGAGGG + Intergenic
1003801192 6:9669270-9669292 GTGAAGATCTGCAGGAGAGGTGG - Intronic
1004374084 6:15076624-15076646 GTAAAGGGCTGCAGAGGAGACGG - Intergenic
1005010302 6:21329349-21329371 ATGAGGGTCTTCAGGGGAAAAGG - Intergenic
1005125487 6:22442264-22442286 GTGACCTGCTTCAGGGGAGAAGG - Intergenic
1006928147 6:37670392-37670414 GTGCAGGGCTTCAGAGGGGATGG + Intronic
1007109036 6:39302418-39302440 ATGAAGTTCTTCAGAGGAGCTGG + Intronic
1007209543 6:40181251-40181273 ATGAAGGTCTTCAAGGGAAATGG - Intergenic
1007547966 6:42708573-42708595 GGGAAGGTCTTGGGGGAAGAAGG - Intronic
1007872285 6:45053955-45053977 CTGATGGTCTTCAGGGGAGAAGG - Intronic
1008186642 6:48400544-48400566 GAGAATGTATTCATGGGAGATGG - Intergenic
1009027361 6:58016047-58016069 ATGAGGGTCTTCAGGAGAGAAGG - Intergenic
1010465264 6:76160629-76160651 GGGAAGATCTTCAAGGCAGAGGG + Intergenic
1011101938 6:83731852-83731874 ATGAAGATCTTCAAGGGAAAAGG + Intergenic
1014060178 6:117063136-117063158 GTAAAGTTTTTCTGGGGAGAGGG + Intergenic
1015444630 6:133288648-133288670 GTGATGCTTTTAAGGGGAGATGG + Intronic
1016781076 6:147959092-147959114 GTGAAAGTGTTGAGAGGAGAAGG + Intergenic
1016805214 6:148205624-148205646 GTGAAGTTCTTCTGGGGACTAGG - Intergenic
1017066873 6:150537295-150537317 TTGAAGGTCTTCAGGCCATATGG + Intergenic
1018355620 6:163011925-163011947 TGGAAGGTCTTCAGGGGCAATGG + Intronic
1018567637 6:165172319-165172341 GTGAAGATCTTCAGGAAAAATGG - Intergenic
1021504828 7:21370384-21370406 GTGCAGGTCCTCAGGTGTGAGGG + Intergenic
1023480134 7:40625309-40625331 GTGAAGATTTTCAGGGCAGTAGG + Intronic
1024426246 7:49229580-49229602 CTGAAGGTTTTCAGGGAAAATGG + Intergenic
1024983868 7:55179522-55179544 GGGAAGCTCTCCTGGGGAGAAGG + Intronic
1026807211 7:73435934-73435956 GTGAGGCTCATTAGGGGAGATGG + Exonic
1026953393 7:74362131-74362153 TTGGAGGGCTGCAGGGGAGATGG - Intronic
1027124743 7:75548380-75548402 GAGAAGGTCCTCATGAGAGAAGG - Intronic
1027124745 7:75548396-75548418 GAGAAGGTCCTCATGAGAGAAGG - Intronic
1027224928 7:76237823-76237845 GTGAAGGTCTTTGAGGGGGAGGG - Intronic
1027560624 7:79724436-79724458 GTGAAGGTCTTCAGAAGAGAAGG + Intergenic
1028755992 7:94434867-94434889 AGGATGGTCTTCAGGGGAGGAGG + Intergenic
1028803326 7:94994291-94994313 CATAGGGTCTTCAGGGGAGAAGG + Intronic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1029897176 7:103995372-103995394 GTGATGGTCTTCAAAGGAGATGG + Intergenic
1029927306 7:104330413-104330435 GGGAAGGTTTTCTGGGGAGAGGG + Intronic
1030187597 7:106778840-106778862 GTGAAAGCCTTCTGGGGAGATGG - Intergenic
1030406800 7:109125259-109125281 ATGAAGGCGTTTAGGGGAGAAGG + Intergenic
1032029209 7:128468423-128468445 GGGAAGGTGTTCCAGGGAGAGGG - Intergenic
1032327813 7:130948394-130948416 ATGATGGTTTTCAGGGGAGCTGG + Intergenic
1033429624 7:141277428-141277450 TGGAAGGTCTTCAGGGGCAATGG + Intronic
1033711600 7:143951675-143951697 GTGGAGTTTTTGAGGGGAGAGGG + Intergenic
1033832667 7:145272325-145272347 GTGAGAATCTTCAGGGAAGAGGG + Intergenic
1035487009 7:159233843-159233865 GTAAAGGTTTTGAGGGGATAAGG + Intergenic
1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG + Intronic
1037900957 8:22689497-22689519 GAGAAGGTTTAGAGGGGAGAAGG + Exonic
1038438583 8:27555973-27555995 ACGAGGGTCTTCAAGGGAGAGGG + Intergenic
1039259427 8:35754546-35754568 TGCAAGGTCTTCCGGGGAGAAGG - Intronic
1041505691 8:58595030-58595052 ATGAAGGTCTTAATGAGAGAGGG + Intronic
1042310269 8:67372229-67372251 GAGAAGGTCATTAGGAGAGAGGG + Intergenic
1042487344 8:69361181-69361203 ATGAGGGTATTCAAGGGAGAAGG - Intergenic
1042938353 8:74082936-74082958 GTGATCTGCTTCAGGGGAGAAGG + Intergenic
1043908746 8:85836291-85836313 GCGGAGTTCTTCAGGGCAGAGGG + Intergenic
1044338569 8:91019487-91019509 GGGAAGGCTTTCAGGGCAGAAGG + Intronic
1045288663 8:100813177-100813199 ATGAGGGTCTTCAAGGGAAAAGG - Intergenic
1046319842 8:112558286-112558308 ATGAGGGTTTTCAAGGGAGAAGG - Intronic
1047096977 8:121636394-121636416 GAGAAGGTCAGAAGGGGAGAAGG - Intronic
1047301012 8:123613413-123613435 TTGAGGATCTTCAAGGGAGAAGG + Intergenic
1047417087 8:124673516-124673538 GTGAAAGTCCCCAGGGGAGGTGG + Intronic
1047802184 8:128321485-128321507 GTGAGGGTGTGCAGGGGTGAGGG + Intergenic
1048239335 8:132725626-132725648 GTGAAGGGCTTAATGGAAGATGG + Intronic
1048454501 8:134565726-134565748 GAGAAGGGCATCAAGGGAGAGGG + Intronic
1049082839 8:140456911-140456933 GGGAAGGTCTGCAGGGGTGGAGG + Intronic
1049148025 8:141016449-141016471 GTTAGGGTGTTCAGGGGAGTGGG - Intergenic
1049499862 8:142956017-142956039 GGGCAGGACTACAGGGGAGAGGG + Intergenic
1049530780 8:143153802-143153824 GTGAAGGTGGTCAGGGCAGGTGG - Intergenic
1049702161 8:144020257-144020279 GAGAGGTTCTTCAGCGGAGAGGG - Intronic
1049702310 8:144020834-144020856 GAGAGGGTCTTTAGGGAAGAGGG - Intronic
1049702328 8:144020898-144020920 GAGAAGGTCCTGAGGGAAGAGGG - Intronic
1049702358 8:144021009-144021031 GGGAAGGTTTTCAGGGAAGGAGG - Intronic
1049702820 8:144022834-144022856 GAGAGGGTCCTCAGGGAAGAAGG - Intronic
1049702878 8:144023062-144023084 GAGAGGGTCCTTAGGGGAGAGGG - Intronic
1049702917 8:144023194-144023216 GAGAGGGTCCTCAGGGGAGAGGG - Intronic
1049702923 8:144023210-144023232 GGGTAGGTCCTGAGGGGAGAGGG - Intronic
1049702992 8:144023447-144023469 GAGAGGGTCCTCAGGGAAGAAGG - Intronic
1049703349 8:144024764-144024786 GGGTAGGTCTTGAGGGGAGAGGG - Intronic
1053406883 9:37885165-37885187 GAGAAGGTCCTCAGGGGCCAGGG - Intronic
1053603166 9:39631145-39631167 CTGAAGGTCATCAAGAGAGAGGG + Intergenic
1054250373 9:62711280-62711302 CTGAAGGTCATCAAGAGAGAGGG - Intergenic
1054564481 9:66745808-66745830 CTGAAGGTCATCAAGAGAGAGGG - Intergenic
1054801690 9:69356136-69356158 GCCACGGACTTCAGGGGAGAAGG - Intronic
1055502588 9:76916392-76916414 ATGAGTGTCTTCAGGGGAGAAGG - Intergenic
1055791321 9:79926127-79926149 TTGAGGGCCTTCAGGGGACAAGG + Intergenic
1056467732 9:86874679-86874701 TATAAGGTATTCAGGGGAGAAGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058698893 9:107584852-107584874 GTGAAGGTTTGGAGAGGAGAGGG - Intergenic
1059347173 9:113636979-113637001 GTAAAGGTCTTCAGGAGGGCAGG - Intergenic
1059445079 9:114332992-114333014 TGGGAGGTCTTCCGGGGAGAGGG - Intronic
1060024637 9:120160933-120160955 GTGCAGGGCTTCAGGGCACAGGG - Intergenic
1060404804 9:123367933-123367955 GGGATGGTCTTCAGGGAAGACGG + Intronic
1060446351 9:123691802-123691824 GTGAAAGTCCTCAAGGAAGAAGG + Intronic
1061714987 9:132513448-132513470 GGGAGGGTCCTCAGGGAAGACGG - Intronic
1061953672 9:133950448-133950470 TTGGAGGGCTTCAGGGGAGCAGG - Intronic
1062521597 9:136960148-136960170 ATGAAGGTCTGCACGGGAGCAGG - Intergenic
1185505088 X:627411-627433 GGAAAGGTCTTTAGGTGAGAGGG + Intronic
1185664908 X:1757915-1757937 GGGGTGGTCTGCAGGGGAGAGGG - Intergenic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1186685880 X:11923494-11923516 GTGAGTGTCTTCAGGGAAGCAGG + Intergenic
1186748159 X:12592072-12592094 ATGAAGGTCTTCAAGGGAGAAGG - Intronic
1187369149 X:18689917-18689939 GTGAAGGTGTTGATGGGGGATGG - Intronic
1188004621 X:25008593-25008615 ATTAATGCCTTCAGGGGAGAAGG - Intronic
1188562002 X:31479298-31479320 GTAAAGCTATTCTGGGGAGATGG + Intronic
1189104126 X:38219870-38219892 GCGAAGAGCTTCAGGGGAGTAGG - Intronic
1189701987 X:43721256-43721278 GTGAAGGCCTTGAGGTGAGAAGG + Intronic
1189861143 X:45273691-45273713 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1189962147 X:46333838-46333860 ATGAAGGTTTTCAGGGAAGTGGG - Intergenic
1190274613 X:48891848-48891870 GTGAAGGCCTGCAGGGGGCAGGG + Intergenic
1192055554 X:67769624-67769646 GTGTAGGTTTCCAGGGAAGAAGG - Intergenic
1193837020 X:86355820-86355842 GTAAAGGTCTTCTTTGGAGAAGG + Intronic
1194051727 X:89077839-89077861 GTGGAGTTCTTCAGGGAACAGGG + Intergenic
1195004477 X:100672344-100672366 GTGGATGACTTGAGGGGAGAAGG + Intergenic
1195508004 X:105681108-105681130 ATGAAGGTCTTCAAGGGAAAGGG + Intronic
1196045792 X:111255054-111255076 GTGAAGGTCCTGAGGGGATCTGG + Intronic
1197633840 X:128892067-128892089 ATGAAGGCCTTCAGAGTAGAAGG - Intergenic
1198314064 X:135449456-135449478 GTTAAGGTCTTCAGTAAAGAAGG - Intergenic
1198459211 X:136847306-136847328 GAGAAGGTCTCCAGGGGTGAGGG - Intergenic
1198730412 X:139721985-139722007 ATGTAGGTTTTCAGAGGAGAGGG - Intergenic
1202334205 Y:23789805-23789827 GTGAAGGTAAGCAGAGGAGAGGG + Intergenic
1202536563 Y:25880254-25880276 GTGAAGGTAAGCAGAGGAGAGGG - Intergenic