ID: 1158018220

View in Genome Browser
Species Human (GRCh38)
Location 18:52809650-52809672
Sequence CGGCAAACAGCAGTGGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 2, 1: 63, 2: 126, 3: 79, 4: 266}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158018220 Original CRISPR CGGCAAACAGCAGTGGGGGA CGG Intronic
903071302 1:20728087-20728109 CTGCAAAGGGCAGGGGGGGAAGG + Intronic
903509976 1:23867833-23867855 CGGCAAACAGGAGGTGGGGCTGG - Intronic
903524091 1:23979943-23979965 CTGCAAACTGCGGAGGGGGAGGG + Intronic
904049572 1:27631185-27631207 GAGAACACAGCAGTGGGGGAGGG - Intronic
904917677 1:33982142-33982164 AGGCAAACAGAAGTGGGTGATGG + Intronic
906061012 1:42948528-42948550 CGGCTCAAAGGAGTGGGGGAGGG + Intronic
907179006 1:52553346-52553368 GGGGAAACAGCACTGGGGGGAGG + Intronic
907338409 1:53715865-53715887 CTGCAAACAGAAGTGGAGAATGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907602971 1:55788566-55788588 CGGTGAACAGCCGTGGTGGACGG + Intergenic
908703368 1:66925188-66925210 CGGTACACTGCCGTGGGGGAGGG - Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911286715 1:96003375-96003397 AGGAACACAGAAGTGGGGGAAGG - Intergenic
912503101 1:110135551-110135573 CGGCAAACAGATGTTGGGGTGGG + Intergenic
913703513 1:121396767-121396789 CGGCAAAAAGCCGTGGCGGCGGG - Intergenic
914044041 1:144076996-144077018 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
914134016 1:144883472-144883494 CGGCAAAAAGCCGTGGTGGCGGG + Intergenic
915725122 1:158011763-158011785 CGGAGGGCAGCAGTGGGGGAAGG + Intronic
916414394 1:164578960-164578982 TGGCAAATAGCAATGGGGGCGGG - Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917910408 1:179638717-179638739 GGGGAAAAAGAAGTGGGGGATGG + Intronic
918536910 1:185584894-185584916 AGCCACACAGCGGTGGGGGAAGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919921000 1:202166329-202166351 CGGGGAAAAGAAGTGGGGGAAGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921562774 1:216678466-216678488 TGGCAAAAAGAAGTGGGGGAAGG - Intronic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923731736 1:236557810-236557832 AGTCAAAAAGCAGTGGGTGAAGG - Intronic
924652258 1:245940138-245940160 CGGGACACAGCACTGGGGGGAGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066144342 10:32541224-32541246 TGGCTACCAGCAGTGGGGGTGGG + Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067552837 10:47247319-47247341 AGGCACCCAGCAGTGGAGGAGGG + Intergenic
1068747991 10:60557033-60557055 CAGACGACAGCAGTGGGGGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070786724 10:79166361-79166383 CGCCAAAGAGCAGGGTGGGAGGG - Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1074447251 10:113530616-113530638 AGGGAAAGAGCAGTAGGGGAGGG + Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077437572 11:2550185-2550207 CGGCAAAGAGAGGCGGGGGAGGG - Intronic
1077485721 11:2837604-2837626 GGGCAGACAGAGGTGGGGGATGG + Intronic
1077836795 11:5933281-5933303 AAGCACACAGGAGTGGGGGAAGG - Intronic
1078692812 11:13598784-13598806 CAGCAAACCCCAGTGGGAGATGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG + Intronic
1080485797 11:32705125-32705147 CGGGAAACAGCAGTGGGGCTAGG + Intronic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081063030 11:38503995-38504017 CCACAATCAGCAGTGGGGGATGG - Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081492522 11:43579397-43579419 GGGCAAACACCCGTGGGGGGCGG + Intronic
1081905639 11:46667790-46667812 TATCAAACAGCAGTGAGGGACGG + Exonic
1083637694 11:64129337-64129359 CTCCCAACAGCAGTCGGGGATGG - Intronic
1083969120 11:66061905-66061927 TGGCAATCAGCCATGGGGGAGGG - Exonic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085265594 11:75236241-75236263 TGTCTCACAGCAGTGGGGGAGGG + Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086327777 11:85722030-85722052 AAGCAAACTGCAGTGGGGGTGGG - Intronic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089455078 11:118621347-118621369 CGGCCACCAGCGGCGGGGGAAGG - Intronic
1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG + Intronic
1091325111 11:134680321-134680343 CAGCAAACAGCAGTGGCTGCTGG - Intergenic
1092208399 12:6630863-6630885 CGGGAAGCAGAAGTGTGGGATGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1095944166 12:47744711-47744733 CGGAAAAAAGCAGGGTGGGAAGG - Intronic
1096102599 12:48978730-48978752 CTGCCAACAGCAGTGGCCGATGG + Exonic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096472252 12:51887170-51887192 CGGCAGGCAGTAGTGAGGGAGGG - Intergenic
1096510745 12:52126648-52126670 CGGCAAACAAAAGTGGGTGGAGG + Intergenic
1096803243 12:54125778-54125800 CGGCCAACAGGAGTGGGCCAAGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1099778346 12:87163026-87163048 AGGCAGACAGCTGTGGGGGCAGG - Intergenic
1100773549 12:97950114-97950136 TGGGAAACAGGGGTGGGGGATGG + Intergenic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1102536735 12:113587243-113587265 AGGCAGCCAGCAGTTGGGGAGGG + Intergenic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1103969094 12:124658567-124658589 CGGGACACAGCAGAGGGTGAGGG + Intergenic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1106713440 13:32362808-32362830 AGGAGAACAGCAGTGTGGGATGG - Intronic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108095277 13:46894327-46894349 GGGCAAACTCCAGTGGGGGTAGG - Intronic
1108344095 13:49527308-49527330 AGTCAAACAGCATTGGTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110310057 13:74038460-74038482 CGACAAAAAGCAGTGCAGGAGGG + Intronic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG + Intergenic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114398755 14:22390081-22390103 GGGCACACAGCAGAAGGGGAGGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115359441 14:32484791-32484813 CGGCGAACATCAGTGGGATAAGG + Intronic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117828395 14:59726931-59726953 TGAGAAACAGCAGTGGGGGCGGG + Exonic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119237430 14:73031284-73031306 CGGAAAAGAGATGTGGGGGAGGG - Intergenic
1119907153 14:78316293-78316315 TGGCAGACAGCTGTGGGGGTAGG + Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1121711157 14:96039829-96039851 AGGGGGACAGCAGTGGGGGATGG - Intronic
1122301844 14:100735859-100735881 GGGCAAAGAGGGGTGGGGGAGGG - Exonic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124221824 15:27856053-27856075 CCGCAGACACCAGTGGGGCAAGG - Intronic
1124840956 15:33241715-33241737 ATGCACACACCAGTGGGGGAGGG + Intergenic
1125747196 15:42005080-42005102 CAGCAGGCAGCTGTGGGGGAAGG - Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127659650 15:61088457-61088479 AAGCAAAAAGCGGTGGGGGATGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129060011 15:72853236-72853258 GGGCTCACAGCAGTGGAGGAGGG + Intergenic
1129685420 15:77683708-77683730 AGGCCAACAGCAGTGGGACATGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129882574 15:79016929-79016951 CAGCCAACAGCAGAAGGGGAGGG - Intronic
1131120929 15:89823053-89823075 TGGTGACCAGCAGTGGGGGAGGG + Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133539138 16:6731788-6731810 TAGGAAACAGCAGTGGGGAAGGG - Intronic
1133774060 16:8884310-8884332 CGGCATACAGCTGTGGGAGTGGG - Intergenic
1134000551 16:10779550-10779572 AGGCAAACAGCACAGGGGCATGG + Intronic
1134305343 16:13027039-13027061 CCAGATACAGCAGTGGGGGAGGG - Intronic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1137783381 16:51116333-51116355 AGACAACAAGCAGTGGGGGAGGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141617089 16:85216029-85216051 CAGCCAACAGGAGTTGGGGAGGG + Intergenic
1142148314 16:88501843-88501865 TGGCAAACAGCAGTGGCAGGAGG - Intronic
1142197812 16:88746787-88746809 CTTTAATCAGCAGTGGGGGAAGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1145694003 17:26773686-26773708 CGGCAAAAAGCCGTGGCGGCGGG - Intergenic
1145978214 17:28996444-28996466 CAGCAAACCTGAGTGGGGGAGGG + Intronic
1146375836 17:32293804-32293826 AAGCAAACAGAAGTGGGTGAGGG + Intronic
1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG + Intergenic
1147946586 17:44083775-44083797 GGGCGTACAGCAGTGGGGGTGGG - Intronic
1148229014 17:45919560-45919582 CTGCGCCCAGCAGTGGGGGAAGG - Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148736123 17:49865876-49865898 CTGCAGTCAACAGTGGGGGAGGG - Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152242120 17:79166212-79166234 AAGCAAACACCAGTGTGGGAGGG + Intronic
1152272969 17:79336008-79336030 TGGCAAACAGCACAGAGGGAGGG - Intronic
1152371838 17:79893077-79893099 AGGCCAGCAGCAGTGGGGGCAGG + Intergenic
1152791873 17:82284479-82284501 AGGCAGAAAGCAGTGGGGGAGGG + Intergenic
1152820603 17:82435875-82435897 CGGCCAACAGGGCTGGGGGAGGG + Intronic
1203192285 17_KI270729v1_random:200374-200396 CGGCAAAAAGCAGCGGGAGCAGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156036241 18:32770636-32770658 TGGCAGACAGGGGTGGGGGATGG + Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1158525276 18:58207647-58207669 CCCCAAACATCACTGGGGGATGG - Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160293952 18:77620945-77620967 CTGCAAGCTGCAGTGAGGGATGG + Intergenic
1160342670 18:78102673-78102695 GTGCAAACAGCGGTGGGAGATGG + Intergenic
1161155588 19:2730724-2730746 CTTCCAACAGCAGTGGGGTAAGG + Intronic
1161313526 19:3607506-3607528 CGGGAGGCTGCAGTGGGGGATGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165181268 19:33973036-33973058 GGACAAACAGGAGAGGGGGAGGG - Intergenic
1165823193 19:38690264-38690286 CGGTGAACAGCAGTGAAGGATGG - Intronic
1167671800 19:50857847-50857869 TGGGAAACAGCAGTGTGAGAGGG - Intronic
1167694246 19:51004943-51004965 TGGTAAACAGAAGTCGGGGACGG + Intronic
1168072146 19:53959275-53959297 CGCGAAACAGAAATGGGGGAGGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1202683272 1_KI270712v1_random:29309-29331 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925384973 2:3455494-3455516 CTGGGAACAGTAGTGGGGGATGG - Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929594185 2:43165793-43165815 CGGCAACCAGCAAGGGGGGGCGG + Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
930767350 2:55097548-55097570 AAGGAGACAGCAGTGGGGGAAGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931471378 2:62541013-62541035 TGGCAGACAGCAGAAGGGGAGGG + Intergenic
932669959 2:73728663-73728685 GGGCAAAGAGCCATGGGGGAAGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934304353 2:91809540-91809562 CGGCAAAAAGCCGCGGGGGCGGG - Intergenic
934307636 2:91840272-91840294 CGGTAAAAAGCCGTGGGGGCAGG - Intergenic
934328902 2:92043210-92043232 CGGCAAAAAGCCGCGGGGGCGGG + Intergenic
934331417 2:92073283-92073305 GGGCAAAAAGCAGTGGGAGCGGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936050450 2:109218661-109218683 CGGCCAGCAGGAGTGAGGGAGGG + Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937857804 2:126685294-126685316 AGCCAGACAGCAATGGGGGAAGG - Intronic
937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942298067 2:174536463-174536485 GTGCAGCCAGCAGTGGGGGATGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
946350331 2:219146897-219146919 GGGCAAAAAGTAGTGGGAGAGGG + Intronic
946375117 2:219303117-219303139 GGGCAAACAGGAGCAGGGGAAGG + Intronic
948781458 2:240324229-240324251 CCTCAAACAGCAGTGGGGCCCGG + Intergenic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1171239031 20:23550490-23550512 CGGCAAACTCCAGGGTGGGAGGG + Intergenic
1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171793520 20:29548810-29548832 CGGCCAACAGGAGTGGGAAAAGG - Intergenic
1171854948 20:30335574-30335596 CGGCCAACAGGAGTGGGCAAAGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1174708977 20:52685192-52685214 TGGCAGAGTGCAGTGGGGGAAGG + Intergenic
1175571007 20:60022062-60022084 CTGCAGACATCAGTTGGGGAAGG - Intronic
1177038213 21:16071578-16071600 CGGCAGACACCAATGGGGGGGGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177738089 21:25118590-25118612 CGCCTAACAGCACAGGGGGAGGG + Intergenic
1177738119 21:25118775-25118797 CGGGGAACAGCAGTGGTAGAGGG - Intergenic
1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178613733 21:34111452-34111474 CTTCAAATAGAAGTGGGGGAGGG - Intronic
1178761268 21:35405072-35405094 AGCCAAACAGAAGTGGGGCAGGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1179599081 21:42463946-42463968 CGGAAAACAGAAGTGAGGTAGGG + Intergenic
1180057677 21:45367293-45367315 TGGCAGCCAGCAGTGGGAGAGGG - Intergenic
1180994721 22:19959796-19959818 CGGCCAAGAGCCATGGGGGATGG - Intronic
1182204965 22:28614675-28614697 CAGCAACAAGCAATGGGGGAAGG + Intronic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1183168275 22:36164294-36164316 CGGTTAACAGAAGTGGGGGCTGG - Intronic
1183601948 22:38844801-38844823 AGGCAGACTGCAGTGGGGGTGGG - Intergenic
1184285336 22:43467713-43467735 CAGAACACAGCAGAGGGGGATGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951566798 3:24019560-24019582 CGCCAAACAGCAGGAGGGAAAGG - Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
954516622 3:51183785-51183807 CCTCACACAGCAGTGGGGTAGGG + Intronic
954619103 3:51985672-51985694 CAGGAGACAGCAATGGGGGATGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955615198 3:60800158-60800180 AGGCAGAGAGAAGTGGGGGAAGG - Intronic
955908122 3:63829302-63829324 CACCATACAGCAGTGGGGTAAGG + Intronic
956155286 3:66289582-66289604 CTGAAAAAAGCAATGGGGGAAGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959160231 3:102715260-102715282 AAAAAAACAGCAGTGGGGGATGG - Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961602986 3:128075505-128075527 GGGGAAGGAGCAGTGGGGGAAGG - Intronic
961812643 3:129530766-129530788 AGGCAACCAGGAGTGGGAGAGGG - Intronic
962194699 3:133351415-133351437 CGGCAAACAAAAGTGGGGAGAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963915312 3:150854370-150854392 CAGCAAACAGCAGTAGCAGACGG - Intergenic
964481998 3:157148722-157148744 GGGCATACAGCAGTGAGGGGTGG - Intronic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966803666 3:183788289-183788311 AGGCCAACAGCAGGGAGGGAGGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
968288378 3:197521277-197521299 TAGAATACAGCAGTGGGGGATGG - Intronic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
969055118 4:4396839-4396861 TGGCATTCAGCAGTGGGGGTGGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977769849 4:100845388-100845410 TGGCAGACAGCAGTGAGAGATGG + Intronic
978046040 4:104128924-104128946 AGGCAAACAACTGTGGAGGATGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983666276 4:170188271-170188293 TGGCAGACAACAGTGGGGGCTGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
991772557 5:70053350-70053372 CAGGAAACAGCACTTGGGGATGG + Intronic
991851850 5:70928774-70928796 CAGGAAACAGCACTTGGGGATGG + Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992392071 5:76338533-76338555 CAGCAGACTGCAGTGGGGGTGGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
993806809 5:92420568-92420590 AGGAAAACAGCAGTTAGGGAGGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994105270 5:95940960-95940982 CTGCAAAAAGAAGGGGGGGAGGG + Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
995893491 5:116984019-116984041 CTGCAATCAGAAGTAGGGGAAGG + Intergenic
996018042 5:118562804-118562826 GGGAAAACAGGAGTGGGGAAGGG + Intergenic
996019247 5:118573683-118573705 AGGAAAACGGCAGTGGGGGAAGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
998939201 5:147262203-147262225 AGGCAAACAGAAGTGGGGTGAGG - Intronic
1000908496 5:166993028-166993050 ATGCAAGCAGGAGTGGGGGAGGG - Intergenic
1001401562 5:171449470-171449492 CGGGGAAGAGAAGTGGGGGATGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006877230 6:37308377-37308399 CAGCAAAAAGCAGTGGAGAAAGG - Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1007078962 6:39085354-39085376 CGGGAAACAGCAGGGAGGAAGGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009229363 6:61043668-61043690 TGGTGAACAGCAGTGGGGGTGGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009546057 6:65020977-65020999 CTGCACACAGCAGTGGGGCCCGG + Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1010186407 6:73148956-73148978 TGTCAAAGAGCAGTGGGTGATGG + Intronic
1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG + Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013151212 6:107448076-107448098 CTGCATACAGCAGGGGGGGCTGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014795688 6:125721636-125721658 CGGGAAACAGCAGGCTGGGATGG + Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017634689 6:156432118-156432140 CTGCAAGCTGCAGTGGGTGAGGG - Intergenic
1019843777 7:3476279-3476301 CAGCAAACAGCTGTGGGTGATGG - Intronic
1019872125 7:3774283-3774305 AGGCCTACAACAGTGGGGGAAGG + Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1023795937 7:43792180-43792202 CGGCAAACTTCAGTGTGGCAGGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024156766 7:46633986-46634008 AGGCAATGAGCAGTGGAGGAAGG - Intergenic
1025878567 7:65509921-65509943 GGGCAAAAAGCAGTGGGAGCTGG + Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026804871 7:73423579-73423601 CGGCACACATCACTGGGGCAAGG + Intergenic
1027591857 7:80128191-80128213 GGGCAAACAACACTGGGGCAGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028041392 7:86058715-86058737 TGGCAAGGAGCAGTGGGGGTGGG + Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029597957 7:101547511-101547533 GGACACACACCAGTGGGGGATGG + Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031009694 7:116513005-116513027 CGGCATACAGGGCTGGGGGAGGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031992957 7:128209761-128209783 AGCCAGACAGCAGTGGGAGAAGG + Intergenic
1032087134 7:128890447-128890469 TGGCAGGCAGCAGTGGGCGATGG + Exonic
1032187473 7:129739588-129739610 CAGTAAACAGCAGGGTGGGAGGG + Intronic
1032223267 7:130010211-130010233 GTGGAAACAGCAGTGGGGAAAGG + Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032666580 7:134043071-134043093 AGGGAGACTGCAGTGGGGGAAGG - Intronic
1032851552 7:135799545-135799567 CTGAAAACAGGAGTGGAGGATGG - Intergenic
1033311746 7:140266764-140266786 GGGCGAACAGCAGTGGGAGGGGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG + Intergenic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1041266580 8:56071540-56071562 TGGGTAACAGCAGTAGGGGAGGG + Intronic
1041953878 8:63536272-63536294 CGGGAAGCTGCAGTGGGGAATGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042058017 8:64787040-64787062 CTGCACAGAGCAGTGGGGCAGGG + Intronic
1043484194 8:80682714-80682736 TGCCAAACGGCGGTGGGGGAGGG + Intronic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1044381508 8:91539581-91539603 AAACAAACAGCACTGGGGGATGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048081473 8:131132798-131132820 AGGCAAAGAGCAGTGTGAGAAGG - Intergenic
1048183260 8:132215625-132215647 CAACAAACAGCAGTGGGTGCAGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049491281 8:142904457-142904479 TGGCAAAGAACAGTGGGGGTTGG - Intronic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1051612141 9:18971282-18971304 AGGCAAGCAGCAGTGGGGCATGG - Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053792768 9:41698858-41698880 CGGCCAACAGGAGTGGGCAAAGG + Intergenic
1054152407 9:61615967-61615989 CGGCCAACAGGAGTGGGCAAAGG - Intergenic
1054181181 9:61910879-61910901 CGGCCAACAGGAGTGGGCAAAGG + Intergenic
1054407604 9:64774683-64774705 GGGCAAACAGCCGCGGGGGCGGG + Intergenic
1054407615 9:64774707-64774729 GGGCAAACAGCCGCGGGGGCGGG + Intergenic
1054472180 9:65547110-65547132 CGGCCAACAGGAGTGGGCAAAGG - Intergenic
1055352095 9:75400020-75400042 CACAAAACAGCACTGGGGGATGG + Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057467751 9:95331108-95331130 CTGCAGACAGCAAAGGGGGAAGG + Intergenic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1057744104 9:97737937-97737959 CTGCAAACAGCAGCTGAGGATGG - Intergenic
1061245589 9:129399879-129399901 CGGTAGACAGCAGTGGCAGAGGG + Intergenic
1203616509 Un_KI270749v1:72211-72233 CGGCAAAAAGCCGTGGCGGCGGG - Intergenic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1186410591 X:9342255-9342277 GGGTAAAAAGCAGAGGGGGAGGG - Intergenic
1186410638 X:9342374-9342396 GGGTAAAAAGCAGAGGGGGAGGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188319580 X:28719843-28719865 CAGCACACAGGAATGGGGGATGG + Intronic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1191040135 X:56069540-56069562 TGGCTACCAGCAGTGGGGGTGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193443972 X:81577346-81577368 TGGCAAGGAGCAGTGGGGGTAGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1199699241 X:150363995-150364017 CGGCAAACAGCGTTGGGGTGGGG - Intronic
1199815360 X:151392408-151392430 CGGCAAACAGAAGTAGGCAATGG - Intergenic
1200048413 X:153414990-153415012 CGGGAAACAGCAGCTGGGGCCGG + Intergenic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1202075908 Y:21037863-21037885 TGGCAGACAGGAGTGGGGGGGGG - Intergenic