ID: 1158023846

View in Genome Browser
Species Human (GRCh38)
Location 18:52872418-52872440
Sequence AGATTTGCACTGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158023846_1158023850 17 Left 1158023846 18:52872418-52872440 CCCAGCTCCATCAGTGCAAATCT 0: 1
1: 0
2: 0
3: 7
4: 184
Right 1158023850 18:52872458-52872480 CTACCCCAGAGACAGTTTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 166
1158023846_1158023851 18 Left 1158023846 18:52872418-52872440 CCCAGCTCCATCAGTGCAAATCT 0: 1
1: 0
2: 0
3: 7
4: 184
Right 1158023851 18:52872459-52872481 TACCCCAGAGACAGTTTTCAGGG 0: 1
1: 0
2: 1
3: 15
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158023846 Original CRISPR AGATTTGCACTGATGGAGCT GGG (reversed) Intronic
900307088 1:2015846-2015868 AGACTTCCATTGATGGAGATCGG + Intergenic
902731215 1:18370104-18370126 AGGCTTGAACTGATGGTGCTTGG - Intronic
903046147 1:20565767-20565789 AGATTTGAAATGATGGAGCCAGG + Intergenic
903578931 1:24356769-24356791 AGAGCTGCAGTGATGGAGTTAGG - Intronic
903834372 1:26193338-26193360 AGGTTAGGACAGATGGAGCTTGG + Intronic
905106611 1:35566819-35566841 AGCTGTGAACTGATGGAGCCTGG - Intronic
905151533 1:35931414-35931436 CGATTTCCATTCATGGAGCTGGG - Exonic
907993073 1:59601488-59601510 AGATCAGAAATGATGGAGCTGGG - Intronic
908866163 1:68550870-68550892 AGAGCTGAACTGAAGGAGCTAGG + Intergenic
909474400 1:76065777-76065799 AGATTAGAACTATTGGAGCTCGG + Intergenic
911597933 1:99817556-99817578 AGATTTGGAGTTAGGGAGCTTGG + Intergenic
913211456 1:116585920-116585942 AGATTGCTACTGATGGAACTGGG + Intronic
916502770 1:165400908-165400930 AAATTGGCACTGCTGGAGCATGG - Exonic
916789737 1:168114937-168114959 AGAGTCTCACTGATGGGGCTAGG + Intronic
919579348 1:199352122-199352144 AGACTTGCACAGAGGGAGGTGGG - Intergenic
924205810 1:241710508-241710530 AGAGTTTCACTGGTGGAGATGGG + Intronic
924268887 1:242311507-242311529 AGCTTTGCACTAATGGGCCTGGG + Intronic
1064175414 10:13071144-13071166 AGATTTGGACGCATGGGGCTTGG - Intronic
1066716025 10:38287258-38287280 AGCTTTGCACTAATGGGCCTGGG - Intergenic
1068274660 10:54778183-54778205 GTATTTGCACTGATCGAGATGGG + Intronic
1068521703 10:58084258-58084280 AGATTTGCCCTGTAGGAACTGGG + Intergenic
1069902989 10:71716526-71716548 AGCTGAGCAGTGATGGAGCTGGG + Intronic
1070245988 10:74731489-74731511 TGATTTCCACTGTTGGAGGTGGG + Intergenic
1070590403 10:77796706-77796728 AGATTTTCAGTGCTGAAGCTGGG - Intronic
1072481910 10:95817296-95817318 AGCTCTGCTCTGATGGAGCCAGG + Intronic
1072742057 10:97915448-97915470 AGATGTGCACTCAGGGAGCTGGG - Intronic
1073320301 10:102612274-102612296 AGATTTGCAGTCCTGGAGCTTGG - Intronic
1073326960 10:102648709-102648731 AGGTTTGCACTGCTGGAGTCAGG - Intronic
1074871990 10:117584246-117584268 AGCTTTGAAGTGATGGAGCCGGG + Intergenic
1075435382 10:122436535-122436557 AGCTTTGACCTGATGGAGTTGGG + Exonic
1075564631 10:123494529-123494551 AGATTGCTAATGATGGAGCTGGG - Intergenic
1077442337 11:2574578-2574600 AGATATGCTCTGATGGTGGTGGG - Intronic
1078725285 11:13924611-13924633 AAATTTGGATTGATGGAGATAGG - Intergenic
1080837203 11:35950204-35950226 GGAGTTGTACTGATGGATCTTGG + Intronic
1085183814 11:74558707-74558729 AGAATTGCACTGAGGGCACTGGG - Intronic
1087581435 11:100060498-100060520 AGATTTGCAGTGTTGGAGGCAGG + Intronic
1088117541 11:106329561-106329583 AAATTTTCACTAATTGAGCTGGG + Intergenic
1089700189 11:120240027-120240049 TGATTTGCATACATGGAGCTGGG - Intronic
1091823822 12:3494583-3494605 AGAGATGCAGTGATGGAGGTGGG + Intronic
1097279152 12:57833790-57833812 AGGTGAGCACTGAGGGAGCTGGG + Intronic
1099366632 12:81772984-81773006 AGATTTGGATAGAGGGAGCTTGG + Intergenic
1103924757 12:124417406-124417428 ACATTTGCACAGAGGGAGGTGGG - Intronic
1104569729 12:129914681-129914703 AGCTTTGCACTGAGTGGGCTGGG - Intergenic
1106615949 13:31327935-31327957 ATATTTGTACTGGTGAAGCTAGG + Intronic
1106898002 13:34325942-34325964 AGATTTGCACTTAAGTGGCTGGG - Intergenic
1109561004 13:64050056-64050078 AAATCTGCATTGATGCAGCTAGG - Intergenic
1111466848 13:88624345-88624367 AGAATTGCAGTTATGCAGCTTGG + Intergenic
1114035093 14:18616978-18617000 AGATCTTCACTGATATAGCTTGG - Intergenic
1114123552 14:19698038-19698060 AGATCTTCACTGATATAGCTTGG + Intergenic
1115746275 14:36441006-36441028 ATATTTGCAATGATGGAGGGTGG - Intergenic
1116400201 14:44497233-44497255 TGATCTGCACTGCTGGGGCTGGG - Intergenic
1118179392 14:63476542-63476564 ATATTTGAACTGATTGAGCAGGG - Intronic
1120901615 14:89580581-89580603 AGAATTACACAGATGGAGGTTGG - Intronic
1122374082 14:101247157-101247179 AGGTTTGCAGTGAGAGAGCTGGG - Intergenic
1124712733 15:32029485-32029507 GGAGTTGCTCTGGTGGAGCTCGG + Intergenic
1125085063 15:35720405-35720427 AAATTCACACTGATAGAGCTGGG + Intergenic
1130554125 15:84910921-84910943 AGATTTGGACAGACTGAGCTAGG + Intronic
1131088039 15:89594486-89594508 AGATTTTCTCTGGTAGAGCTCGG - Exonic
1132394276 15:101460379-101460401 AGATTTGGCTTGATGGAGGTAGG - Intronic
1133168948 16:3968659-3968681 AGATTCCCCCTGATGGAACTGGG + Intronic
1134649816 16:15899507-15899529 AGACTTGCAGTGGTGGAGCTGGG - Intergenic
1137963180 16:52906248-52906270 AGTTTTGGAATGATAGAGCTGGG - Intergenic
1138397392 16:56715898-56715920 AGCTTTGCACTGGTGGGGCAAGG + Intronic
1141207401 16:81943495-81943517 TGATCTCCACTGTTGGAGCTGGG - Intronic
1144500677 17:15784425-15784447 AGACCTGGACTGATGGAACTTGG - Intergenic
1145021312 17:19433600-19433622 AAATCTGCACTGATGAAGCCAGG - Intergenic
1145374439 17:22334383-22334405 AGATTTGCAAAGATGGAGCCTGG - Intergenic
1146075997 17:29729835-29729857 ACAATTGAACTTATGGAGCTAGG + Intronic
1146343999 17:32044991-32045013 AGATTATCACTGATGGAGTTGGG - Intronic
1146453259 17:32991187-32991209 AGATATGCAGTGATGGTGGTAGG - Intronic
1146625182 17:34430015-34430037 AGAGTTGCTCTGATGGAGAATGG + Intergenic
1147641290 17:42002255-42002277 AGATCTTCTCTGATGGAGTTTGG - Intronic
1148351006 17:46942326-46942348 AGATTGGCAGGGATGGAGCCAGG - Intronic
1149524971 17:57348414-57348436 TGATTTGCAATGTTGGAGGTAGG + Intronic
1152490159 17:80625886-80625908 AGATTTGCACAGCTGGAGACGGG - Intronic
1155640861 18:28012610-28012632 ATATTTGCACTGAAGCAGCAAGG - Intronic
1155910625 18:31500524-31500546 AGATATGGACGTATGGAGCTGGG - Intronic
1157172736 18:45422910-45422932 AAATTAGCACTGAGGGAGCCGGG - Intronic
1158023846 18:52872418-52872440 AGATTTGCACTGATGGAGCTGGG - Intronic
1166085343 19:40470924-40470946 ATATTTGCATTAATGGGGCTGGG - Intronic
1166200675 19:41235694-41235716 AGTTTGTCACTGATGAAGCTGGG - Intronic
925262170 2:2538334-2538356 AGAATTCTACTGTTGGAGCTGGG + Intergenic
925698353 2:6606705-6606727 AGATTTGCACTGACCCAGATTGG - Intergenic
926830445 2:16956630-16956652 AGCTTTGAAGTGATGAAGCTGGG - Intergenic
930026330 2:47031377-47031399 AGAGGTGCGCAGATGGAGCTGGG - Intronic
930499865 2:52200665-52200687 TGATTTCCACTGTTAGAGCTGGG - Intergenic
932169682 2:69542547-69542569 AGTTTTGCACTGATGCAGGCGGG + Exonic
932398589 2:71464704-71464726 AGTTTTGCACTGAGTGAGATGGG + Intronic
933198274 2:79417913-79417935 AGAGTTTCATTGATGGAGGTTGG + Intronic
934959867 2:98662748-98662770 AGATTTGCACTGATGATCTTTGG - Intronic
935062242 2:99618854-99618876 AGCTTTGCACTGAAGCAGCCAGG - Intronic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
941438673 2:165506223-165506245 AGATCTAAACTGTTGGAGCTAGG - Intronic
941670703 2:168289358-168289380 TGATATTCACTGATGTAGCTGGG - Intergenic
944430106 2:199623991-199624013 AGCTGAGCATTGATGGAGCTTGG + Intergenic
947074492 2:226327596-226327618 AGATTTGCATTGATTGCTCTAGG - Intergenic
1171528357 20:25834019-25834041 AGTTTTGCAAAGATGGAGCCTGG + Intronic
1171548469 20:26021859-26021881 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1172867138 20:38108967-38108989 AGTTCTGCAGTGATGGAGTTGGG - Intronic
1176349162 21:5777068-5777090 AGACCTGAACTGATGGAGATAGG + Intergenic
1176355976 21:5897652-5897674 AGACCTGAACTGATGGAGATAGG + Intergenic
1176543483 21:8175138-8175160 AGACCTGAACTGATGGAGATAGG + Intergenic
1176562434 21:8358183-8358205 AGACCTGAACTGATGGAGATAGG + Intergenic
1178896880 21:36566410-36566432 AGATTTGCATTCATAGGGCTGGG - Intronic
1179204463 21:39261532-39261554 ACATTTGTACTGATGGATCATGG - Intronic
1179607471 21:42526545-42526567 AGAATTGCAGTCCTGGAGCTGGG - Intronic
1180459214 22:15544024-15544046 AGATCTTCACTGATATAGCTTGG - Intergenic
1182032460 22:27170234-27170256 AGTTTGGAAGTGATGGAGCTGGG + Intergenic
1184092166 22:42298596-42298618 ATCTTTGCACGGATGGTGCTGGG + Intronic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
951255873 3:20448460-20448482 AGATTTGGGCTCATGGGGCTTGG + Intergenic
951437971 3:22687265-22687287 AGAATTGAACTAATGGAGATAGG + Intergenic
952621521 3:35349075-35349097 AGATATGCCCGGATGGACCTGGG - Intergenic
954458650 3:50613387-50613409 AGAGTTGCACTCATGAAGCCCGG - Intronic
955052848 3:55429457-55429479 AGATTTGCAGGGAGGGAGTTTGG + Intergenic
955500033 3:59574400-59574422 AGCTTGCCACTGGTGGAGCTGGG - Intergenic
958498697 3:94877814-94877836 AAATTTGCCTTGATGCAGCTTGG + Intergenic
958717584 3:97804189-97804211 AAATCTGCACTGATGCAGCCAGG + Intergenic
959356304 3:105333960-105333982 AGATTGGAACAGAGGGAGCTAGG + Intergenic
960343981 3:116509796-116509818 ATATAGCCACTGATGGAGCTTGG + Intronic
961969463 3:130945126-130945148 TGAGAGGCACTGATGGAGCTAGG + Intronic
967248177 3:187509768-187509790 CAATCTGCACTGATGCAGCTGGG - Intergenic
967289629 3:187906307-187906329 AGTTCTACAGTGATGGAGCTTGG - Intergenic
967887577 3:194343626-194343648 AGATTTGAACTCATGGAATTAGG - Intronic
970021178 4:11570490-11570512 AGCTGTGTAGTGATGGAGCTAGG - Intergenic
971176862 4:24290382-24290404 GGATATTCACTGATGAAGCTGGG - Intergenic
971227099 4:24764534-24764556 TGATTTGTACTGATTGTGCTAGG + Intergenic
972659000 4:41095638-41095660 AGCTGTGCACTCATGGGGCTTGG - Intronic
972789339 4:42355958-42355980 AGGTTTCCCCTGATGAAGCTGGG - Intergenic
975692026 4:76974727-76974749 AGAATCTCACTGTTGGAGCTGGG + Intronic
977071322 4:92392089-92392111 AGATTTACATTGATTGACCTAGG + Intronic
978533945 4:109741263-109741285 AGAGTTGCAGAGATGCAGCTTGG + Intronic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
984369786 4:178848113-178848135 AGATTTGGACTGAGGAAGCATGG + Intergenic
985656474 5:1134129-1134151 AGAATTGCAGAGCTGGAGCTGGG - Intergenic
987395583 5:17420008-17420030 AGGCTGGCACTGATGGACCTAGG - Intergenic
987715317 5:21561451-21561473 AGATTTTCACTCATGGGCCTCGG + Intergenic
988415746 5:30944945-30944967 AGCTTTGCAGTGATGGTTCTAGG - Intergenic
990451905 5:55941510-55941532 AGACTTGGACTGACGGAACTTGG + Exonic
991931470 5:71757000-71757022 ACAATTGTACTCATGGAGCTAGG + Intergenic
992371761 5:76151167-76151189 GGACTTGCAGAGATGGAGCTGGG + Intronic
994184481 5:96803173-96803195 ATATTTACTCTGATAGAGCTGGG + Intronic
994431217 5:99663695-99663717 AGAATTCCTCTGATGGAACTGGG - Intergenic
996984168 5:129537997-129538019 AGATTTGCATGGATGGAGAGGGG + Intronic
998879688 5:146633518-146633540 AGATGTGCACTGAAGAAGGTTGG + Intronic
999642127 5:153682426-153682448 AGAATTGCACAGATGGGCCTAGG - Intronic
999702044 5:154237033-154237055 AGATTGGCAAAGATAGAGCTAGG + Intronic
1007040054 6:38713729-38713751 CTTTTGGCACTGATGGAGCTGGG - Intergenic
1007976140 6:46103403-46103425 CAATCTGCACTGATGCAGCTAGG + Intergenic
1009405725 6:63310087-63310109 AGTTTTGTACAGATGGAGATAGG - Intronic
1011737893 6:90331075-90331097 GGAATTGCACTGATGTGGCTTGG - Intergenic
1011978599 6:93341031-93341053 AAATTTGGACTGATGGTACTAGG - Intronic
1013078681 6:106793361-106793383 AGTTTTGCCATGAGGGAGCTGGG - Intergenic
1015826838 6:137322638-137322660 ACATTTGCAGTCATGGAGTTAGG + Intergenic
1016688781 6:146911800-146911822 AGATTTCTACTGAGGAAGCTTGG - Intergenic
1018507939 6:164491497-164491519 AGATTTGGGCCCATGGAGCTAGG + Intergenic
1019420448 7:948247-948269 GGCATTGCACTGATGGACCTGGG - Intronic
1019659762 7:2217620-2217642 ACAGTTGCACAGCTGGAGCTGGG - Intronic
1023483272 7:40657915-40657937 AGCTCTTCAGTGATGGAGCTGGG + Intronic
1025147121 7:56514450-56514472 ATATATGCACTGAGGGAACTGGG - Intergenic
1026415432 7:70175009-70175031 TGATTTCCTCTGATGGATCTGGG + Intronic
1030300682 7:107971411-107971433 AGATGTGCACAGATGCCGCTTGG - Intronic
1031323653 7:120364870-120364892 AGAATTGCACAGATGGGCCTAGG + Intronic
1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG + Intergenic
1035484932 7:159215501-159215523 AGATTTGAAATGATGGAACGTGG - Intergenic
1037632698 8:20672604-20672626 AGATTTTAACTGATAGAGCTGGG - Intergenic
1038914339 8:32003748-32003770 AAATTTGCAATAATGTAGCTAGG - Intronic
1040763086 8:50874305-50874327 ATTTTTCCACTGCTGGAGCTGGG + Intergenic
1041173329 8:55167790-55167812 AGAGGTGCAATGATTGAGCTTGG + Intronic
1041804852 8:61838855-61838877 AGATCTGCATTGATGCAGCCTGG - Intergenic
1041991169 8:63993499-63993521 AGAGCTGCACTGATGAAGCAGGG - Intergenic
1045801897 8:106111449-106111471 AGTTTTGCACTGCTGGATATTGG + Intergenic
1045891437 8:107162771-107162793 AGAGTTTCACCGATTGAGCTTGG + Intergenic
1047889703 8:129294093-129294115 AGATTTGCAGTGAAGATGCTAGG + Intergenic
1051009951 9:12399466-12399488 ATAATTCCACTGATGGATCTGGG + Intergenic
1051038841 9:12781446-12781468 ACAGTTGAACTCATGGAGCTAGG - Intronic
1052304676 9:26993758-26993780 AAATATGAGCTGATGGAGCTGGG - Exonic
1053366792 9:37528494-37528516 AGACTTGGACTCATGGAGATAGG - Intronic
1054148858 9:61584710-61584732 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1054184729 9:61942222-61942244 AGTTTTGCAAAGATGGAGCCTGG + Intergenic
1054468621 9:65515819-65515841 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1054653778 9:67646275-67646297 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1055080143 9:72260821-72260843 AGAATTGCACTGGTCTAGCTCGG - Intergenic
1056505727 9:87256558-87256580 AGATATTAACTGATGGAGCCAGG - Intergenic
1060896062 9:127218371-127218393 TGATTTTCACTGAAGGAGATAGG + Intronic
1061423600 9:130485481-130485503 ACATTTGCAGGGCTGGAGCTGGG - Intronic
1186830295 X:13383469-13383491 AAATCTGCACTGATGCAGCCAGG - Intergenic
1189683815 X:43543262-43543284 AAATCTGCATTGATGCAGCTAGG + Intergenic
1191686118 X:63892558-63892580 ATGTTTGCACTGATGGGGGTAGG - Intergenic
1195320559 X:103718465-103718487 AGATTTGTGCTGATGGGACTGGG - Intronic
1199589087 X:149449462-149449484 AGAGTTGAACTGAAGGAGATAGG - Intergenic
1200406816 Y:2820331-2820353 AGAATTGAACTCATGGAGATGGG - Intergenic