ID: 1158025827

View in Genome Browser
Species Human (GRCh38)
Location 18:52896462-52896484
Sequence ATCTAGTACCTTCTGTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158025826_1158025827 -4 Left 1158025826 18:52896443-52896465 CCACTATTCATTATTTGCTATCT 0: 1
1: 1
2: 1
3: 31
4: 372
Right 1158025827 18:52896462-52896484 ATCTAGTACCTTCTGTAAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158025827 Original CRISPR ATCTAGTACCTTCTGTAAGA AGG Intronic
903801783 1:25974228-25974250 ACCTAGTACTTTCTGAAAAAGGG - Intronic
906279782 1:44545246-44545268 ATCTGGTACCTTCGGTTGGAGGG + Intronic
907674923 1:56509492-56509514 AGCTAGTTACTTCTGTAAAATGG + Intronic
907679968 1:56553938-56553960 ATGATGTGCCTTCTGTAAGAAGG + Intronic
908064069 1:60383597-60383619 ATTGATTACCTTCTGGAAGAGGG + Intergenic
910283973 1:85532603-85532625 TCCTAGTGCCTTCTATAAGATGG - Intronic
910347463 1:86256655-86256677 ATTTGGTACCGCCTGTAAGATGG + Intergenic
914206045 1:145530382-145530404 TCCTAGTGCCTTCTATAAGATGG + Intergenic
914925140 1:151878614-151878636 ATCTAGGACTTTCTGTTACAAGG - Intronic
915526384 1:156478874-156478896 ATCTGGATACTTCTGTAAGAGGG + Intronic
1067342617 10:45417879-45417901 TTCTAGAAGCTTCTGCAAGAAGG - Intronic
1068107834 10:52641970-52641992 ATCTAGTTCCTTCTTAAAGCAGG - Intergenic
1072298194 10:94033121-94033143 CTCAAGTCCCTTATGTAAGATGG - Intronic
1072510095 10:96113501-96113523 AACTAGTACCTGCAGTAACATGG + Intergenic
1073588014 10:104729666-104729688 ACCTAATACCTTCTGAAATATGG - Intronic
1077749988 11:4956429-4956451 ATCTAGTAACACCTGTAATAAGG + Intronic
1079876365 11:25862379-25862401 CTGTGGTACCTTCTGTGAGATGG - Intergenic
1082838096 11:57666598-57666620 ATCTAGTTCCTTCTCTGACATGG - Intergenic
1085775001 11:79357672-79357694 ATTTAGTACCTGCTGTACTATGG - Intronic
1086258645 11:84910946-84910968 ATCTAGTTTCTTCTCTAACATGG - Intronic
1089543925 11:119207323-119207345 AACTATTATCTTCTGAAAGATGG + Intronic
1092032866 12:5303577-5303599 CTCTAGTAACTTCCTTAAGAAGG - Intergenic
1097379184 12:58874866-58874888 ATCTGGGACCTTTTGTAAGAAGG - Intronic
1099854190 12:88142642-88142664 GGGTAGTGCCTTCTGTAAGAAGG + Intronic
1103124957 12:118413729-118413751 ATCTAATACTGTCTGTGAGAGGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1111425191 13:88071144-88071166 ATCTCATCCCTTCTGTAAAATGG - Intergenic
1112546953 13:100380417-100380439 TTGTAGTAACTTCTGAAAGATGG - Intronic
1115143260 14:30198170-30198192 ATCTATTATGGTCTGTAAGATGG - Intergenic
1115188529 14:30720772-30720794 CTCAAGTACCTTATGTAAAATGG - Intronic
1117773277 14:59156273-59156295 ATCCAGTGCCTTCAGTAAGATGG + Intergenic
1122154780 14:99743422-99743444 AGCTCGTAACTTCTGTGAGAAGG - Intronic
1125794309 15:42393129-42393151 CTCAAGTCCCTTCTGTAAAATGG + Intronic
1127097692 15:55529302-55529324 AGCTAGCAGCTTCTGTGAGAAGG + Intergenic
1131122807 15:89833541-89833563 ATTTCGTACCTTCTGTAAGTTGG - Exonic
1131758621 15:95594465-95594487 ATCTAGCACCTTCTATCATAAGG - Intergenic
1132867011 16:2098082-2098104 TTCTAGGACATTCTGTCAGATGG - Intronic
1133180985 16:4054497-4054519 ATCTAATACCTCCAGCAAGAAGG - Intronic
1134524763 16:14935040-14935062 TTCTAGAACATTCTGTCAGATGG + Intronic
1134548143 16:15125905-15125927 TTCTAGGACATTCTGTCAGATGG - Intronic
1134645394 16:15861002-15861024 CTCTAGTACCCTCTGGAAGCAGG + Intergenic
1134712352 16:16333527-16333549 TTCTAGAACATTCTGTCAGATGG + Intergenic
1134720210 16:16376820-16376842 TTCTAGGACATTCTGTTAGATGG + Intergenic
1134947217 16:18335065-18335087 TTCTAGGACATTCTGTTAGATGG - Intronic
1134954476 16:18375167-18375189 TTCTAGGACATTCTGTCAGATGG - Intergenic
1140833662 16:78774068-78774090 GTCTAGGTCCTTCTGAAAGAAGG + Intronic
1143373200 17:6453259-6453281 AACCAGTGCCTTCTGCAAGAAGG + Exonic
1143749491 17:9018104-9018126 GTCTAGAACCTCCTGTAATACGG - Intergenic
1145997787 17:29114520-29114542 ATTTAGTGCCTTCTGTAAAAGGG - Intronic
1154229014 18:12537033-12537055 ATCTATTAGATTGTGTAAGATGG - Intronic
1155412329 18:25560284-25560306 ATCTGATACCTCTTGTAAGAGGG + Intergenic
1157609481 18:48947567-48947589 ATCTATCTCCTACTGTAAGAGGG + Intronic
1158025827 18:52896462-52896484 ATCTAGTACCTTCTGTAAGAAGG + Intronic
1159025188 18:63177255-63177277 ATTTGGTACCTCCTGTCAGAGGG - Intronic
1159027722 18:63201263-63201285 ATTTAAGACTTTCTGTAAGATGG + Intronic
1159928247 18:74288308-74288330 ATCTAGGACATTCTGAAAGAAGG + Intronic
1161829835 19:6594680-6594702 AACTAATACCTTCTAAAAGATGG + Intronic
1166086929 19:40482467-40482489 AACTGGGACCTCCTGTAAGAGGG + Intronic
1166883101 19:45940736-45940758 TTCTTGTACCTTCTGCACGATGG + Exonic
1168467805 19:56618419-56618441 ATCTGGTACCTTCTGTGTGCAGG + Intronic
928357322 2:30630513-30630535 TTCTATTACCTTTTGTAATAAGG + Intronic
929148705 2:38729087-38729109 CTCTAGTTCCTTCTATAAAATGG + Intronic
932753154 2:74385295-74385317 ATATAGGAACTTCTGCAAGAAGG + Intronic
933314047 2:80694619-80694641 ATCGAGTACATTCTCAAAGAAGG - Intergenic
933823140 2:86133243-86133265 ACCTGATACCTTCAGTAAGATGG + Exonic
936643336 2:114341264-114341286 ATCTAGCAGCTTCTGTTACATGG - Intergenic
939735421 2:145838512-145838534 AAGTAATACCTTCTATAAGAAGG - Intergenic
947447379 2:230174394-230174416 TTCTAGAACCTTTTGTTAGAAGG - Intronic
948796920 2:240409463-240409485 ATCTAGTGCCTTCTTCAACATGG - Intergenic
1174740385 20:53007540-53007562 TTCTAGCACCTTCTCTAGGATGG - Intronic
1176312046 21:5156666-5156688 CTCTCTTACCTTCTGGAAGAGGG - Intergenic
1176923642 21:14720166-14720188 TTATAGTATCTACTGTAAGAGGG - Intergenic
1177915342 21:27081965-27081987 ATCAAGTACCTTATATAAAATGG - Intergenic
1178744396 21:35234331-35234353 ATCTAGAACCTTCTGAAGAATGG - Intronic
1179845002 21:44105364-44105386 CTCTCTTACCTTCTGGAAGAGGG + Exonic
951752361 3:26051526-26051548 AACTATTACCTTATGTAAAAGGG + Intergenic
954602601 3:51881292-51881314 ATCTAGTACCTCCAGTCAGATGG + Intergenic
955455258 3:59113273-59113295 ATCTAGTATGTCCTGTAAGTTGG - Intergenic
955484498 3:59422241-59422263 ATCTAATACATACTTTAAGAAGG - Intergenic
956857566 3:73290669-73290691 ATCAAGTTTCTTCTCTAAGATGG - Intergenic
957562426 3:81839830-81839852 TTTTAGTACCTTATGTAAGATGG + Intergenic
958561325 3:95750994-95751016 ATTTAATATCTTCTGTAATATGG - Intergenic
959376557 3:105594856-105594878 ATCTAGTACCTATTGAAAGTCGG - Intergenic
964416991 3:156458082-156458104 ATCTATCATCTTTTGTAAGAGGG + Intronic
966193703 3:177293749-177293771 ATAAACTACCTTATGTAAGAAGG + Intergenic
972993888 4:44855400-44855422 ATCTAGGACCTTTTGGAAAATGG + Intergenic
975919891 4:79372850-79372872 ATGTTGTATCTTCTTTAAGATGG + Intergenic
982378315 4:154719483-154719505 ATCTGGTAACTTCACTAAGAAGG + Intronic
983891917 4:173038354-173038376 ATCTAGGACCCTCAGAAAGAAGG + Intronic
984356150 4:178661635-178661657 ATTTAGTACTTTTTGAAAGAAGG + Intergenic
984562705 4:181289710-181289732 ATCCAAGACCTTCTGTAAGTCGG - Intergenic
986346361 5:6839043-6839065 ATCTGTTATCTTCTGGAAGAGGG + Intergenic
986731897 5:10640922-10640944 AACTAGTGCCTTATGAAAGAGGG - Intronic
988156843 5:27464080-27464102 ATCTAGTCCTTTCTGGAGGAAGG - Intergenic
988228925 5:28449395-28449417 ATCTAGTGCCTTCAGGATGATGG - Intergenic
988923418 5:35964696-35964718 ATATAATAACTTCTGTAAAATGG + Intronic
992523956 5:77587225-77587247 TTATAGTTTCTTCTGTAAGATGG + Intronic
997148577 5:131466242-131466264 CTCTGGTTCCTTCTGTAAGAAGG + Intronic
997658126 5:135570084-135570106 ATCTACTATCTTCTCTAAGTGGG + Intergenic
998993970 5:147850291-147850313 CTCTTCTACCTGCTGTAAGATGG + Intergenic
1000393506 5:160749307-160749329 ATCTTGAACCATCTGTAGGAGGG - Intronic
1001361814 5:171093500-171093522 ATGTGGTAGCTTATGTAAGAGGG + Intronic
1004156270 6:13171055-13171077 ATCGAGTACCTGCTCTAAGCAGG - Intronic
1005717161 6:28560768-28560790 ATCTACTTCCTTCTGCAAGTTGG + Intergenic
1007191860 6:40026135-40026157 TTCTACTACCCTCTGTAAGCCGG - Intergenic
1011691534 6:89874608-89874630 TTCTAGTACTTGCTGTGAGAAGG - Intergenic
1012657973 6:101849603-101849625 ATTTAATGCCTTCAGTAAGAGGG + Intronic
1013689585 6:112625417-112625439 TTCTAGTACTTTCTTCAAGAAGG + Intergenic
1015562044 6:134526434-134526456 ATATAGTACCATCTGTACAAAGG - Intergenic
1016586090 6:145687755-145687777 ATCCTGTACCTTCTGTCTGATGG - Intronic
1016677157 6:146784559-146784581 ATCTAGACCCTTTTGAAAGAAGG + Intronic
1018470531 6:164092994-164093016 ATCTATCACCTACTGTATGATGG + Intergenic
1024345806 7:48311700-48311722 ATCAGGTACCTTCTATATGAAGG + Intronic
1024349300 7:48347501-48347523 ATCTATTTCCTTCTTTAAGATGG - Intronic
1025748484 7:64269373-64269395 ACCTAGAACCTTAAGTAAGATGG - Intergenic
1026815503 7:73508384-73508406 ATCTACTAACTTCTCTAAGGAGG + Exonic
1027869764 7:83692675-83692697 ATCTGCTACCTTCTCCAAGAGGG - Intergenic
1028540067 7:91933421-91933443 CTTTAATACATTCTGTAAGAAGG + Intergenic
1036649864 8:10635284-10635306 TTCTATCACCTTCTCTAAGAGGG + Intronic
1043160819 8:76844425-76844447 ATCTAGTACCTTGTAAAGGATGG + Intronic
1055268745 9:74531014-74531036 ATCTAGTGCCTTATGAAACAAGG - Intronic
1057845917 9:98523458-98523480 ATCAAGTAGCTGCTTTAAGAAGG + Intronic
1058267645 9:102925381-102925403 AGCTAGCAACTTCTGTAAGAAGG + Intergenic
1186588494 X:10902492-10902514 GATTAGTACCCTCTGTAAGATGG + Intergenic
1187108270 X:16268012-16268034 ATCTCAGACCTTATGTAAGATGG - Intergenic
1187988657 X:24845019-24845041 ATCTATTTCCTTCTTTAAGAGGG + Intronic
1189546283 X:42045744-42045766 ATCTACCACCTTCTGCAAGTGGG - Intergenic
1190359545 X:49636077-49636099 ATCGATTACATTATGTAAGAGGG + Intergenic
1193379061 X:80797274-80797296 ATCAAGTAAATGCTGTAAGAGGG + Intronic
1198443433 X:136687410-136687432 ATCTTGTATCTTCAGTATGATGG - Intronic
1199085265 X:143621210-143621232 AACTAGTAGCTTCTGTGGGATGG + Intergenic