ID: 1158025191

View in Genome Browser
Species Human (GRCh38)
Location 18:52887432-52887454
Sequence CAAAAGGTAGTTCCAGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158025189_1158025191 -2 Left 1158025189 18:52887411-52887433 CCATCTGTGTCATCTTAGCTGCA 0: 1
1: 0
2: 2
3: 21
4: 229
Right 1158025191 18:52887432-52887454 CAAAAGGTAGTTCCAGCAAAAGG 0: 1
1: 0
2: 0
3: 13
4: 207
1158025188_1158025191 23 Left 1158025188 18:52887386-52887408 CCTAATGCTTTATATTAGGTTTA 0: 1
1: 0
2: 0
3: 17
4: 268
Right 1158025191 18:52887432-52887454 CAAAAGGTAGTTCCAGCAAAAGG 0: 1
1: 0
2: 0
3: 13
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158025191 Original CRISPR CAAAAGGTAGTTCCAGCAAA AGG Intronic
902734337 1:18390350-18390372 CAGAATGTAATTCCAGAAAAAGG - Intergenic
903546764 1:24129056-24129078 CAAAACACAGTTCCAGCAGAAGG - Intronic
903862194 1:26371297-26371319 CAAAAGATAATTCAAGCACATGG + Intronic
906795277 1:48691907-48691929 GAGAAGGTAGGTCCAGTAAAAGG - Intronic
907838684 1:58135644-58135666 CAAAAGGCACCTACAGCAAAAGG - Intronic
909981185 1:82103398-82103420 GAAAAGGTATTTCATGCAAATGG - Intergenic
910323677 1:85978523-85978545 AAAAAGGTATTTCATGCAAATGG + Intronic
912890270 1:113522722-113522744 AAAAAATTAGTTCAAGCAAAGGG - Intronic
917668525 1:177249246-177249268 CAATATGTATTTCCAGGAAAGGG - Intronic
917853736 1:179085594-179085616 AAAGAGGTAGTCACAGCAAAAGG - Intronic
918295889 1:183156608-183156630 AAAAAGATACTCCCAGCAAAAGG - Intergenic
919087486 1:192937809-192937831 CAAAAGGCTGTAACAGCAAATGG + Intergenic
919598636 1:199595232-199595254 AAAAAGGTATTTCATGCAAATGG + Intergenic
919910870 1:202109960-202109982 TATAGGGTAGTTTCAGCAAAGGG + Intergenic
920119905 1:203648655-203648677 CAAAAGGTGGTACCAGCTCATGG - Intronic
922037672 1:221865413-221865435 CAAAAGGAAGAGCCAGCAGATGG + Intergenic
922226989 1:223654121-223654143 CAAGAGGTAGTTCCAGCATTTGG + Intronic
923996480 1:239500928-239500950 CAAAAGGCATTTCATGCAAATGG + Intronic
924375137 1:243399809-243399831 CCAGAGGTAGTTCCAAGAAACGG - Intronic
924532365 1:244904220-244904242 CAAAAGGTAGTTTGAGAAGAGGG + Intergenic
1068012723 10:51474523-51474545 CAAAAAGTAGATCCTGCAATAGG - Intronic
1068393134 10:56425056-56425078 TAAAAGGTTGTACCAGTAAAGGG - Intergenic
1069325487 10:67227038-67227060 AAAAAGGTATTTCATGCAAATGG + Intronic
1071011812 10:80949121-80949143 CAAAAGGTATTTCGAGAAAGGGG + Intergenic
1074364687 10:112848489-112848511 CAAGAGAGACTTCCAGCAAATGG + Intergenic
1075416430 10:122267860-122267882 CATAAGGTATTTCCAGCTAAGGG + Intergenic
1078562607 11:12386352-12386374 GAAAAGGTATTTCCAGAATATGG - Intronic
1079172617 11:18110729-18110751 CAATTGCTAGTTACAGCAAATGG + Intergenic
1079585797 11:22125974-22125996 TAAAAGGTATTTCATGCAAATGG + Intergenic
1079913038 11:26334199-26334221 CAAAAGGCAACTTCAGCAAAAGG + Intronic
1080203149 11:29697612-29697634 AAAAAGGTAGTCCATGCAAATGG - Intergenic
1081467071 11:43330637-43330659 CATAAGATACTTCCAACAAAGGG + Intronic
1082689391 11:56281326-56281348 AAAAAGGATGTTCCAGCATAAGG + Intergenic
1085430174 11:76441305-76441327 AAAAAAGTAAATCCAGCAAAGGG + Intergenic
1086090026 11:82996295-82996317 CAACAGGCAGTCCCAGGAAAGGG + Intronic
1089408801 11:118221057-118221079 CAAAAGGTATTTCCAGAAAGGGG - Intronic
1089439956 11:118506812-118506834 CAAAATGTAGTTCCATCCATGGG + Intronic
1089977874 11:122748070-122748092 CAAAAGGAGGATCCTGCAAAAGG + Intronic
1092033562 12:5310509-5310531 CAGTAGGTAGTTCCCGGAAAAGG - Intergenic
1092641059 12:10510271-10510293 CTAAAGGTACCTCCACCAAATGG + Intronic
1092724354 12:11470404-11470426 CAAATGGTAGATCGAGCTAATGG - Intronic
1093078156 12:14778371-14778393 CAAAAGGTAACTCCTGCAACTGG + Intergenic
1093147219 12:15581223-15581245 CTAAAGGCAGTTTCAGCAACCGG + Intronic
1093409015 12:18843077-18843099 AAAAAGGTATTTCATGCAAATGG - Intergenic
1093646833 12:21595616-21595638 AAAAAGGTATTTCATGCAAATGG + Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1098546041 12:71711921-71711943 AAAAAGGGAGTACCAGCAAAAGG + Intergenic
1098983172 12:76982000-76982022 TAAAAGATATTTCAAGCAAATGG - Intergenic
1099105952 12:78496645-78496667 CAAAAGATATTACCAGGAAATGG - Intergenic
1100175064 12:92020997-92021019 CATAATGCAGTTCCAGAAAATGG + Intronic
1100293791 12:93241885-93241907 CAACAGGAAGTACCAGCAGACGG + Intergenic
1101521028 12:105482522-105482544 CAAAAGGTAATTCGTTCAAATGG + Intergenic
1102254694 12:111408726-111408748 CCAAAGGTGTTTCCAGCAAAAGG - Intronic
1103758539 12:123231462-123231484 CAAAATGTACTTCCAGACAATGG - Intronic
1104416723 12:128601778-128601800 CAAAAGTTATTTCCATTAAAAGG - Intronic
1105580698 13:21693217-21693239 CAAAAGGTGGTGTCAGCATAAGG + Intronic
1107984595 13:45764633-45764655 GGAAAGAGAGTTCCAGCAAAGGG + Intergenic
1109620798 13:64902114-64902136 CTAAAGGTAGTTAGAGGAAAAGG + Intergenic
1109862620 13:68220287-68220309 GAAAAGTAAGTTCCAGCAAATGG + Intergenic
1113452736 13:110423217-110423239 CAATAGTTAGTTCCAGCCATAGG + Intronic
1114044964 14:18866854-18866876 AAAAAGGTAGTACCAGTCAAAGG - Intergenic
1114119258 14:19652668-19652690 AAAAAGGTAGTACCAGTCAAAGG + Intergenic
1115338367 14:32265358-32265380 AAAAATGTAGTTCATGCAAATGG + Intergenic
1116719436 14:48475862-48475884 TAAAAGGTAGATTCAGTAAAAGG - Intergenic
1116990491 14:51270940-51270962 CAAAAGCTAGCTCCCACAAAAGG + Intergenic
1117575516 14:57093271-57093293 CACAAGGAGGATCCAGCAAAGGG + Intergenic
1118093378 14:62508435-62508457 CATGAGGCAATTCCAGCAAAGGG + Intergenic
1119157448 14:72424065-72424087 CATGAGGTGGTTCCAGTAAATGG + Intronic
1120545567 14:85807482-85807504 AAAAAGGTATTTCATGCAAATGG - Intergenic
1121567276 14:94919422-94919444 CAAAAGGTAGTCTCTTCAAATGG + Intergenic
1122773162 14:104106085-104106107 CAAGTGGCAGTTCCAGCACATGG - Intronic
1133903722 16:10001503-10001525 CATAAGATAGTTTCAGCAGAGGG - Intronic
1134291173 16:12903446-12903468 CACCAGCTAGTTCCAGCAGATGG + Intronic
1135279824 16:21144773-21144795 CCAAAGTTAGCTTCAGCAAAAGG + Intronic
1135690926 16:24537055-24537077 CAAAATTCAGTTCCAGCAAGCGG - Intergenic
1136294263 16:29292736-29292758 CAAAAGGCAGTTTCAGCAGCTGG + Intergenic
1137475367 16:48803518-48803540 CAATTGGTAGTTCCAGCTACAGG - Intergenic
1142100168 16:88266782-88266804 CAAAAGGCAGTTTCAGCAGCTGG + Intergenic
1143068548 17:4269446-4269468 AAAAAGGTAATTCCACCAACTGG + Exonic
1144177695 17:12723003-12723025 TAAAAGGTAGTTAGAACAAATGG + Exonic
1145925515 17:28644270-28644292 CAAAAGGTCGTTCCTGAAACTGG + Intronic
1147019386 17:37519274-37519296 CTAAACCTAGTTTCAGCAAAAGG + Intronic
1148883126 17:50747888-50747910 CAAAAGGCAGTTGCTACAAAGGG + Intronic
1150984611 17:70181735-70181757 CAAAAGACAGTCCAAGCAAAAGG - Intergenic
1151219588 17:72602613-72602635 CAAATGGCAGTGTCAGCAAAGGG + Intergenic
1155863881 18:30940056-30940078 AAAAAGATATTTCCTGCAAATGG - Intergenic
1157907648 18:51583939-51583961 GAAAAGGTAGTGTTAGCAAATGG - Intergenic
1158025191 18:52887432-52887454 CAAAAGGTAGTTCCAGCAAAAGG + Intronic
1158800498 18:60902491-60902513 CAAAAGGTAGCTTCAACATATGG + Intergenic
1159577884 18:70201915-70201937 CAAAAGTAATTTCCAGCAGATGG - Exonic
1159675802 18:71283257-71283279 CAAAATGAAGTTCAAGGAAAAGG + Intergenic
1161502362 19:4623365-4623387 AAACAGGCAGTTCCAGCACAGGG - Intergenic
1166754336 19:45181066-45181088 CAAAAAGTAGAACCAGCACACGG - Exonic
925101084 2:1246258-1246280 CAAACGGTATTTCTAGCAATGGG - Intronic
925722741 2:6844320-6844342 CAAAAGGAAGTTGCAGAAACTGG - Intronic
926357354 2:12053490-12053512 CACAAGTTTGTTCCAACAAAAGG - Intergenic
926560382 2:14410327-14410349 GAAAAGGCAGTTCATGCAAATGG + Intergenic
928523955 2:32120600-32120622 AAGAAGGTGGTTCCAGGAAAAGG - Intronic
928781384 2:34825714-34825736 CAAAAAGTAGTTCCAGCCTTTGG - Intergenic
931147899 2:59540021-59540043 CAAAAGATAATTCCAGGAAGAGG - Intergenic
933436777 2:82259514-82259536 CAAAAGGTATTTCCACAAAGGGG + Intergenic
936164652 2:110109353-110109375 AAAAAGGTACTTCATGCAAATGG + Intronic
938985199 2:136568619-136568641 CATAAGGTATTTCAAGCAAAGGG - Intergenic
939657369 2:144844970-144844992 GAAAAAGTTGTTCCAGCCAATGG + Intergenic
941763066 2:169265816-169265838 CAAACAGAAGTTCCAGCACAGGG + Intronic
943717317 2:191166526-191166548 CAATTGGTCTTTCCAGCAAAGGG + Intergenic
943996560 2:194774139-194774161 CAAAAGGTAGTTACATGAAAAGG - Intergenic
944668272 2:201974357-201974379 CAAAAGGAAGCTCCAGCTACAGG - Intergenic
945041752 2:205748498-205748520 CAAAAGGCAGACACAGCAAAGGG + Intronic
946840983 2:223819345-223819367 GAAAGGTTATTTCCAGCAAAAGG - Intronic
948567277 2:238895229-238895251 CAAAAGGTATTTCCAGCCCAGGG + Intronic
1169314471 20:4577109-4577131 CAGAAGGTATTTCAAGGAAAAGG - Intergenic
1169397936 20:5251750-5251772 CAAAAGATAGTTCAGTCAAATGG - Intergenic
1169677716 20:8173115-8173137 CACCAGGTTGTACCAGCAAAAGG + Intronic
1171102091 20:22393975-22393997 CAAAAGGTAACTCTAGCGAATGG + Intergenic
1173417927 20:42874651-42874673 CAAAAGTGAGTTACAGTAAATGG - Intronic
1173433159 20:43009471-43009493 AAAAAGGAGGTTCCAGGAAAGGG + Intronic
1174199592 20:48798068-48798090 CAAAAGTGAGTTCATGCAAAAGG - Intronic
1174722634 20:52829793-52829815 CAATAGGTAGCACAAGCAAATGG + Intergenic
1179313148 21:40214650-40214672 AAAAAGAGATTTCCAGCAAATGG + Intronic
1179474867 21:41636640-41636662 TGAGAGGGAGTTCCAGCAAAGGG + Intergenic
1180463487 22:15589414-15589436 AAAAAGGTAGTACCAGTCAAAGG - Intergenic
1181017172 22:20077781-20077803 AAAAAGTTAGTTCCAGTAAGAGG - Intergenic
949776789 3:7642226-7642248 CAAAATGTAGTCCCAGGACAAGG - Intronic
950950416 3:16992698-16992720 CAGAAGGAAATTCCAGCCAAGGG + Intronic
950950670 3:16995099-16995121 CAGAAGGAAATTCCAGCCAAGGG + Intronic
950969179 3:17169381-17169403 CAAAAAGTATTTCCAGTAAGGGG + Intronic
957029049 3:75218862-75218884 CACATGGTAATTCCAGCATATGG + Intergenic
958148938 3:89664455-89664477 CAAGAGTCATTTCCAGCAAAAGG - Intergenic
964306742 3:155348898-155348920 CAAAAGATATTTCATGCAAATGG - Intergenic
965384247 3:168026833-168026855 GAAAAGCTGTTTCCAGCAAAAGG + Intronic
967365637 3:188683372-188683394 TAAAAGATAATTCCAGTAAAAGG - Intronic
971439281 4:26662485-26662507 CCAAAAGGAGTTCCAGAAAAGGG + Intronic
971834008 4:31737896-31737918 CAAACGGGAGCTTCAGCAAAAGG - Intergenic
972912894 4:43840560-43840582 CAAAAGGAAGTTCCAGCTGTAGG - Intergenic
974316584 4:60290126-60290148 CAAAAGTTATTGCCAGTAAAAGG - Intergenic
974462123 4:62202009-62202031 CAAAATGTACTTCAAACAAAAGG + Intergenic
975085699 4:70336111-70336133 ACAGAGGTAGTTCCAGAAAATGG - Exonic
975262984 4:72326878-72326900 TAAAAGCTATTTCCAGCAGATGG + Intronic
975295400 4:72728776-72728798 CAAAAGATATTTCATGCAAATGG + Intergenic
975414665 4:74092868-74092890 CATAAATTAGTCCCAGCAAAAGG - Intergenic
976856679 4:89612079-89612101 AAAAAGGTATTTCATGCAAATGG + Intergenic
977871969 4:102102390-102102412 AAGAATGAAGTTCCAGCAAAAGG + Intergenic
978288285 4:107105345-107105367 CTGAAGGTAGTTCCTGAAAAAGG - Intronic
979966246 4:127079427-127079449 CAACAGGAAGTACCAGCAAATGG + Intergenic
981947252 4:150362315-150362337 CCAAAGGTAGTCCCAGTGAAAGG - Intronic
986816005 5:11412239-11412261 CAAAAGGGATATACAGCAAATGG - Intronic
987240303 5:15990959-15990981 AAAAAGGTATTTCATGCAAATGG - Intergenic
987641685 5:20620404-20620426 CAAAGAGTAGTTCAAGTAAATGG - Intergenic
988007408 5:25434626-25434648 AAAAAGTAAGTTCCAGCTAATGG + Intergenic
988401301 5:30763751-30763773 CAAAAGGCACTTTCAGCATATGG - Intergenic
988682103 5:33493598-33493620 CAACAGGTAGTTTCAGCAGCTGG - Intergenic
989291236 5:39768756-39768778 CAAAAGGTAGATAGACCAAATGG + Intergenic
989404541 5:41045296-41045318 CAAAAGCCAGTTCTAGGAAAGGG - Intronic
992955965 5:81908341-81908363 TAAAAGGTAGGTCCATCCAATGG - Intergenic
994528602 5:100936403-100936425 CAAAAGCTAACTTCAGCAAAAGG + Intergenic
999035429 5:148343566-148343588 CAGATGGTAGTTCAAGCAATTGG - Intergenic
1000046203 5:157523943-157523965 CTGAAGGTCGTTCCAGCAATAGG + Intronic
1001653448 5:173330744-173330766 CAAAAGGTAGGCCTAGCCAAAGG - Intergenic
1001663101 5:173411242-173411264 GAAGATGCAGTTCCAGCAAAAGG - Intergenic
1003451087 6:6232253-6232275 AAAAAGGTATTTCATGCAAATGG + Intronic
1004429882 6:15533634-15533656 GGGAAGGTCGTTCCAGCAAAGGG - Intronic
1004968657 6:20883393-20883415 CACAAGGTAGGTGCAGCAGAGGG - Intronic
1005205920 6:23404680-23404702 CAAAAGTTATTTCATGCAAATGG - Intergenic
1005762248 6:28977864-28977886 AAAAAGGAAGATCGAGCAAAGGG - Intergenic
1007439576 6:41846668-41846690 CAAAAGGAGATTACAGCAAAAGG + Intronic
1007982952 6:46177838-46177860 CAACTGGTAGTTCCTGCCAAAGG - Intergenic
1008302622 6:49859914-49859936 CAAAAGATACTTCATGCAAATGG + Intronic
1008647252 6:53527333-53527355 CAACAGTTGGTTCTAGCAAAAGG - Intronic
1010106540 6:72175976-72175998 AAAAATGCAGTTACAGCAAAAGG + Intronic
1012530949 6:100235703-100235725 CTAAATGTAGTTCCTGAAAAGGG - Intergenic
1015778894 6:136842990-136843012 CCAAATGTAGCTCCAGTAAAGGG + Intronic
1018894846 6:168006845-168006867 CAAAAGGTAGTTTTAGTTAACGG + Intronic
1020744043 7:12058518-12058540 GAAAAGGTATTTCCTGTAAATGG + Intergenic
1021872062 7:25016699-25016721 CAAACTGAAGTTCCAGCAGACGG - Intergenic
1021881927 7:25103418-25103440 AAAAAGGCAGTTCCAGCTATAGG + Intergenic
1022263771 7:28733273-28733295 GAGAAGGAAGTTCCAGAAAAGGG - Intronic
1024973097 7:55088426-55088448 CAAAAGGGAGTTGCACAAAAGGG - Intronic
1028885496 7:95928230-95928252 TAAATTGTAGTTCCTGCAAAAGG + Intronic
1028962030 7:96759996-96760018 AAAAAGGTATTTCGTGCAAATGG - Intergenic
1030875920 7:114813163-114813185 CAAAAGGTAGTTCCCTCACAAGG + Intergenic
1031482683 7:122298273-122298295 CAAAAGTTAATTCCAACAGAGGG + Intergenic
1034076018 7:148231860-148231882 CAGAATGCAGTTCCAGAAAAAGG + Intronic
1035062457 7:156079619-156079641 CGAAAGTTAGTGCCAGGAAATGG + Intergenic
1039207998 8:35178303-35178325 AAAAAGATATTTCCTGCAAATGG + Intergenic
1039211158 8:35216001-35216023 AAAAAGATAGTTCATGCAAATGG - Intergenic
1039409219 8:37338357-37338379 TAAAAGCTACTTCCAGGAAAAGG - Intergenic
1040402787 8:47069346-47069368 AAAAAGGATGTTCCAGCATAAGG + Intergenic
1040508359 8:48071848-48071870 CCAGAGGAAGTTCCAGCAGAGGG - Intergenic
1041773945 8:61503580-61503602 CCAAAGGTAGTTCTCGCACATGG - Intronic
1042287430 8:67129443-67129465 CAAAAAGCAGTTGCAGGAAATGG + Intronic
1042499502 8:69492738-69492760 CAAAAGGCAGTTCCAAGAAGAGG - Intronic
1042648398 8:71012702-71012724 CAAAAGGTACTTACATCAAAGGG - Intergenic
1042670883 8:71262101-71262123 CAAAAGGCAGATCCATCAACTGG - Intronic
1044828045 8:96217374-96217396 CAGAAGCGAGTTGCAGCAAATGG + Intergenic
1044964984 8:97565899-97565921 CAAAAGATTGTTCCAGCAGCTGG - Intergenic
1045040248 8:98216876-98216898 CAAAAGGTCCTTCCAAGAAAAGG + Intronic
1045812632 8:106241367-106241389 AACAAGATAGTTCCAGCTAATGG + Intergenic
1048103832 8:131385178-131385200 CATAAGGAAGATCCAGCAAGCGG - Intergenic
1050101340 9:2123506-2123528 CAAAAGGTGGGTACAGAAAAAGG + Intronic
1050616826 9:7409979-7410001 GGAAAGGTAGTCCTAGCAAAGGG - Intergenic
1050846921 9:10232540-10232562 CAAAATGTGCTTCCAGCAGATGG + Intronic
1051630682 9:19137718-19137740 AAACAGGTAATTCAAGCAAAAGG + Intronic
1051701506 9:19829056-19829078 CCAAAAGGAGTTCGAGCAAAGGG - Intergenic
1057163384 9:92907249-92907271 CAAAAGGAAGTACCAGCACGTGG + Intergenic
1057926821 9:99159790-99159812 AAAAATGCAGTTCCAGCGAAGGG - Intergenic
1058540498 9:106007471-106007493 AAAAAGATAGTTCATGCAAATGG - Intergenic
1062136289 9:134930103-134930125 CCAAGGGTTCTTCCAGCAAAGGG + Intergenic
1186771373 X:12821188-12821210 CAAAAGGTAGAACCACCCAATGG + Intronic
1190449140 X:50560026-50560048 AAAAAGGTATTTCATGCAAATGG + Intergenic
1191976696 X:66879790-66879812 CTAGAAGTAGTTCCATCAAATGG + Intergenic
1192726197 X:73755291-73755313 AAAAAGATATTTCAAGCAAATGG - Intergenic
1193849924 X:86524346-86524368 CCAAAGGTAGTCCTAGGAAAAGG - Intronic
1194466338 X:94238551-94238573 AAAAAGGTATTTCATGCAAATGG + Intergenic
1194693211 X:97011947-97011969 TAAAGGGTATTTCCAGCAGAGGG + Intronic
1195458643 X:105098890-105098912 CAAAAGTTATTTCCAAGAAAAGG + Intronic
1197470904 X:126864910-126864932 AAAAAGGTGGTTGCAGCTAAAGG + Intergenic
1198242735 X:134801294-134801316 CAAAAGGTATTTCCAGAAAGGGG + Intronic
1199171964 X:144743253-144743275 CAACAGTTAGATCCAGCAACGGG + Intergenic
1199825451 X:151494504-151494526 CAAGAGGTACTTTCAACAAATGG - Intergenic
1200243414 X:154509419-154509441 GAAATGGCAGTTCCAGGAAATGG + Intronic