ID: 1158027470

View in Genome Browser
Species Human (GRCh38)
Location 18:52917816-52917838
Sequence CTAGTTTAGCATTTCCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158027470 Original CRISPR CTAGTTTAGCATTTCCCTAT TGG (reversed) Intronic
906925831 1:50115393-50115415 CTAGTTTTGCATTTTACTTTTGG - Intronic
908842966 1:68297106-68297128 TTAGTTAAGCATTTCATTATGGG + Intergenic
912252739 1:108027935-108027957 CTAGTATACCATTTCCTTCTTGG + Intergenic
917873316 1:179261796-179261818 CTAGGTTAACATTTCCCAAAAGG - Intergenic
921405370 1:214773370-214773392 CTAATCTAGAATTTCCCAATAGG + Intergenic
921780880 1:219161941-219161963 GAAGTTTAGTATTTCCCTACGGG - Intergenic
923200538 1:231706608-231706630 CTTGTTTAGAATTTCCTTTTTGG + Intronic
1070032354 10:72689557-72689579 GTATTTAACCATTTCCCTATTGG + Intergenic
1072458864 10:95601424-95601446 CTAGTTTGGTGTTTTCCTATTGG + Intergenic
1074746664 10:116541205-116541227 CTAGATTAGCACTGCCCAATAGG - Intergenic
1074888478 10:117714341-117714363 CTATTTTAACATTGCGCTATTGG + Intergenic
1076141379 10:128081083-128081105 CTAGTTAAGCCTTTCCCTTCTGG - Intronic
1082739879 11:56899162-56899184 CAAGTCTAGCATCTCCCTCTTGG + Intergenic
1087005266 11:93464478-93464500 CTAAATTTGCATTTCCCTAATGG - Intergenic
1089117182 11:116105014-116105036 ATGGTGTAGCATTTCCCTGTGGG - Intergenic
1089400962 11:118164465-118164487 TGAGTTTAGCATTTCCAGATGGG + Exonic
1090672969 11:128963172-128963194 CTAGCCTAGCATTCTCCTATGGG + Intergenic
1090689708 11:129166923-129166945 ACAGTTTAGGATTTCTCTATTGG + Intronic
1093331212 12:17842866-17842888 ATAGTTTTGCATTTTCATATTGG + Intergenic
1093543105 12:20311210-20311232 CTAGTTTATGAATTCCCTTTAGG + Intergenic
1096277381 12:50221358-50221380 CTAGTTAAGTAATTCCCTCTGGG + Intronic
1097600785 12:61690153-61690175 TTTGTTTTGCATTTCCCTAGTGG + Intergenic
1098231736 12:68378013-68378035 CAAGTTTAGCATTTCCTCTTAGG - Intergenic
1098306839 12:69110742-69110764 CTAGTTTTGCTTTACTCTATAGG - Intergenic
1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG + Intronic
1101091436 12:101290562-101290584 CTAGTTTAGAAGTTCCTTTTGGG + Intronic
1107877765 13:44805709-44805731 CTCTTTTATCATTTCACTATGGG - Intergenic
1109077570 13:57857250-57857272 CTATGTTATCATTTCCTTATTGG + Intergenic
1116176804 14:41481260-41481282 CTACTGTAGCATTTCCCCCTTGG + Intergenic
1119506073 14:75174081-75174103 GTAGTTTAGCATGGCCTTATGGG - Intronic
1120558511 14:85960083-85960105 CCAGTGTAGCTTTTCCCTTTGGG - Intergenic
1202851749 14_GL000225v1_random:24725-24747 CTAGTCTTGGATTTGCCTATGGG + Intergenic
1128380901 15:67111719-67111741 TTTGATTTGCATTTCCCTATTGG + Intronic
1129919418 15:79307350-79307372 CTAGTTTGGGATTTACCCATAGG + Intergenic
1130324793 15:82871360-82871382 CTTGATTACCATTTCCCTACAGG + Intronic
1130404875 15:83589818-83589840 CTATTATACCATTTCCCTATTGG + Intronic
1133793959 16:9031358-9031380 TTAGATTTGCATTTCCCTAATGG + Intergenic
1134395313 16:13857088-13857110 ATAGTTAACCAGTTCCCTATTGG - Intergenic
1136004815 16:27321776-27321798 CCAGTTTAGAATTTCCCTTTTGG + Intronic
1138871795 16:60897855-60897877 TTCGTTTTGCATTTCCCTAATGG - Intergenic
1142651248 17:1353815-1353837 CTGGTTTCCCATTTCCCTCTGGG - Intronic
1144031228 17:11325145-11325167 CAAGTTTATCATTTCCATCTGGG - Intronic
1146561724 17:33875765-33875787 CCAGTTAAGCATTTTCCTGTGGG - Intronic
1148340766 17:46872260-46872282 CTATTTTCCTATTTCCCTATTGG - Intronic
1150117912 17:62570702-62570724 GCAGTTTAGGATTTCCCTAAAGG + Intronic
1150989154 17:70235673-70235695 ATAGTTTAACATTTTCCTTTAGG - Intergenic
1154322117 18:13362859-13362881 CTAATTTAGCTCTTCTCTATAGG - Intronic
1157585281 18:48797110-48797132 ATAGTTTAGATATTCCCTATAGG - Intronic
1158027470 18:52917816-52917838 CTAGTTTAGCATTTCCCTATTGG - Intronic
1159273431 18:66184095-66184117 CTAGTCTAGTTTTTCCCTATAGG - Intergenic
927539687 2:23897790-23897812 CTAGATTAGCATTTCTCCAAGGG + Intronic
929726326 2:44431826-44431848 CTAGTTCCCCATTTCCCAATGGG - Intronic
933989546 2:87624481-87624503 ATAGTTTAGCACTACCCTCTTGG - Intergenic
936304297 2:111326345-111326367 ATAGTTTAGCACTACCCTCTTGG + Intergenic
940622902 2:156135198-156135220 GTATTTTAGCATTTCACCATAGG + Intergenic
944279101 2:197873746-197873768 CTTTTTTAGGATTTTCCTATTGG - Intronic
947109032 2:226698843-226698865 CTAGTTTAAAAATTTCCTATGGG - Intergenic
1178135973 21:29627695-29627717 CAAGTTTAGGAATTCCCTATTGG + Intronic
1179123008 21:38566284-38566306 CTAAATTAGCATTTTCCCATGGG - Intronic
954169953 3:48793379-48793401 CTGATTTAGCATTTACCTAAAGG - Intronic
955069318 3:55559149-55559171 CCAGTCCAGCATCTCCCTATGGG + Intronic
955343608 3:58144488-58144510 ATATTTGACCATTTCCCTATTGG + Intronic
955538365 3:59948695-59948717 CTTAATTTGCATTTCCCTATGGG + Intronic
955563718 3:60222091-60222113 CTAGTTAAGCATTTCCATCCAGG + Intronic
955986423 3:64578178-64578200 CCAATTTAGCATTGCTCTATCGG + Intronic
959475620 3:106808381-106808403 CTAGTTTAGCATTTGGTTAATGG + Intergenic
960789385 3:121411439-121411461 CAAGTTTACCTTTTCCCTTTTGG + Intronic
962091604 3:132249731-132249753 ATAGTTTATCATTTCCAGATCGG - Intronic
962276239 3:134016449-134016471 CTTGTTTTGCATTTCCCTAATGG - Intronic
963953807 3:151230992-151231014 CTTTTTTAGCATTTCCTAATCGG - Intronic
964284132 3:155099070-155099092 CTAGTTTTGCTTTTCCATGTTGG + Intronic
964712454 3:159685244-159685266 CTTGTTTTGCATTTTCCCATAGG + Intronic
965095612 3:164221038-164221060 CTACTTTATCATCTCCTTATAGG - Intergenic
965727116 3:171729768-171729790 TTAGTATAGCTTTTCCCTGTTGG + Intronic
965780512 3:172281041-172281063 CTTTTTTAGCATTTCCAGATAGG + Intronic
966235323 3:177695029-177695051 TTTCTTTAGCATTTCTCTATAGG - Intergenic
971936712 4:33158991-33159013 CCAGAATAGCATTTCCCTTTGGG + Intergenic
974449868 4:62040486-62040508 ATATTTTAGCATTTGCTTATGGG - Intronic
974450080 4:62043218-62043240 CTAGTTTAACATCTCCATAAGGG + Intronic
976447322 4:85146119-85146141 ATAGTTTTGCATTTGACTATTGG - Intergenic
979134301 4:117089808-117089830 CTATTTTAGTGTTTCCCTAAAGG + Intergenic
980723077 4:136721923-136721945 TTACTTTATCATTTGCCTATTGG + Intergenic
985314758 4:188645146-188645168 CTAGGTTAGCTTTTCCCCACAGG - Intergenic
993130556 5:83892964-83892986 CTAGTTTCACATTTCCCTGTGGG + Intergenic
994036332 5:95205800-95205822 CTTGATTTGCATTTCCCTAATGG - Intronic
994149314 5:96430598-96430620 CTAATTTAGCATTACTATATTGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000851029 5:166340570-166340592 CTATTTAATCATTTCCATATTGG + Intergenic
1001342504 5:170861219-170861241 CAAGTTCAGCATTTCCATTTGGG - Intergenic
1003351533 6:5322193-5322215 TTATTTTATCATTTCCCTATTGG - Intronic
1003440382 6:6135482-6135504 CTATTTTAGCATATTTCTATTGG + Intergenic
1005088364 6:22030494-22030516 TCATTTTACCATTTCCCTATGGG + Intergenic
1008831658 6:55771280-55771302 CTAGCTTAGAATTTAGCTATTGG + Intronic
1009276257 6:61684615-61684637 TTATTTTATCATTTCCCTAAAGG - Intronic
1010109661 6:72210976-72210998 ATTGTTTAGCACTTCCCTTTAGG - Intronic
1012807259 6:103909807-103909829 CTAGTTTGGTATTTCTCTAATGG + Intergenic
1014815821 6:125934297-125934319 CTTGTTTAGCATTTTCCTCAAGG - Intergenic
1015741227 6:136456253-136456275 ATATTTTATAATTTCCCTATAGG - Intronic
1016929248 6:149386838-149386860 TTTGATTTGCATTTCCCTATTGG + Intronic
1018310263 6:162501207-162501229 CTAGTTTAGAATTTATCTTTTGG - Intronic
1021345829 7:19527006-19527028 CTTGTTTAGCATTTCAGTTTTGG + Intergenic
1022592336 7:31676460-31676482 TTTGTTTAGTATTTCCCTTTTGG - Intergenic
1025528889 7:61851214-61851236 CTACATTTGCATTTCCCCATTGG + Intergenic
1026387772 7:69867564-69867586 CTAGTACAGCATTTCCTTTTTGG + Intronic
1032273140 7:130429820-130429842 CTAGTCTAGGATTTCCCTGAAGG + Intronic
1032552114 7:132793868-132793890 CTATTTTAGCAGTTCCTCATGGG - Intronic
1034328205 7:150257477-150257499 CTATATTAGCATTTCCTTCTTGG - Intronic
1034765011 7:153711987-153712009 CTATATTAGCATTTCCTTCTTGG + Intergenic
1035427683 7:158791645-158791667 CTAGATTTGCATTTTCCTAATGG + Intronic
1035987566 8:4451482-4451504 CTTGTTTAATATTTCTCTATGGG - Intronic
1036196045 8:6715996-6716018 CTAGTCTAGCTTTTCCTTCTGGG + Intronic
1038151917 8:24949651-24949673 TAAGTTTAGCAATTCCCTTTAGG + Intergenic
1039092316 8:33845284-33845306 CTTGTGAAGCATTCCCCTATTGG + Intergenic
1041052674 8:53952905-53952927 CAAGTATAGCAGTTCCCTAGAGG + Intronic
1041625570 8:60022452-60022474 CTATTTTAGCATTTCTCAGTAGG - Intergenic
1042409887 8:68452492-68452514 CTTGATTTGCATTTCCCTAAAGG + Intronic
1043147183 8:76673548-76673570 CTAGTTTACAATTTCCGTCTGGG - Intergenic
1043475766 8:80604454-80604476 ATATTTTAGCGTTTCCCTTTTGG + Intergenic
1043576966 8:81669222-81669244 CTAGTTAGGCATTACCCTAGTGG - Intronic
1044517668 8:93157902-93157924 GTTGATTAGCATTTCCCTGTTGG + Intronic
1044983584 8:97738988-97739010 TTACTTAACCATTTCCCTATTGG + Intergenic
1045060184 8:98404197-98404219 CTATTCTAGCATCTCTCTATGGG + Intronic
1046396301 8:113644710-113644732 CTAGTGTTGCATTTTCCTCTTGG - Intergenic
1048095183 8:131284390-131284412 CTCATTTAACCTTTCCCTATGGG + Intergenic
1054818724 9:69500334-69500356 CTTGTTTCACATTTCCATATAGG + Intronic
1055515253 9:77027091-77027113 TTATTTAAACATTTCCCTATGGG - Intergenic
1060285861 9:122251750-122251772 CTAGAATAGCAGTTCCCTGTAGG - Intronic
1185914915 X:4025123-4025145 TTAGATTTGCATTTCCCTATTGG - Intergenic
1187850994 X:23591590-23591612 CTATATTGGCATTTCCCTATTGG + Intergenic
1188767721 X:34116932-34116954 ATAGTTTAGCATTTACATTTAGG - Intergenic
1189095891 X:38139060-38139082 CTTGAGTAGCATTTCCCTAGAGG - Intronic
1201568347 Y:15389389-15389411 CTAGTTGAGTATTTGCCCATTGG + Intergenic