ID: 1158029078

View in Genome Browser
Species Human (GRCh38)
Location 18:52940474-52940496
Sequence CAGCGTAAATAGAATCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158029078_1158029083 7 Left 1158029078 18:52940474-52940496 CCACCATGATTCTATTTACGCTG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1158029083 18:52940504-52940526 GAATGTGCTCCCCTGGAGGATGG 0: 1
1: 0
2: 0
3: 12
4: 208
1158029078_1158029082 3 Left 1158029078 18:52940474-52940496 CCACCATGATTCTATTTACGCTG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1158029082 18:52940500-52940522 GGTAGAATGTGCTCCCCTGGAGG 0: 1
1: 0
2: 0
3: 16
4: 114
1158029078_1158029081 0 Left 1158029078 18:52940474-52940496 CCACCATGATTCTATTTACGCTG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1158029081 18:52940497-52940519 ATTGGTAGAATGTGCTCCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 84
1158029078_1158029084 8 Left 1158029078 18:52940474-52940496 CCACCATGATTCTATTTACGCTG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1158029084 18:52940505-52940527 AATGTGCTCCCCTGGAGGATGGG 0: 1
1: 0
2: 0
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158029078 Original CRISPR CAGCGTAAATAGAATCATGG TGG (reversed) Intronic
905283522 1:36864490-36864512 GAGGGTAAATCGAGTCATGGAGG - Intronic
906419698 1:45654782-45654804 CAGAGTCCACAGAATCATGGCGG + Exonic
907325271 1:53633922-53633944 CAGTGAACAGAGAATCATGGCGG + Intronic
909755644 1:79221699-79221721 GAGCGATAATTGAATCATGGGGG + Intergenic
910540400 1:88349644-88349666 CAGGAAACATAGAATCATGGTGG + Intergenic
910649405 1:89549324-89549346 CAGGGTTAATAGAAACATGAAGG - Intronic
918485315 1:185022529-185022551 CAGCGTTAATCGATTCATGATGG + Intergenic
918699980 1:187596743-187596765 CAGTGGTAATTGAATCATGGGGG - Intergenic
921649304 1:217658040-217658062 CAGAGATAATTGAATCATGGGGG - Intronic
1063645368 10:7876602-7876624 CACCGTATACAGAATCACGGGGG + Intronic
1069404108 10:68079687-68079709 CAGGATAGATAGAAACATGGGGG + Intergenic
1070407216 10:76107598-76107620 CAGCGGAAACAGAGCCATGGAGG - Intronic
1071665729 10:87555677-87555699 TAGGGGTAATAGAATCATGGAGG - Intergenic
1077193255 11:1264972-1264994 CAGAGGTAATTGAATCATGGGGG - Intergenic
1077193587 11:1267212-1267234 CAGAGGTAATTGAATCATGGGGG - Intergenic
1079157151 11:17958737-17958759 CAGCTTGAAAAGAGTCATGGAGG - Intronic
1081305565 11:41508002-41508024 GAGAGTTAATTGAATCATGGGGG + Intergenic
1085360780 11:75883735-75883757 CAGCTTGTATAGAATCAGGGAGG + Intronic
1087083870 11:94197296-94197318 CAGAGATAATTGAATCATGGGGG + Intergenic
1092597830 12:10026818-10026840 GAGAGGTAATAGAATCATGGGGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098870199 12:75808830-75808852 CGGAGAAAATTGAATCATGGAGG + Intergenic
1101116183 12:101533781-101533803 CAGAGTAGTGAGAATCATGGAGG + Intergenic
1104085228 12:125468451-125468473 CAGCATGAATGAAATCATGGAGG + Intronic
1106721951 13:32444023-32444045 CAGTCAGAATAGAATCATGGAGG - Exonic
1110978765 13:81870376-81870398 CAGCCTATATAGCAGCATGGTGG - Intergenic
1111378921 13:87420046-87420068 CAGTTTTAATTGAATCATGGGGG - Intergenic
1111915694 13:94357634-94357656 CAGTGAAAATAGACACATGGTGG - Intronic
1112622992 13:101071077-101071099 CAGAGATAATTGAATCATGGGGG - Intronic
1112626164 13:101106604-101106626 CAGAGATAATTGAATCATGGGGG + Intronic
1112788251 13:102975405-102975427 CAGCATAAATAAAATTATGGGGG - Intergenic
1117334685 14:54746962-54746984 CAGCAGAAATAAAAGCATGGTGG + Intronic
1120442464 14:84558136-84558158 GGGAGAAAATAGAATCATGGGGG - Intergenic
1121499195 14:94419983-94420005 CAGAGTTAATGGAATCATGAGGG + Intergenic
1124380582 15:29161789-29161811 CAGCACACATAGGATCATGGTGG + Intronic
1126367599 15:47912020-47912042 CAGAGTAAATAGAATAAAGCAGG - Intergenic
1128989670 15:72249204-72249226 CAATGTAAATAGAGTCAAGGTGG + Intronic
1130336238 15:82959321-82959343 CAAGGTAAATAGATTCAGGGTGG + Intronic
1131427506 15:92358541-92358563 CAGAGATAATTGAATCATGGTGG - Intergenic
1131789846 15:95952392-95952414 GAGAGTTAATTGAATCATGGAGG - Intergenic
1134332167 16:13261059-13261081 CAGAGGTAATTGAATCATGGGGG - Intergenic
1137299402 16:47133270-47133292 CAGCTTAAATAAGAACATGGAGG + Intronic
1149098791 17:52877959-52877981 AAGCATGAATACAATCATGGAGG + Intronic
1150576933 17:66438858-66438880 CAGAGATAATTGAATCATGGGGG - Intronic
1152326930 17:79647022-79647044 CAGAGGAAATAAAATCAAGGAGG - Intergenic
1158029078 18:52940474-52940496 CAGCGTAAATAGAATCATGGTGG - Intronic
1165174484 19:33917584-33917606 CAGAGATAATTGAATCATGGGGG + Intergenic
1165371591 19:35410718-35410740 CAGAAAACATAGAATCATGGTGG + Intergenic
1166934639 19:46323880-46323902 CAGCGATAATTGAATCATGGGGG - Intronic
925972389 2:9114813-9114835 CAGTGGTAATTGAATCATGGGGG + Intergenic
926874591 2:17461024-17461046 CTGGGTAAATAGAATAATAGAGG - Intergenic
926979814 2:18556849-18556871 CAGGGTAAATGGCACCATGGGGG + Intronic
928153564 2:28855205-28855227 CAGATTACATAGAATCATGCAGG + Intronic
935260030 2:101346256-101346278 CACTGTAAATAAAAACATGGTGG + Exonic
942710008 2:178823168-178823190 CAGAGAAAAAATAATCATGGTGG - Intronic
943864626 2:192914028-192914050 CAGAGGCAATTGAATCATGGAGG - Intergenic
944899437 2:204199202-204199224 AAGCAAAAATAGTATCATGGGGG - Intergenic
945225817 2:207530296-207530318 CAGCGAACAAAGAATAATGGCGG + Intronic
946247861 2:218397618-218397640 CAGGAAAAATAAAATCATGGGGG - Intergenic
1169564042 20:6833354-6833376 CAGAGTAAAAAGAACCATGAAGG + Intergenic
1170364800 20:15587286-15587308 CAGAGGTAATTGAATCATGGGGG - Intronic
1174749704 20:53099781-53099803 CAGAGACAATTGAATCATGGGGG - Intronic
1177035670 21:16039460-16039482 TAGAGAAAATTGAATCATGGGGG - Intergenic
1177492869 21:21850239-21850261 AATAGTAAGTAGAATCATGGAGG + Intergenic
1177770664 21:25512004-25512026 CAAAGTAACTAGAATCAAGGAGG - Intergenic
1178117656 21:29434177-29434199 CAGAGTTAATTGAATCATAGGGG + Intronic
1183041248 22:35179787-35179809 CAGCGAACATACAGTCATGGAGG + Intergenic
952631647 3:35477150-35477172 CAGCCGTAATTGAATCATGGGGG + Intergenic
956500870 3:69883664-69883686 GACCCTAAATAGCATCATGGTGG + Intronic
956558197 3:70544081-70544103 CAGTGTAAATACAATTAGGGAGG + Intergenic
957158975 3:76584042-76584064 CTGCTTAAATAGAAGCAAGGAGG - Intronic
958151852 3:89702083-89702105 CAGAGATAATTGAATCATGGGGG - Intergenic
958483950 3:94679430-94679452 GAGAGGTAATAGAATCATGGGGG + Intergenic
959443159 3:106404614-106404636 GAGAGGTAATAGAATCATGGGGG - Intergenic
961342850 3:126240665-126240687 CAGCTGAACTTGAATCATGGGGG + Intergenic
964275243 3:155002818-155002840 TAGAGTTAATTGAATCATGGGGG + Intergenic
964836298 3:160941452-160941474 CAGAGGTAATTGAATCATGGGGG + Intronic
970789077 4:19835229-19835251 TGGAGTTAATAGAATCATGGGGG + Intergenic
971384297 4:26128776-26128798 GAGAGATAATAGAATCATGGGGG + Intergenic
971557667 4:28035457-28035479 CAGGGAAATTACAATCATGGTGG + Intergenic
974437736 4:61878010-61878032 CAGCGAACTTACAATCATGGCGG - Intronic
974658483 4:64855649-64855671 CAGGGGTAATTGAATCATGGGGG + Intergenic
979019807 4:115481835-115481857 CAGGGAACTTAGAATCATGGCGG - Intergenic
980209204 4:129764224-129764246 CAGGGAACATACAATCATGGAGG + Intergenic
980824214 4:138053931-138053953 CAGCACAAATAGAAACATGCAGG + Intergenic
982477104 4:155867488-155867510 GAGAGTTAATTGAATCATGGAGG - Intronic
983297916 4:165890169-165890191 GAGAGTTAATTGAATCATGGGGG - Intronic
984275384 4:177603453-177603475 CAGAGATAATTGAATCATGGGGG - Intergenic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
987512216 5:18855196-18855218 GAGAGAAAATTGAATCATGGGGG + Intergenic
987617705 5:20298006-20298028 AAGTGAAAATAGAATAATGGGGG - Intronic
990326357 5:54679657-54679679 CAGTTTAAATAAAATTATGGCGG + Intergenic
995391982 5:111649797-111649819 CACTGGAAATGGAATCATGGGGG - Intergenic
995488428 5:112663269-112663291 GGGCGGTAATAGAATCATGGAGG + Intergenic
997204287 5:132033520-132033542 CAGAGAAAGTATAATCATGGAGG + Intergenic
998753829 5:145353724-145353746 GGGAGTAAATTGAATCATGGAGG - Intergenic
1006731326 6:36238531-36238553 CAGGAAACATAGAATCATGGCGG + Intergenic
1010450272 6:75994690-75994712 CAGAGGTAATTGAATCATGGGGG - Intronic
1014639515 6:123892371-123892393 CAGGGAAATTACAATCATGGTGG + Intronic
1015195607 6:130521970-130521992 GAGAGAAAATTGAATCATGGGGG - Intergenic
1016253075 6:142070820-142070842 GAGAGGAAATTGAATCATGGGGG + Intronic
1017429887 6:154360709-154360731 TAGAGGAAATTGAATCATGGGGG - Intronic
1019840249 7:3434788-3434810 GAGTGTAGATAGAATCATGGGGG + Intronic
1021173001 7:17418282-17418304 CAGCCTATATAGCAGCATGGTGG - Intergenic
1028272661 7:88812077-88812099 CAGAGTAATTAAAATCATGTAGG + Intronic
1033502252 7:141963659-141963681 TAGGGTAATTAAAATCATGGAGG - Intronic
1034623257 7:152472513-152472535 GGGAGGAAATAGAATCATGGAGG + Intergenic
1045888669 8:107128539-107128561 TAGAGAAAATTGAATCATGGGGG - Intergenic
1047919366 8:129618112-129618134 GAAGGTAAATTGAATCATGGGGG + Intergenic
1048203930 8:132400722-132400744 CAGCGTATAAAGAATCAGAGTGG + Intronic
1048217789 8:132512348-132512370 CAGTGTTAGTGGAATCATGGGGG - Intergenic
1056761500 9:89418799-89418821 CTGTGTTAATAGAATCATGGAGG - Exonic
1059702736 9:116791513-116791535 CAGTGTAAACAAGATCATGGGGG + Intronic
1186217176 X:7312563-7312585 CAGAGGTAATTGAATCATGGGGG + Intronic
1193199107 X:78666572-78666594 CAGAGATAATTGAATCATGGGGG + Intergenic
1193792582 X:85833537-85833559 CAGAGATAATTGAATCATGGGGG + Intergenic
1196547125 X:116975393-116975415 AAGAGAAAATTGAATCATGGGGG + Intergenic
1197314053 X:124942016-124942038 GAGAGAAAATTGAATCATGGGGG - Intronic
1197400239 X:125980554-125980576 CAGAGGTAATTGAATCATGGGGG - Intergenic
1199613525 X:149637200-149637222 GAGAGTTAATTGAATCATGGGGG + Intergenic
1201529770 Y:14979043-14979065 CAGGGTGAAGAGTATCATGGTGG - Intergenic
1201632623 Y:16085925-16085947 TAGAGATAATAGAATCATGGGGG - Intergenic