ID: 1158027140

View in Genome Browser
Species Human (GRCh38)
Location 18:52913673-52913695
Sequence TGAGACTCTTGGGAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158027140_1158027144 -7 Left 1158027140 18:52913673-52913695 CCTGTTTTTTCCCAAGAGTCTCA 0: 1
1: 0
2: 2
3: 22
4: 248
Right 1158027144 18:52913689-52913711 AGTCTCATGAGGCCAAAATATGG 0: 1
1: 0
2: 1
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158027140 Original CRISPR TGAGACTCTTGGGAAAAAAC AGG (reversed) Intronic
901567362 1:10129656-10129678 TGAGATTCTTAGAAAAAAAAGGG - Intronic
902852451 1:19170877-19170899 ATAGGCTCTGGGGAAAAAACAGG + Exonic
903790666 1:25890796-25890818 AGAGACCATTTGGAAAAAACTGG + Intronic
906171524 1:43729951-43729973 TGAGGCTGTGGGGTAAAAACAGG - Intronic
906830477 1:49026109-49026131 TGAGATTCTTGGAAAAACTCAGG + Intronic
908466138 1:64397592-64397614 TGAGACTTTTGAGAAATCACTGG + Intergenic
910219733 1:84878318-84878340 TGAGGAGATTGGGAAAAAACAGG - Intronic
911208398 1:95116059-95116081 TGAGAGTCTTGGGGAGAAAAAGG + Intergenic
911882697 1:103262282-103262304 TTATGCTCTTGGGATAAAACAGG - Intergenic
911960583 1:104297210-104297232 GGAGAATCTTGGAATAAAACTGG + Intergenic
913030648 1:114899009-114899031 AAAGCCCCTTGGGAAAAAACTGG - Intronic
915997525 1:160578802-160578824 TGAGACTATTTGTAAAAAATGGG + Intronic
917668284 1:177247003-177247025 TGAGTCACTGGGTAAAAAACTGG + Intronic
918748722 1:188242533-188242555 TGAGCTTCTTTGGTAAAAACTGG + Intergenic
919497962 1:198300453-198300475 TGAGTTTCTTTGGAAAGAACAGG - Intronic
920408974 1:205743160-205743182 TTACATTTTTGGGAAAAAACAGG + Intronic
920838937 1:209537615-209537637 TTAGAATCTTGGGATAAAAATGG + Intergenic
923546683 1:234928548-234928570 TTAGACACTTGGGACGAAACTGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063218082 10:3942074-3942096 TGAGACTCTGTGGAAAAAAAAGG + Intergenic
1063280139 10:4619899-4619921 TGATTTTTTTGGGAAAAAACAGG - Intergenic
1063735317 10:8747020-8747042 TGAGACTATTGGGAGAATATGGG + Intergenic
1065974504 10:30830620-30830642 TGAGACTGTGGAGATAAAACAGG - Intronic
1068165433 10:53325662-53325684 TGACACTCTTGGGTAAAACATGG + Intergenic
1068442117 10:57070780-57070802 TGTTACTATTGGAAAAAAACTGG - Intergenic
1070883437 10:79869010-79869032 TGAGACTTTTGAAAAAACACAGG + Intergenic
1070948076 10:80409174-80409196 TGTGACTCTTGGGAAAGAGGGGG - Intronic
1071236278 10:83653358-83653380 TAAAACTCCTGGGAAATAACAGG - Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1071650003 10:87385316-87385338 TGAGACTTTTGAAAAAACACAGG + Intergenic
1071691692 10:87826753-87826775 TGGGACTCTTGGAAATAAACAGG + Intronic
1071744325 10:88398680-88398702 TAAGACTCTTAGAAGAAAACAGG + Intronic
1072337030 10:94406413-94406435 TGACATTCTTGGGAAAGAAAGGG + Intronic
1074278203 10:112024796-112024818 TGAGGATCTTAGGTAAAAACCGG - Intergenic
1076743757 10:132502158-132502180 TGAGATTTTTGCTAAAAAACAGG - Intergenic
1077329974 11:1979907-1979929 TTGGACTCTTGGGAAGAAGCTGG + Intronic
1077511194 11:2964245-2964267 AGAGACACTTGGGAAAAGAATGG + Intronic
1077565004 11:3292089-3292111 AGAATCTCTTGGGAATAAACAGG - Intergenic
1077570890 11:3337906-3337928 AGAATCTCTTGGGAATAAACAGG - Intergenic
1077709265 11:4519676-4519698 TGCAACTCTTGGGAAGTAACTGG - Intergenic
1079234064 11:18674919-18674941 TGAGGCTGTTGGGAAATATCTGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081388383 11:42500321-42500343 TGAGACTTTTGGGGGATAACAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1085235817 11:75014548-75014570 TGAGTCACTTGGGAAAATATAGG + Intronic
1085715842 11:78872483-78872505 TGGCACACTTGGGAAATAACAGG - Intronic
1086065024 11:82734532-82734554 TGAGAATCCTGGGAAAACTCAGG - Intergenic
1086992967 11:93326292-93326314 TGATAGTCTTGTGAAAAAAAGGG - Intergenic
1202812951 11_KI270721v1_random:35086-35108 TTGGACTCTTGGGAAGAAGCTGG + Intergenic
1092299814 12:7236557-7236579 TTAGACTTTAGGGAAAAAAGTGG - Intergenic
1092593465 12:9974119-9974141 TGTGACTATTGGGATGAAACAGG - Intronic
1093687548 12:22073877-22073899 AAAGCCTCTTGGAAAAAAACTGG - Intronic
1093836808 12:23841775-23841797 TGGGATTCTAGGGAAAAAAGCGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095674964 12:44905912-44905934 TGAGAGTCTAGGGGAAAAACAGG + Intronic
1095741717 12:45614417-45614439 TGAAACTCTTGGGGAAAATGAGG - Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1098717203 12:73845468-73845490 GTAGACACATGGGAAAAAACTGG + Intergenic
1099043639 12:77687670-77687692 AGAAACTCATGAGAAAAAACTGG + Intergenic
1100610219 12:96185801-96185823 TGGCACTCTTGAGAAACAACTGG - Intergenic
1101411123 12:104469410-104469432 AGTGACACTTGGGAAATAACAGG + Intronic
1102073467 12:110041137-110041159 TCAAACACTTGGGAAATAACTGG + Intronic
1103594340 12:122014716-122014738 TGAGACTCTCTTAAAAAAACAGG - Intergenic
1104428818 12:128699827-128699849 TGACACTCTGGGGCAAAATCAGG - Intronic
1104566448 12:129889188-129889210 TGAGATTCTGGGGACAAAAATGG - Intronic
1104876307 12:132037402-132037424 TGAGACTGGTGGGAGAAAAACGG + Intronic
1107297593 13:38927936-38927958 TAAAACTCTTAGGAAAAAATAGG + Intergenic
1109469546 13:62787785-62787807 TGGAACTCTTGGGGGAAAACAGG + Intergenic
1111047387 13:82831859-82831881 TGAGATTATTGGAAAGAAACTGG + Intergenic
1111737578 13:92162115-92162137 TTAGACTTCAGGGAAAAAACAGG - Intronic
1113661143 13:112107088-112107110 AGCAACTCTTGGGAGAAAACGGG - Intergenic
1113664059 13:112128566-112128588 TGAGGCTCCTGGAGAAAAACAGG - Intergenic
1114788325 14:25626545-25626567 TGAGATTTCTGGGAGAAAACAGG - Intergenic
1115063172 14:29219923-29219945 TGACACTTTTGGGAAAAATGTGG + Intergenic
1116255325 14:42547764-42547786 TGAGACTTTTGGGAACAATTGGG - Intergenic
1116554017 14:46279850-46279872 TGAGACCCTTGGCAAAGATCTGG - Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1120452146 14:84681816-84681838 TGAGAATATTGGCAAAAAAAAGG + Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121892201 14:97604774-97604796 AGTGAGTCTTGGGGAAAAACTGG + Intergenic
1121983661 14:98477661-98477683 TGAGCATCTTGGGAAGAAAGTGG + Intergenic
1122245914 14:100403417-100403439 TGGGACTCCTGGGAAGGAACTGG + Intronic
1123871553 15:24579958-24579980 TGAGAGTCTGGGGAACAAAGTGG - Intergenic
1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG + Intergenic
1126302072 15:47208336-47208358 TTAGAGTCTTAGGAAAATACAGG + Intronic
1126416561 15:48423817-48423839 TGAACCTTATGGGAAAAAACAGG + Intronic
1128178876 15:65582457-65582479 TAAAACTCTTAGAAAAAAACGGG + Intronic
1129229592 15:74189336-74189358 GGAGACGCTGGGGAAGAAACTGG + Intronic
1130820550 15:87490698-87490720 TCAGACAATTGGGAAAACACAGG + Intergenic
1130989770 15:88869419-88869441 TAAGACTTTTGGGAAAAAAAAGG + Intronic
1132247958 15:100311870-100311892 TTAGACTCGTGGGAGAAAAAAGG + Intronic
1132752156 16:1463225-1463247 TAAAATTCTTAGGAAAAAACGGG + Intronic
1134789000 16:16971523-16971545 GGAGACTCTTGGAAAAACCCTGG + Intergenic
1135093076 16:19537651-19537673 TGACATTTTTGGGAAAAAAGTGG + Intronic
1137072118 16:35912615-35912637 CGAGACTTTGGGGAAAAAAAGGG - Intergenic
1137794242 16:51201734-51201756 TGACCCTCTTGGGTAAAAGCAGG - Intergenic
1138225440 16:55290593-55290615 TGAGACTCTTGCCACAAACCTGG + Intergenic
1140804205 16:78518108-78518130 TGTGACTCTTATGAAAATACTGG - Intronic
1142665600 17:1461715-1461737 TGAGGCTCTTGGGATATAGCAGG - Intronic
1143000951 17:3794737-3794759 AGTCACTCTGGGGAAAAAACAGG + Intronic
1144311963 17:14022351-14022373 TGTCACACTTGGGAAAAAGCAGG + Intergenic
1144332795 17:14238968-14238990 TGTCACACTTGGGAAAAAGCAGG - Intergenic
1148531933 17:48401661-48401683 TGAAACTCTTAGAAAAAGACAGG + Intronic
1149111852 17:53042907-53042929 TAATATTCTGGGGAAAAAACTGG - Intergenic
1149435959 17:56633760-56633782 TGTGGCTCTTGAGACAAAACTGG - Intergenic
1149739078 17:59026304-59026326 TAAAACTCTTGGAAGAAAACAGG + Intronic
1150028205 17:61701436-61701458 AGAGACTCTTGGCAAAGAATGGG - Intronic
1150628638 17:66860018-66860040 TGATACTGTTGAGAAAAATCAGG + Intronic
1153672076 18:7420995-7421017 TGAGACACTTAGGGAGAAACAGG + Intergenic
1156410615 18:36824954-36824976 TAAGACTCTTGGAAGAAAACAGG - Intronic
1156746949 18:40403718-40403740 TGAGACATTTTGGCAAAAACGGG - Intergenic
1156794049 18:41019037-41019059 TGAGACTGCTGGAAGAAAACAGG + Intergenic
1157097133 18:44696215-44696237 TGAGTCTCTTGGGAACAGGCAGG - Intronic
1158027140 18:52913673-52913695 TGAGACTCTTGGGAAAAAACAGG - Intronic
1158430819 18:57385697-57385719 TAAGACTGTGGGGAAAACACAGG + Intergenic
1161579234 19:5071597-5071619 GGGGACTCTTGGGAAAGAAGGGG + Intronic
1163108570 19:15142497-15142519 TGTGACTCTTAGGAAAACAAAGG - Intergenic
1164383452 19:27754280-27754302 AGAGACACCTGGGTAAAAACAGG - Intergenic
1164830491 19:31316403-31316425 GGAGACTCTGGGGAAAAGGCAGG + Intronic
1165801176 19:38551480-38551502 TGAGGCTCTTGGGGGACAACTGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166523457 19:43496369-43496391 TGAGACCCTTGGGAAAAAATGGG - Intronic
1166953188 19:46444166-46444188 TGAGCCTTTTGGGAAAATTCAGG + Intergenic
1167129833 19:47577287-47577309 TGAGAATCTAGTTAAAAAACAGG + Intergenic
1167194496 19:48018394-48018416 TGAGACACTAGGCAAAAAAATGG + Intronic
1167352015 19:48981449-48981471 TGAGACTCTAGGAGAAACACAGG + Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168463442 19:56582064-56582086 TTAGAATCTTTGGAAAAATCAGG + Exonic
926147747 2:10406908-10406930 TGAGCCTCTGGGGAGAGAACAGG - Intronic
926518940 2:13884706-13884728 TGGTAGTCTTGGGAAAAATCTGG - Intergenic
928174673 2:29025677-29025699 TGAGACTCTAGGGGACAAAAGGG + Intronic
928575822 2:32653999-32654021 TGGGACCCTTGGGGAAGAACTGG - Intronic
929181215 2:39041616-39041638 TAAAACTCTTGGAAGAAAACAGG - Intronic
931207346 2:60160683-60160705 TGAGCCTCTTGGGAGAAAGTTGG - Intergenic
933937058 2:87215040-87215062 TTACACAATTGGGAAAAAACAGG - Intergenic
936339287 2:111617146-111617168 TTAGACACTTGGGAACAGACAGG - Intergenic
936356083 2:111750784-111750806 TTACACAATTGGGAAAAAACAGG + Intergenic
937182137 2:120006312-120006334 TGAGACTCAGGGGAAGAAAAAGG - Intergenic
937206473 2:120239897-120239919 TGAGCTTCTGGGGAAACAACAGG - Intergenic
938154000 2:128912833-128912855 TAAAACTCTTGGAAGAAAACAGG + Intergenic
938752261 2:134343935-134343957 TCTGACTCTTGGGAGGAAACTGG + Intronic
938840410 2:135156595-135156617 TAAAACTCTTGGGAAAAGAGTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942403215 2:175625437-175625459 AAAGTCTCTTGGGAAAAAATCGG + Intergenic
943223212 2:185136444-185136466 TGTGTCTCTTGGGAGAAACCAGG - Intergenic
947480492 2:230495078-230495100 TGAGACTCTTTGGCAAGGACAGG + Intronic
948651913 2:239451705-239451727 TGATATTCTTTGGAACAAACTGG + Intergenic
1170081924 20:12486137-12486159 ATAGACTCTAGTGAAAAAACTGG + Intergenic
1170601453 20:17844455-17844477 TGAGAATCATGGGAAGAAAAGGG - Intergenic
1172643677 20:36456797-36456819 TGAGACTCTTGAGACAAGACAGG + Intronic
1173268189 20:41506141-41506163 GGAGACTCTTGAGAATAATCTGG - Intronic
1173326674 20:42040071-42040093 TGAGACTGTGGGGAAAAAAAAGG - Intergenic
1173414937 20:42846953-42846975 TGAGACTCTGGAGAAAACAATGG + Intronic
1177365861 21:20134946-20134968 TGAGACTCTTGTGAACAGAAAGG - Intergenic
1177553395 21:22656006-22656028 TGAGACTTTAGAGAAAAAAAAGG - Intergenic
1178244706 21:30939158-30939180 TGGGAGACTTTGGAAAAAACTGG + Intergenic
1179380913 21:40898139-40898161 TCAGACTTTTGGGAAACTACTGG + Intergenic
1181538130 22:23557389-23557411 TGAGGCTCTTGGGAAAATGGAGG + Intergenic
1182384409 22:29924131-29924153 TAAGACTCTTAGAAGAAAACAGG - Intronic
1182966444 22:34526015-34526037 TGAGGTTCTTGAGAAAGAACTGG - Intergenic
949201093 3:1380307-1380329 TGTGGCTCTGGGGAAAACACGGG - Intronic
949220419 3:1626547-1626569 TAAGCCACTTGGGAAAAAAGAGG - Intergenic
952190570 3:31018761-31018783 TGAGCCTTTGGGGAAAAAGCAGG + Intergenic
952841754 3:37652438-37652460 TGGAAGTCTTGGGAAAAAAGAGG - Intronic
953639129 3:44689067-44689089 TCAGACTCTTGGGGAAAATTAGG + Intergenic
954572816 3:51656279-51656301 TGGCACTCTTGGTAAAAAATAGG + Intronic
955405507 3:58623281-58623303 TGAGTGTCTTGGTAAACAACAGG + Intronic
960266695 3:115628235-115628257 TGGGGCTCTGGGGAAAACACGGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962598342 3:136969940-136969962 TAAAACTTTTAGGAAAAAACAGG - Intronic
963640616 3:147857721-147857743 TGAGACTTTTGGGAACTATCGGG - Intergenic
963713420 3:148774462-148774484 TGAGACTCAAGGGAATAATCTGG - Intergenic
965401471 3:168218039-168218061 TGAGAGTCCTGGGAAATAAAAGG - Intergenic
965596092 3:170412847-170412869 TGAGACTCTTGGCAGAGAAGTGG + Intergenic
971587128 4:28418390-28418412 TCACCCCCTTGGGAAAAAACTGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972730138 4:41786737-41786759 AGAGACTCTTAGGACAAAACTGG - Intergenic
973671844 4:53227481-53227503 TGAGAATCTTGGTATAAAAACGG + Intronic
974017418 4:56660859-56660881 TGGGACTCCGGGAAAAAAACAGG - Intronic
974050594 4:56938102-56938124 TGAGACCCTTGGGAAGAAAAAGG - Intergenic
977717604 4:100199502-100199524 TATGGCTCTTGGGGAAAAACAGG - Intergenic
978674915 4:111301196-111301218 TGATACTGATGGGAAAAAGCTGG - Intergenic
980952062 4:139390458-139390480 TGATACTGTGGGGGAAAAACAGG + Exonic
981827406 4:148959329-148959351 TGAAACTTCTGGGAAATAACTGG + Intergenic
981854288 4:149268947-149268969 TGAAATTCTTGGTAACAAACAGG + Intergenic
985912063 5:2892506-2892528 TCAGAGTTTTGGGAAAAAACAGG + Intergenic
986273804 5:6256419-6256441 GGAGACTCTTGGGGAAATTCAGG - Intergenic
986470845 5:8072799-8072821 TGAAACTCTTGGCAAATTACAGG - Intergenic
987168811 5:15231124-15231146 TGAGACTCTTGGGGAAATTAAGG - Intergenic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
989630394 5:43476288-43476310 TGAAACCCTTGGGAACAAAACGG - Intronic
990385558 5:55258081-55258103 TGTGACTGTTGAGAATAAACTGG + Intronic
991147489 5:63323924-63323946 TGAAAGGTTTGGGAAAAAACAGG - Intergenic
992034760 5:72762134-72762156 TGAGATTTTTGTGAAATAACAGG + Intergenic
992519102 5:77531046-77531068 TAAAACTCTTAGGAAAAAACAGG + Intronic
996013442 5:118505797-118505819 TTAGAATCTTGAGAAATAACAGG + Intergenic
997020815 5:129999594-129999616 TGAGACTATAGGGAAAAGAAGGG - Intronic
997612209 5:135223125-135223147 TGAGCCTCGTGGGAAAGACCAGG + Intronic
1000034933 5:157438959-157438981 TAAAACTCTTAGAAAAAAACGGG + Intronic
1000494332 5:161960783-161960805 TCAGGCTCATGGGAAGAAACAGG - Intergenic
1005022496 6:21431652-21431674 TGGGACTCTAGGAAAAAAAGAGG + Intergenic
1008464466 6:51815059-51815081 TGAGAATCTTGGCAAACAAAGGG - Intronic
1010097347 6:72062475-72062497 TGAGATTCTTTAGAAAAAACGGG - Intronic
1010822975 6:80437377-80437399 TGAGGCTCTTTGCAAAAAAAAGG - Intergenic
1012603352 6:101126468-101126490 TGGGTCTCTTGGGACTAAACTGG + Intergenic
1013322733 6:109010243-109010265 TGAGGAACTTGGGAAAATACAGG + Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016611697 6:145997658-145997680 TGGGACTTTTGGGAGAAAAGAGG + Intergenic
1017533418 6:155320731-155320753 TGAGACCCTTGAGTAGAAACAGG - Intergenic
1017555439 6:155560974-155560996 TGAGTCTCTTGAGAAAACAGTGG - Intergenic
1017787409 6:157768030-157768052 TGAGACTCTTGTTTTAAAACTGG - Intronic
1018336533 6:162796889-162796911 TGAGACTCTCAGGAAAGGACTGG - Intronic
1018889655 6:167974587-167974609 TGTGACTTTTTGGAATAAACTGG + Intergenic
1019454498 7:1118942-1118964 TGAGACTCTTAAAAAAAAATAGG + Intronic
1019655085 7:2188722-2188744 TAAAACTCTTAGAAAAAAACAGG + Intronic
1019694637 7:2438389-2438411 TGAGACTCTTGGCAGAGAGCTGG + Intergenic
1020910496 7:14124141-14124163 GGAGACACTTGGTAAATAACAGG + Intergenic
1022611382 7:31877395-31877417 TGAGAGTCTTTGGAAAACAATGG + Intronic
1023276715 7:38526865-38526887 TAAAACTTTTGGGAAAAAATAGG - Intronic
1023319521 7:38978085-38978107 TGAGACCCTTGTGGAAAAAAGGG - Intronic
1023341442 7:39225100-39225122 ATAGACTCTTGGGAGAAATCAGG + Intronic
1023420069 7:39969801-39969823 TGAGACACTTAGCAAAAAATAGG - Intronic
1024205559 7:47156860-47156882 TGAGCCTCTTGGGCAAACAAAGG - Intergenic
1024786245 7:52911172-52911194 ACAGACTCTGGGGAAAAAAAGGG - Intergenic
1024908445 7:54416840-54416862 TGAGACTGGTGGGAAAAATAGGG + Intergenic
1026544227 7:71307943-71307965 TGAGACCTTTGGGAGAAAAGGGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030969503 7:116037500-116037522 TGAGTCTCTTGGCAAATAATTGG + Intronic
1031116890 7:117678641-117678663 TGTGAATCTTGGGGAAAAAGAGG + Intronic
1033778852 7:144645829-144645851 TGAGACTGTGGGGAATGAACAGG + Intronic
1033959950 7:146902423-146902445 TATGACACTTGGGACAAAACTGG + Intronic
1034142686 7:148836923-148836945 TGAGACTCTTGGCAGAAGGCTGG + Intronic
1035189992 7:157158384-157158406 TTAAACTTTTGGGAACAAACAGG + Intronic
1035854005 8:2953780-2953802 GGAGACACTTGGAAAAAAATTGG + Intronic
1036245250 8:7110689-7110711 TGAGACTCTGGAAAAAAAAAAGG + Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1040131975 8:43807682-43807704 TGAGACCTATGGGAAAAAAATGG + Intergenic
1040970381 8:53129723-53129745 AGAGACTCTTGGGAAAATTAAGG + Intergenic
1043798205 8:84572865-84572887 TGAGAAGATTGGGAAAAAAAAGG - Intronic
1044125937 8:88457791-88457813 TGGGACCCATGGGAAATAACTGG - Intergenic
1044781321 8:95746219-95746241 TGAGATTCTTGGCAAGCAACTGG + Intergenic
1044859381 8:96507848-96507870 GGAAACTCTTGGGAGAAAAGAGG - Intronic
1050084547 9:1950966-1950988 TGATACAATTGGGAATAAACAGG + Intergenic
1050838080 9:10109775-10109797 TGAAACTCATGGGGAAAAATAGG + Intronic
1051108189 9:13604362-13604384 TTTGACTCTTGTGAAAAAAGAGG + Intergenic
1051329408 9:16008177-16008199 TAAAACTCTTGGAAGAAAACAGG - Intronic
1051401363 9:16686944-16686966 TGAAACTCTTGGGTAAAGAGTGG - Intronic
1051716076 9:19985817-19985839 TAAAACTCTTGGGAAAATAGGGG + Intergenic
1051817857 9:21130920-21130942 TCAGTCTCTTGGGAGAAGACAGG - Intergenic
1054867417 9:70016817-70016839 TGAGAAGCTTGGGAACAAACTGG - Intergenic
1055383142 9:75731013-75731035 ATAGACTTTAGGGAAAAAACTGG - Intergenic
1056390174 9:86133766-86133788 TGGGACTCTTATGAAAAGACAGG + Intergenic
1056432199 9:86539081-86539103 TGAAACTCTTAGGAGAAAACAGG + Intergenic
1057964804 9:99492488-99492510 TGAGACCCTAGGAAAAAAGCGGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058683738 9:107463049-107463071 TGAGACTCTTTGGAAATGATAGG - Intergenic
1061056204 9:128224281-128224303 TGAGACCATTGTGAAAAAGCAGG + Exonic
1061243850 9:129391169-129391191 TGAGGCTCTTGGGAAAATGGAGG - Intergenic
1061442671 9:130617066-130617088 TGAGACTCTCGGGACCAAACGGG + Intronic
1062557494 9:137121114-137121136 TAAAACTCTTAGGAAAAAAACGG - Intergenic
1186057506 X:5665607-5665629 TGGGACTCTTGGGCAAAAGCGGG - Intergenic
1186228161 X:7423645-7423667 GGAGAGTCTTGGGAAAAAGCAGG + Intergenic
1186977482 X:14923662-14923684 TGAGACTCTTTGGACATTACAGG - Intergenic
1187779687 X:22805494-22805516 TGAGACTTTGTGGAAAAAAAAGG + Intergenic
1191246205 X:58230224-58230246 AGAGACTCCTGGCCAAAAACAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193031690 X:76906027-76906049 TGCCATTCTTGGAAAAAAACAGG - Intergenic
1193195422 X:78625950-78625972 TGAGATTATTGTGGAAAAACTGG + Intergenic
1195764823 X:108285069-108285091 TGGGCCGCTTGGGAAAGAACAGG - Intronic
1197551277 X:127895711-127895733 TGAGAGTCCTGGAAAAAAACAGG + Intergenic
1199986329 X:152954476-152954498 TAAGACTCTTGAGAAACAAGGGG + Intronic
1202039935 Y:20671458-20671480 TGAGATTTTTTTGAAAAAACAGG - Intergenic