ID: 1158022292

View in Genome Browser
Species Human (GRCh38)
Location 18:52857621-52857643
Sequence GATTATTCACAGAAGTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158022292_1158022295 -2 Left 1158022292 18:52857621-52857643 CCCAGTGACTTCTGTGAATAATC 0: 1
1: 0
2: 2
3: 11
4: 197
Right 1158022295 18:52857642-52857664 TCACTAATGAGGCCCTCAAATGG 0: 1
1: 0
2: 1
3: 8
4: 80
1158022292_1158022298 24 Left 1158022292 18:52857621-52857643 CCCAGTGACTTCTGTGAATAATC 0: 1
1: 0
2: 2
3: 11
4: 197
Right 1158022298 18:52857668-52857690 GTGAGAATTGATCTCTTCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 140
1158022292_1158022299 27 Left 1158022292 18:52857621-52857643 CCCAGTGACTTCTGTGAATAATC 0: 1
1: 0
2: 2
3: 11
4: 197
Right 1158022299 18:52857671-52857693 AGAATTGATCTCTTCTCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158022292 Original CRISPR GATTATTCACAGAAGTCACT GGG (reversed) Intronic
900962375 1:5933360-5933382 GAGTTATCACAGAAGTCACCTGG + Intronic
904564244 1:31418265-31418287 AATTATTCACAGTAGTCATAAGG - Intronic
905887760 1:41500836-41500858 GATTCTTCACAGAAGCCACTGGG - Intergenic
909281321 1:73757594-73757616 CATTATTCAGTGAAGTCTCTGGG + Intergenic
909682199 1:78304361-78304383 GATTATTAACACTAGTCACCTGG + Intronic
910042039 1:82864166-82864188 GATTTTTCTCAAAAATCACTAGG - Intergenic
911111019 1:94185707-94185729 TATTATTCATAGCAGTGACTTGG - Intronic
914737431 1:150431360-150431382 CATTATTCACAGTAGTCAAAAGG + Intronic
916258475 1:162815415-162815437 GATTATTGACAAAAATCACTGGG + Intergenic
916576904 1:166075439-166075461 AATCATTCACAGAAGTAACAAGG + Intronic
919503430 1:198367633-198367655 GATTCTTCAGAGAAGAAACTGGG + Intergenic
924217281 1:241836469-241836491 GAGTATTCACTGAACACACTAGG + Intergenic
1064792887 10:18978898-18978920 CATTATTCAAATAAGGCACTAGG - Intergenic
1066724919 10:38381103-38381125 GATTATTGACAAAAATCACTGGG + Intergenic
1068614008 10:59091592-59091614 GATTATCCATAAAAGTCCCTGGG - Intergenic
1069265834 10:66456367-66456389 TATTTTGCACAGAATTCACTTGG - Intronic
1072391400 10:94991189-94991211 GATTATTCACTACAGTCTCTAGG - Intergenic
1073960001 10:108914620-108914642 GCTCATTGACAGAAGTCATTGGG - Intergenic
1074337496 10:112592843-112592865 GTTTATCCACAGGATTCACTCGG - Intronic
1076327639 10:129639589-129639611 CATCATTCAAAGAAGTCACAGGG + Intronic
1076557601 10:131338095-131338117 CATTATTCACAACAGTCACAGGG - Intergenic
1080272066 11:30460941-30460963 CATTATTCACAATAGTCAATAGG + Intronic
1080835847 11:35940241-35940263 CATGAGTCACAGAAGTGACTGGG + Intergenic
1082007110 11:47425615-47425637 GATTATTCCCAGTTCTCACTGGG + Intronic
1090071269 11:123546588-123546610 GATTACTCCCAGACCTCACTGGG - Intronic
1090174007 11:124631593-124631615 GATTACTCACAGATGTCATGGGG + Intronic
1095382160 12:41608181-41608203 GATTATACATAGAAGACATTTGG - Intergenic
1096133661 12:49181428-49181450 CATTATTCACAAAAGTCAACAGG + Intergenic
1097969639 12:65619243-65619265 GTTTCTTCACTGAAGTCACGTGG - Intergenic
1099854904 12:88151559-88151581 AATTATTCACATAACTCATTAGG - Intronic
1100902956 12:99264032-99264054 GATTACTTACAGAAGACAATGGG - Intronic
1101224041 12:102669723-102669745 GCTTCTTCTCAGAAGTCTCTGGG + Intergenic
1102202427 12:111066904-111066926 GATCATTCATGGAAGGCACTTGG + Intronic
1102246448 12:111359503-111359525 GAATATTCTGAGAAGCCACTTGG - Intergenic
1103134179 12:118493346-118493368 CATTATTCACAAAAGTCAAATGG + Intergenic
1106265019 13:28101756-28101778 CATTATTCACAGTAGTCAAAAGG + Intergenic
1106565991 13:30885178-30885200 CATTATTCACAGTAGTCAAAGGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1108362121 13:49677400-49677422 GAATGTTCAGAGATGTCACTTGG - Intronic
1111239040 13:85450986-85451008 TATTATTTACAGGAATCACTGGG - Intergenic
1111741370 13:92209549-92209571 GCTTATTAACAGCAGTCATTAGG - Intronic
1112140047 13:96630983-96631005 TATTATACACAGAAATCAATGGG + Intronic
1114164314 14:20203538-20203560 GATGAGTCAGAGAAGTCACAAGG + Intergenic
1114331207 14:21638758-21638780 GTTTATTCTCTGATGTCACTGGG - Intergenic
1114744006 14:25127068-25127090 CATTCTTCACAAAAGTCACAAGG - Intergenic
1115736108 14:36331938-36331960 AATTAATCACAGAGTTCACTAGG + Intergenic
1117553855 14:56864222-56864244 AACATTTCACAGAAGTCACTGGG + Intergenic
1118156404 14:63246557-63246579 GATAATTCACATAAAGCACTTGG + Intronic
1119422872 14:74517933-74517955 GCTAATTCACACAAGTCCCTTGG + Intronic
1120635511 14:86945594-86945616 AATTCTTCAAAGAATTCACTTGG + Intergenic
1120820677 14:88909289-88909311 GGTTATTGACAGAATTCAGTAGG - Intergenic
1129040489 15:72681983-72682005 GATTATAGACGCAAGTCACTGGG + Intronic
1129133209 15:73519691-73519713 GATTATTCACAGTAGGCAAAAGG + Intronic
1133535966 16:6702652-6702674 AATTATTCTCACCAGTCACTGGG - Intronic
1133545620 16:6803491-6803513 GATTATACACAGATTGCACTGGG - Intronic
1134015010 16:10882091-10882113 GATTATTCACAATAGTCAAGAGG - Intronic
1136987775 16:35127183-35127205 GATCATTTACAGAAGTTACATGG + Intergenic
1139038734 16:62978795-62978817 AAATATGCACTGAAGTCACTAGG + Intergenic
1139352114 16:66343284-66343306 GATTATTCACACACACCACTGGG - Intergenic
1140222742 16:73055960-73055982 GTTTATTCAGAGAAATCAATAGG + Intronic
1140745701 16:77978340-77978362 GATTTTTCACAGTAGACAATGGG + Exonic
1141843352 16:86589356-86589378 GATTATTCAGAAAAACCACTTGG + Intergenic
1144381771 17:14705943-14705965 GATAATTCACAGAAGTGATGTGG + Intergenic
1144811889 17:18005833-18005855 GGTGATGCACAGATGTCACTGGG + Intronic
1151872703 17:76847280-76847302 CATTATTCACAGTAGTCAAAAGG + Intergenic
1153737067 18:8082311-8082333 GACTATTCATACAATTCACTGGG - Intronic
1155162388 18:23206362-23206384 AATTATTCACAGTAATCGCTTGG + Intronic
1157758282 18:50238060-50238082 GATTATACACATAAGTTATTAGG - Intronic
1157918038 18:51688764-51688786 GAGTATTCACATAAATCACTTGG + Intergenic
1158022292 18:52857621-52857643 GATTATTCACAGAAGTCACTGGG - Intronic
1158051997 18:53233658-53233680 AATTATTCACAAAGGTAACTCGG - Intronic
1158341219 18:56468710-56468732 AATTATACACAGAAGTGGCTGGG - Intergenic
1158554474 18:58464020-58464042 GACTAATCAGAGAAGTCACCAGG + Intergenic
1161851106 19:6738562-6738584 GACTAGCCACAGAACTCACTGGG + Intronic
1163891077 19:20014367-20014389 CATTATTCACAAAAATCAATAGG + Intronic
1164785663 19:30928375-30928397 TATTATCCACAGGAGTGACTGGG - Intergenic
1164872284 19:31656193-31656215 GATTGTTCACACCAGTCCCTTGG + Intergenic
1165656933 19:37541940-37541962 GTTTATCCTCAGTAGTCACTGGG + Exonic
1167864069 19:52309762-52309784 GATTTCTCACAAAAGTCAGTTGG + Intronic
925620305 2:5785719-5785741 GATTAGGCACAGAAATGACTGGG - Intergenic
926707358 2:15846192-15846214 GAATATTCAGGGAACTCACTGGG - Intergenic
930257809 2:49111726-49111748 GAGTTTTCACAGAAGGCTCTGGG + Intronic
930394913 2:50809655-50809677 GATTATCCACAGAAGTAGTTGGG - Intronic
930920088 2:56742572-56742594 CATTATTAACAGATGTCACCTGG - Intergenic
931010007 2:57899944-57899966 AATTATTCACAGTAATGACTTGG + Intergenic
931549899 2:63431523-63431545 GATTAGTCCAAGAAGTCCCTTGG + Intronic
932558366 2:72845523-72845545 CATTATTCACAATAGTCACTAGG + Intergenic
934466899 2:94271501-94271523 GCTCATTCACAGAAGGCAGTGGG + Intergenic
935198597 2:100836311-100836333 GCTTATTCTGAGAAGGCACTGGG - Intronic
936495251 2:113014869-113014891 GATTATTCACAATATTCAGTAGG - Intergenic
938139862 2:128786670-128786692 CATTATTCACAGAAGCCATGAGG - Intergenic
939449318 2:142352455-142352477 TATTATTCACAGTAGTCAAAAGG + Intergenic
939963103 2:148583626-148583648 TATTATTCATACAAATCACTTGG + Intergenic
940007464 2:149021012-149021034 AAATATTCACAGAACTCATTTGG - Intronic
941413229 2:165186586-165186608 GATAATTCACAGAAGGGACCTGG - Exonic
944291426 2:198010751-198010773 AATTATTCAGAGAAGCCACATGG + Intronic
946849987 2:223896466-223896488 GATTTTTCACATAAATTACTTGG - Intronic
1170608358 20:17890955-17890977 CATTATTCACAATAGTCACAAGG + Intergenic
1170618124 20:17970683-17970705 GATTATTGAAAAAAGTCACCTGG + Intronic
1170818418 20:19734901-19734923 GACTATTCACAGAAATCACCTGG - Intergenic
1173102627 20:40101331-40101353 GATAATTCACATAAAGCACTTGG - Intergenic
1174125592 20:48302729-48302751 CCTTAATCACTGAAGTCACTGGG - Intergenic
1174994943 20:55555827-55555849 GAATAGTCTCACAAGTCACTGGG + Intergenic
1179973556 21:44849879-44849901 GTTTATTCATAAAAGACACTTGG - Exonic
1182641908 22:31774980-31775002 GTTCATTCACAGACGTAACTGGG + Intronic
1182701658 22:32244800-32244822 GATTACAGGCAGAAGTCACTGGG + Intronic
1184372425 22:44090871-44090893 GATTTTTCACAGAAATCCTTGGG - Intronic
952116673 3:30190014-30190036 GATGATTTACAGATGTAACTAGG - Intergenic
953761822 3:45694425-45694447 TATTATTCACAGAAGTCTCCCGG + Intronic
954475497 3:50741206-50741228 GATTATTCACAGTAGCCAAAAGG - Intronic
954887555 3:53889537-53889559 CATTATTCACAGTAGTCAGAAGG - Intronic
956029156 3:65018384-65018406 GATTATTCAGAGAAGTCAGTGGG - Intergenic
957585031 3:82122077-82122099 GATTAACCACTGTAGTCACTAGG - Intergenic
958213068 3:90517203-90517225 AATTATTCACAGAAACTACTTGG - Intergenic
958880267 3:99661685-99661707 GATTATTCACAGTAGCCAAAAGG + Intronic
959246205 3:103872327-103872349 GCTTATACACAAAGGTCACTAGG + Intergenic
964355210 3:155844914-155844936 TATTATTAACAGCATTCACTTGG + Intronic
965921805 3:173926485-173926507 GATTATTCTCAGAATTTAGTGGG - Intronic
966905046 3:184516362-184516384 CATTATTCACAGTAGTCAAAAGG + Intronic
969463362 4:7340515-7340537 GCTGATTCACAGAAGCCACCTGG - Intronic
971803009 4:31317142-31317164 GATTATCCAAATGAGTCACTAGG + Intergenic
972741147 4:41887279-41887301 GATAATTCACATAAAGCACTTGG - Intergenic
977118466 4:93065177-93065199 CATGATTTACAGAACTCACTTGG - Intronic
977596768 4:98891390-98891412 CATTATTCACAAAAGTCAAAAGG + Intronic
978616182 4:110598960-110598982 GATTATGCCCTGAAGTCTCTTGG + Intergenic
980768461 4:137339428-137339450 GATCTTTCACAGAAATCAATAGG - Intergenic
982841457 4:160193023-160193045 GATTTTTCACAAAAATAACTTGG + Intergenic
982861756 4:160460674-160460696 TATTTTTCACAGATGTTACTTGG + Intergenic
983609068 4:169622605-169622627 GATAATTCACAAAAATTACTTGG - Intronic
987858817 5:23457005-23457027 GATTAGTTGCAGAGGTCACTGGG + Intergenic
988745675 5:34134464-34134486 GATCAGTGACAGAAGTGACTTGG - Intergenic
989203992 5:38793501-38793523 GTTTATTGTCTGAAGTCACTAGG + Intergenic
989249706 5:39296660-39296682 CATTATTCACAGTAGCCACATGG + Intronic
990646971 5:57856191-57856213 AATTATTCAATCAAGTCACTGGG + Intergenic
991170779 5:63622839-63622861 CATTATTCACAGTAGCCAATAGG - Intergenic
995767053 5:115629891-115629913 GAGAAGTCACAGAAGTCACAAGG + Intronic
995887642 5:116914144-116914166 CATTTTTCTCAGAAGTCACCTGG - Intergenic
996459157 5:123721397-123721419 GATTATTCAGTCAAGTCCCTAGG - Intergenic
1000388812 5:160701677-160701699 GACTATTCCCAGGAGGCACTGGG - Intronic
1000593129 5:163182676-163182698 CATTATTCACAGGAGATACTTGG - Intergenic
1000907992 5:166986722-166986744 CATAATTTAGAGAAGTCACTGGG + Intergenic
1001492781 5:172167494-172167516 GATAATTGCCAGATGTCACTGGG - Intronic
1003389382 6:5700054-5700076 GACTATTAGCAGAAGTCACCAGG + Intronic
1004306874 6:14509154-14509176 GAATATTCACAAACGTCTCTTGG - Intergenic
1004458865 6:15817108-15817130 GATAAGTCACAGAGGTCACACGG + Intergenic
1005223665 6:23617525-23617547 GAATATTCATAAAAGTCATTAGG - Intergenic
1005543835 6:26842699-26842721 GATCAGTGACAGAAGTGACTTGG - Intergenic
1006345924 6:33482541-33482563 CATTATTCACAGAAGCCAACAGG - Intergenic
1007811708 6:44491002-44491024 TATTATTCAAAGCAGTCACAGGG - Intergenic
1007835301 6:44669346-44669368 GATTACTCACCTAATTCACTGGG + Intergenic
1007874445 6:45079841-45079863 AACTATTCATAGAACTCACTAGG + Intronic
1009014615 6:57884364-57884386 GATCAGTGACAGAAGTGACTTGG - Intergenic
1010456394 6:76060903-76060925 TATTTTTCACAGTAGTCTCTAGG - Intronic
1010903805 6:81460558-81460580 GAATATGCACAGGAATCACTGGG + Intergenic
1011175681 6:84557751-84557773 AAGTATTCACAGTATTCACTTGG + Intergenic
1011748429 6:90431548-90431570 CATTATTCACAAAAGTCAAAAGG - Intergenic
1012846827 6:104400522-104400544 GATTATTTTCAAAATTCACTTGG - Intergenic
1013803666 6:113973185-113973207 GATTATAGACAGAATTCTCTTGG - Intronic
1016775708 6:147902597-147902619 CATTAATCGCAGAAGTAACTAGG - Intergenic
1018836041 6:167484938-167484960 TATTATTTACAGAAGTCATTGGG + Intergenic
1022030915 7:26491204-26491226 GAGCATTCCCAGAAGCCACTCGG - Intergenic
1023207680 7:37768555-37768577 CATTATTCACAGAAATCGTTAGG + Intronic
1023558621 7:41449357-41449379 AATAATTCACAGAAGCCTCTGGG + Intergenic
1024743395 7:52379712-52379734 TATTATTCACAGTAGCCAATAGG + Intergenic
1025140897 7:56462971-56462993 CATTATTCACAAAAGCCAATAGG - Intergenic
1025163638 7:56690291-56690313 CATTATTCACAAAAGCCAATAGG + Intergenic
1025240824 7:57271266-57271288 CATTATTCACAAAAGCCAATAGG - Intergenic
1025576822 7:62655275-62655297 AATCTTTCAGAGAAGTCACTTGG - Intergenic
1025607086 7:63047290-63047312 GTTGATTCAGAGACGTCACTGGG - Intergenic
1025612639 7:63091216-63091238 CATTATTCACAAAAGCCAATAGG + Intergenic
1025706685 7:63872166-63872188 CATTATTCACAAAAGCCAATAGG - Intergenic
1027569250 7:79842985-79843007 GAATATTTGCAGAACTCACTAGG + Intergenic
1033779662 7:144653732-144653754 GATTATTTTCAGAACTCTCTGGG + Intronic
1034610455 7:152363019-152363041 GATTAGTCAGAAAAGTCACATGG - Intronic
1035918211 8:3648710-3648732 GATCATTTACAGAAGTTACATGG + Intronic
1036107262 8:5854440-5854462 GATTATTCCCAGAAGCCAGTGGG + Intergenic
1037326885 8:17701106-17701128 GAATCTCCACACAAGTCACTTGG - Intronic
1038964186 8:32552692-32552714 GATTATTCACAGAATGAAATAGG + Intronic
1039535701 8:38310447-38310469 CATTATTCACAGTAGTCAAAAGG - Intronic
1039893272 8:41698640-41698662 GATAACTCACAGCAGTCACAGGG + Intronic
1041243956 8:55873499-55873521 GATATTTCACAGAAATCAATAGG - Intergenic
1041340772 8:56843352-56843374 GATTGTTCACAGAAGTGAAGAGG - Intergenic
1042657516 8:71116092-71116114 GGTTGTTCACAGAAGTAATTTGG - Intergenic
1042702186 8:71627487-71627509 GAATATCCAAAGAACTCACTGGG - Intergenic
1043758159 8:84030582-84030604 GATTATTTAAATAAGTCACGTGG - Intergenic
1044132499 8:88542544-88542566 GCTTATTCACAGATGTAAGTAGG + Intergenic
1047714181 8:127580464-127580486 CATTATTCACAGCAGTCAAAAGG + Intergenic
1047863691 8:128997404-128997426 GATTCTTCCCATGAGTCACTGGG - Intergenic
1048385066 8:133904510-133904532 GATTGTACAAAGAAGTCATTAGG + Intergenic
1050493737 9:6217228-6217250 TGTTATTTACAGTAGTCACTGGG + Intronic
1051156938 9:14158505-14158527 CTTTATTTACAGAAGTGACTGGG + Intronic
1052000649 9:23275564-23275586 TATTATTCACTGAATTCACTTGG - Intergenic
1056975085 9:91245667-91245689 GATAATGCCCATAAGTCACTTGG - Intronic
1057929566 9:99181828-99181850 AGTTGTACACAGAAGTCACTGGG - Intergenic
1058387597 9:104456981-104457003 GTTTAATCAGAGAAGTCACATGG - Intergenic
1059899731 9:118910373-118910395 TCTTATGCACAGCAGTCACTTGG + Intergenic
1060585851 9:124785317-124785339 CATTATTCACAGTAGCCACAAGG - Intronic
1060738814 9:126084112-126084134 GATTATCCCCAGAAGACACTGGG + Intergenic
1061369091 9:130187839-130187861 AATTGTTCACAGAAGCCACACGG - Intronic
1186706716 X:12147286-12147308 GAATATGGACAGAAGTCACAGGG + Intronic
1187340393 X:18416138-18416160 GATTATTGACAGATGTCAATAGG + Intergenic
1189191185 X:39107621-39107643 CATTATTCACAGCAGTCAAGAGG - Intergenic
1190706907 X:53036604-53036626 TATGATTGACAGAAGTCAGTAGG + Intergenic
1191921030 X:66257163-66257185 GATGATTCACAGACTTCACAAGG + Intronic
1194343716 X:92735154-92735176 CATTATTCACAATAGTCAATAGG + Intergenic
1195130214 X:101843724-101843746 GATTGTTCACAGAATGCATTTGG - Intronic
1195176056 X:102316549-102316571 GATTGTTCACAGAATGCATTTGG + Intronic
1195182808 X:102370544-102370566 GATTGTTCACAGAATGCATTTGG - Intronic
1197478682 X:126954905-126954927 GATCATTCAGAAAAGTCCCTAGG - Intergenic
1200652070 Y:5851817-5851839 CATTATTCACAATAGTCAATAGG + Intergenic
1202081700 Y:21090366-21090388 GATTATTGACATAAGCCAATGGG + Intergenic