ID: 1158028957

View in Genome Browser
Species Human (GRCh38)
Location 18:52939161-52939183
Sequence AGTGCATATAAGGGGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158028957_1158028961 -3 Left 1158028957 18:52939161-52939183 CCTGCTTTCCCCTTATATGCACT 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1158028961 18:52939181-52939203 ACTAAACAATTCCCAGTCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 201
1158028957_1158028963 6 Left 1158028957 18:52939161-52939183 CCTGCTTTCCCCTTATATGCACT 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1158028963 18:52939190-52939212 TTCCCAGTCTCAGGATATTTGGG 0: 1
1: 0
2: 3
3: 16
4: 201
1158028957_1158028962 5 Left 1158028957 18:52939161-52939183 CCTGCTTTCCCCTTATATGCACT 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1158028962 18:52939189-52939211 ATTCCCAGTCTCAGGATATTTGG 0: 1
1: 0
2: 2
3: 21
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158028957 Original CRISPR AGTGCATATAAGGGGAAAGC AGG (reversed) Intronic
908859153 1:68463816-68463838 AGTCCTTATAAGAGGAAAGCAGG - Intergenic
909699917 1:78511300-78511322 AGGGAATATATGGGGAAGGCTGG - Intronic
910035851 1:82787354-82787376 ACAGCACAAAAGGGGAAAGCTGG + Intergenic
911362777 1:96900052-96900074 AGTGCTTCCAAGGGGGAAGCAGG - Intergenic
912477134 1:109945974-109945996 AGTCCTTATAAGAGGAAGGCAGG - Intergenic
914724269 1:150314343-150314365 AGTGCATTTCAGGGGAAAAATGG - Intergenic
916751213 1:167724269-167724291 AGTGTATATAAGGGGAATGGTGG + Intronic
918085884 1:181244936-181244958 AATGGATATTAGGGGACAGCTGG + Intergenic
918241663 1:182625669-182625691 AGTGCAGATAAGGGGAATTGAGG - Intergenic
920037179 1:203073795-203073817 AATGGAGATAAGGGGAAGGCGGG + Intronic
920356398 1:205376409-205376431 AGTCCAAATAAGGGAAAAGTGGG - Intergenic
1063861869 10:10318335-10318357 AGTCCACAGAAGGGGAAAACAGG + Intergenic
1064172686 10:13047926-13047948 AGGGCTTAAAGGGGGAAAGCAGG + Intronic
1064569191 10:16674742-16674764 ACTGAATATAAGTGTAAAGCCGG + Intronic
1065251499 10:23819765-23819787 ATAGCATATAAAGGGAAATCTGG - Intronic
1065984091 10:30932146-30932168 AGTGCATATAGGGGCCAGGCAGG + Intronic
1067270184 10:44784798-44784820 AATGCATATTAGGAGAAAGCAGG + Intergenic
1069344863 10:67457043-67457065 AGTGGATAGAGGTGGAAAGCAGG + Intronic
1070690460 10:78521193-78521215 ATTGCATATAAGAGGAAGGAGGG + Intergenic
1072086070 10:92080489-92080511 TGTGCATATATGGTGGAAGCAGG + Intronic
1074080360 10:110163553-110163575 AGTGCTTATTAGGTGAAAGTAGG + Intergenic
1074809185 10:117085252-117085274 AGTGCATATATGAGAAAAGAAGG - Intronic
1078309118 11:10220765-10220787 AGGGTATATATGGGGAAAGGGGG - Intronic
1079164846 11:18030462-18030484 AATGCAAATAATGGGAAAGAAGG + Intronic
1079475658 11:20826513-20826535 AGTGCACACCAGGGGACAGCTGG + Intronic
1079805439 11:24924376-24924398 AGTAAATAAAAGGGGCAAGCGGG - Intronic
1080057929 11:27926695-27926717 CCTGCATAGAAGGGGAAGGCTGG - Intergenic
1080276136 11:30505131-30505153 AGTGCAAATGATGGGGAAGCAGG + Intronic
1081123587 11:39295838-39295860 ATTGCATAAAAATGGAAAGCAGG + Intergenic
1086356059 11:86001076-86001098 AGTGGATGAAAGGGAAAAGCAGG - Exonic
1088674698 11:112180893-112180915 AGTGTGTATAATGGGAAAGGTGG + Intronic
1089710298 11:120309733-120309755 AGGGAATAGAAGGGGATAGCGGG + Intronic
1091245266 11:134088175-134088197 TGTGAATTTAAGGGGAAAGCTGG - Intronic
1091310487 11:134571991-134572013 AGTGCAGATGAAGGGACAGCTGG + Intergenic
1091901976 12:4151686-4151708 AGTGCTTATAAAGTGAAAGTTGG + Intergenic
1092145255 12:6210302-6210324 AGTGCAGCCAAGGGGAAAGGAGG + Intronic
1093279847 12:17179796-17179818 AGTCAATATAAGGGGAAAATTGG - Intergenic
1095380876 12:41590139-41590161 AGTGCATGTTAGGGAAAAGCAGG + Intergenic
1095683750 12:45008505-45008527 ATTGCATATGAGGGGAGAGAGGG + Intergenic
1098621701 12:72608888-72608910 ATTGCAAATAAGGGTAGAGCTGG - Intronic
1101791756 12:107934010-107934032 AGTGCAATTAAGGGGGAAGGAGG + Intergenic
1102450250 12:113036782-113036804 AGGGCAAATAAGGGGAACCCGGG - Intergenic
1104702543 12:130918088-130918110 AGTGGATATCAGGGGAAAGTGGG + Intergenic
1109031896 13:57201027-57201049 AGTGAATAAAAGAGGAAAGAAGG - Intergenic
1111055774 13:82948176-82948198 AAAGCATATTAGGGGAAAACAGG + Intergenic
1115288083 14:31739827-31739849 AGTGCATATCAGGGGTCAGAGGG - Intronic
1115314085 14:32008247-32008269 AGAGAATATAAGAGGAAAGAAGG - Intronic
1116531912 14:45981839-45981861 AGTGCATCTAGGGTAAAAGCAGG - Intergenic
1119081086 14:71694377-71694399 ATTGCATATAAATGAAAAGCTGG + Intronic
1119684097 14:76616640-76616662 AGGGAATATAAAAGGAAAGCTGG - Intergenic
1121089251 14:91169979-91170001 TGGGGACATAAGGGGAAAGCTGG - Intronic
1121902225 14:97704084-97704106 GGTCCTTATAAGAGGAAAGCAGG - Intergenic
1125291484 15:38152895-38152917 AGTGTATATTAGGGGAAACTGGG + Intergenic
1127870732 15:63071229-63071251 ATTGCATTTAAGGGGTAAGCAGG - Exonic
1129789144 15:78329085-78329107 TGTCCTTATAAGGGGAAATCTGG - Intergenic
1129983341 15:79894849-79894871 AGTGAAGATGAGGGGAAAGGAGG - Intronic
1130083134 15:80752231-80752253 ATTAAATATAGGGGGAAAGCAGG + Intronic
1130152691 15:81323677-81323699 ATTGCATTTAAGGGGTAAGCAGG - Intronic
1135168144 16:20158449-20158471 AGTGCAGATATGGAAAAAGCAGG + Intergenic
1137920515 16:52483383-52483405 ATTGCCTAGAAGGGGAGAGCTGG + Intronic
1138165575 16:54798548-54798570 AGTGCATGCAAAGAGAAAGCAGG + Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1143859374 17:9877134-9877156 AGTGAATATAGTGGGAAAGAAGG - Intronic
1147020500 17:37528324-37528346 AGTCCTTATAAGGGGAAGGTAGG - Intronic
1147047835 17:37767864-37767886 AGTGCTTAGAAGGAGAAAGGAGG - Intergenic
1148069671 17:44900934-44900956 AGTCAATATCAGGGGAAAGAGGG - Intronic
1150946449 17:69751434-69751456 AGTCCTTATAAGGGGAAAAGAGG + Intergenic
1158028957 18:52939161-52939183 AGTGCATATAAGGGGAAAGCAGG - Intronic
1161911119 19:7194808-7194830 AGTCCATAAAAGAGCAAAGCTGG - Intronic
1166886969 19:45967601-45967623 AGTGACTAGAAGGGGAAAGACGG - Intronic
1166997085 19:46724769-46724791 AGTGGATGTGAGGGGAAGGCGGG + Intronic
1167741974 19:51329284-51329306 CGTGCATATATTGGGGAAGCAGG - Exonic
1168422956 19:56217301-56217323 AATGCCTAGAAGGAGAAAGCTGG - Intergenic
926705592 2:15835233-15835255 AATGGATACAAGGGGAGAGCAGG - Intergenic
927098425 2:19766355-19766377 AGTGGTTATCAGGGTAAAGCAGG - Intergenic
927918966 2:26956727-26956749 CGTGCACAGAAGAGGAAAGCTGG + Intergenic
929135001 2:38615144-38615166 TGTGCATATGTGGAGAAAGCTGG + Intergenic
930572088 2:53099686-53099708 AATGCTTATAAGGGCCAAGCTGG - Intergenic
931511932 2:63007542-63007564 ACTGCATTTAAAGGGAAAGTAGG - Intronic
931562806 2:63581216-63581238 AGTGCAAGGAAGGGGAAACCAGG + Intronic
933224481 2:79729755-79729777 AGTGCATTCAAGTGGAAGGCTGG + Intronic
934158242 2:89223033-89223055 AGTGCAGGTAAGAGGAAAGTGGG + Intergenic
934209022 2:89959391-89959413 AGTGCAGGTAAGAGGAAAGTGGG - Intergenic
935339252 2:102045304-102045326 AGGGCATATCAGGAGACAGCTGG - Intergenic
935896532 2:107744031-107744053 AGTACATATCTGGGGAAAGATGG + Intergenic
935918228 2:107982252-107982274 AGTGCATTTAAAAAGAAAGCTGG + Intergenic
938783205 2:134603810-134603832 AGTGTATATAAGGTGGAAGGTGG + Intronic
941607498 2:167617836-167617858 AGTGCATTAAAGAGGAAATCAGG - Intergenic
941877504 2:170449195-170449217 AGAGCTAATAAAGGGAAAGCTGG - Intronic
942832126 2:180250167-180250189 AGGGCAGATAAGGGAAAAGAGGG - Intergenic
945879483 2:215311676-215311698 AGTTCATATAGCGGCAAAGCTGG - Intergenic
946602579 2:221368687-221368709 AGTGCCTATAAGGGGACAAAGGG + Intergenic
946791732 2:223307810-223307832 AGTTTATATAAGGGAAATGCGGG - Intergenic
1171183606 20:23109463-23109485 AGTTCAGTAAAGGGGAAAGCAGG - Intergenic
1172438654 20:34949365-34949387 AGTGGATATAGTGGGAAAGAAGG - Intronic
1175440251 20:58985486-58985508 ACTCCATCTAAGGGCAAAGCAGG - Intronic
1176277959 20:64285052-64285074 AGTGCAGATTAGGGCAAAGAAGG + Intronic
1176973017 21:15288462-15288484 ATAGCATAAAAGGGGAAAGAAGG + Intergenic
1177808720 21:25901844-25901866 AGTCCAAATAAAGGGAAACCAGG - Intronic
1178423669 21:32461759-32461781 AGTGCACATTAGGGAAAAGAAGG - Intronic
1178914364 21:36698632-36698654 AGAGCTGAAAAGGGGAAAGCCGG - Intergenic
1179715725 21:43286929-43286951 AGTGAACATTAGGCGAAAGCAGG - Intergenic
1181121861 22:20673829-20673851 ACTGCAGATAATGGGAAAGTAGG + Intergenic
1182155618 22:28070129-28070151 AGTGCTTATATGGGGAAAAAAGG + Intronic
951419237 3:22464210-22464232 AGTGCAAATAATGGGAAATGAGG + Intergenic
952124548 3:30285100-30285122 GGTGCCTATAATGGGAAGGCCGG + Intergenic
952750851 3:36823747-36823769 TGTGCATATAAGGTAAAACCTGG + Intergenic
957426588 3:80047418-80047440 AGTACACATAGGAGGAAAGCAGG - Intergenic
961920182 3:130417386-130417408 AGTACATATTAGTGGAATGCTGG - Intronic
962919448 3:139937054-139937076 AGTGTCTATATTGGGAAAGCAGG - Intronic
963721353 3:148865645-148865667 ATTGAACATAAGGGGAAAGCAGG + Intronic
964619123 3:158703235-158703257 AGTTCACATAGAGGGAAAGCAGG - Intronic
964722843 3:159784368-159784390 ACTGCAGAGAAGGTGAAAGCTGG - Intronic
964817945 3:160737191-160737213 AGTACATGAAAGTGGAAAGCTGG - Intergenic
966965310 3:184985791-184985813 AGTCCATATAATGGAAAAACAGG - Intronic
973942781 4:55927096-55927118 AGTACATATAAGAGGACATCTGG + Intergenic
978473761 4:109101600-109101622 GGTGAATATTATGGGAAAGCAGG - Intronic
980316115 4:131202921-131202943 ATTGCATATAAGAGGAAAGATGG + Intergenic
986741914 5:10712113-10712135 TGTCCCTATAAGGGGAGAGCAGG + Intronic
986986846 5:13510188-13510210 AGTCCATATGAGAGGAAGGCAGG + Intergenic
987555650 5:19444245-19444267 ACTGTATATAAAGGGAAAGAAGG - Intergenic
988325336 5:29758148-29758170 ATTGCATATATGTGGAAAACTGG - Intergenic
988636470 5:32989785-32989807 AATGCCTATAAGGGGAAAAAGGG + Intergenic
990757070 5:59085127-59085149 AGTGCTTATAATGTGAAATCTGG + Intronic
991072810 5:62503686-62503708 AGTGAATAAAAGGAAAAAGCAGG + Intronic
991096399 5:62744522-62744544 ACTGCATAGAAGGAGAAAGCAGG - Intergenic
993791817 5:92219180-92219202 AGTGCAGACTAGGGGAAAGAAGG - Intergenic
994263939 5:97692283-97692305 AGTATATATTAGGGAAAAGCGGG + Intergenic
996782760 5:127206546-127206568 AGTGTTTATAGAGGGAAAGCGGG + Intergenic
996969326 5:129344411-129344433 AGTACATAGAAGGGGAAAAATGG + Intergenic
1000285312 5:159821407-159821429 AATGCTTATAAGGATAAAGCAGG - Intergenic
1001529016 5:172449271-172449293 ATCTCATATAAGGGGAAACCGGG + Intronic
1002754937 6:149490-149512 AGTGCAGATTAGGGCAAAGAAGG - Intergenic
1006374748 6:33665660-33665682 AGAGCATTTCAGGGGAAAGCCGG + Intronic
1007610462 6:43145619-43145641 GGTGCTGATAAAGGGAAAGCAGG - Intronic
1008577469 6:52874649-52874671 AGTGCATACAAGGAGAAATGAGG - Intronic
1012901164 6:105008133-105008155 ATTGAATATGAGGGGAAAACAGG - Intronic
1013055382 6:106577742-106577764 GGTCCTTATAAGGGGAAGGCAGG + Intronic
1013444644 6:110211685-110211707 AGGGCATAAGAGAGGAAAGCAGG + Intronic
1014383101 6:120768500-120768522 AGTGAAAATAAGGGGAAGCCAGG - Intergenic
1015227350 6:130872954-130872976 TGTGCAGATAAGGGCAAAGAAGG - Intronic
1017582758 6:155884533-155884555 AGTGTGTATAAGGAGAAAGATGG - Intergenic
1021919510 7:25470387-25470409 ATTGCATACAAAGGAAAAGCAGG + Intergenic
1022255775 7:28656116-28656138 AGTCCACATAGGGGTAAAGCTGG - Intronic
1024094757 7:45974737-45974759 AGTGCATTCAAGGTGAGAGCAGG - Intergenic
1028021766 7:85785510-85785532 AATGGATATCAGGGGAAAGATGG - Intergenic
1028408726 7:90504745-90504767 AGAAGATATAAAGGGAAAGCTGG + Intronic
1032192926 7:129774686-129774708 AGTGCCAATATGGGAAAAGCAGG - Intergenic
1034861066 7:154595227-154595249 AGTGCAGAAAAGGAGGAAGCTGG - Intronic
1036913853 8:12785615-12785637 AGTGGATATGAGGGGAATGTTGG + Intergenic
1038203908 8:25446156-25446178 AGTGTGTATAATGGGAAAGGTGG - Exonic
1040428067 8:47309177-47309199 AGTGCTTGTAAAGGGAAATCTGG + Intronic
1042709766 8:71704181-71704203 AGTGCAGAAAAGGAGAAATCAGG + Intergenic
1046452324 8:114410089-114410111 GCTGTATTTAAGGGGAAAGCTGG - Intergenic
1046504534 8:115120380-115120402 AGTGCATCCCTGGGGAAAGCAGG + Intergenic
1046719121 8:117599162-117599184 AGTTCATGTAAAGGGAAAGTGGG - Intergenic
1050069778 9:1798543-1798565 AGTGCATGTGAGGGGAAACCAGG - Intergenic
1050120428 9:2301961-2301983 AGTCCTTATAAAGGGAATGCAGG - Intergenic
1052510412 9:29411430-29411452 AGGACATAAAAGGGAAAAGCAGG + Intergenic
1053359887 9:37477269-37477291 AGTGTGTATAATGGGAAAGGTGG + Intergenic
1055827103 9:80339803-80339825 AGTGAATATAAGTGGTAGGCAGG + Intergenic
1056458361 9:86785210-86785232 AGTGGATATAATGGGATATCAGG + Intergenic
1056681895 9:88726367-88726389 CGTGCATATAAGGAAAAAACAGG - Intergenic
1056781551 9:89554775-89554797 AGTGGAAAGAAGGGGAGAGCAGG + Intergenic
1057564991 9:96159845-96159867 AGTCCAGACAATGGGAAAGCAGG + Intergenic
1058020480 9:100081246-100081268 AATGCAAATAATGGAAAAGCTGG + Intronic
1058469681 9:105264579-105264601 AGTGCATATTAATAGAAAGCTGG - Intronic
1059014112 9:110495391-110495413 GGTCCTTATAAGGGGAAGGCAGG + Intronic
1188477734 X:30605034-30605056 AGGGAATAGAAGGAGAAAGCAGG + Intergenic
1188976549 X:36682757-36682779 AATGCTGATAAGGGGAAAGAAGG - Intergenic
1189595435 X:42559925-42559947 TGTGGATATAATGGGAATGCGGG + Intergenic
1192773516 X:74217827-74217849 AGTGCAGGTAAGGGGATAGCTGG + Intergenic
1192861970 X:75083990-75084012 AGTACTTATAAGAGGAAAGTAGG + Intronic
1194969516 X:100327610-100327632 AGTACATATAAAAGGAAATCTGG + Intronic
1195271669 X:103237225-103237247 AGTGCATATAGGATAAAAGCAGG - Intergenic
1195291686 X:103435986-103436008 AGTGCAAATAAAGAGAAGGCAGG + Intergenic
1195485912 X:105405870-105405892 AGTGTGTATAATGGGAAAGGTGG + Intronic
1195496089 X:105535638-105535660 AGTGCCTATAAGATGAATGCAGG - Intronic
1196039598 X:111187985-111188007 ATTGCATATATGGAGTAAGCGGG + Intronic
1197523481 X:127529309-127529331 AGTGCAAATAAGGGGAATCCAGG - Intergenic
1202370208 Y:24191081-24191103 AGTGCAAATTTGGGGCAAGCTGG - Intergenic
1202500576 Y:25479036-25479058 AGTGCAAATTTGGGGCAAGCTGG + Intergenic