ID: 1158030896

View in Genome Browser
Species Human (GRCh38)
Location 18:52963515-52963537
Sequence CACAGGAGTCTGAAGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158030896 Original CRISPR CACAGGAGTCTGAAGTGGTC AGG Intronic
900191546 1:1354303-1354325 CCCAGGAGACTGAGGTGGGCGGG - Intronic
901441165 1:9279348-9279370 CACAGGAGACTGAGGTGGGAGGG + Intergenic
901559227 1:10056919-10056941 CTCAGGAGGCTGAGGTGGGCTGG - Intronic
902144985 1:14391167-14391189 CAGGGGAGCCTGAAGTGGTGAGG + Intergenic
902738116 1:18414592-18414614 CACTGCATTCTGATGTGGTCTGG + Intergenic
903122261 1:21224012-21224034 GACAGAAGCCTGGAGTGGTCTGG + Intronic
905231469 1:36517170-36517192 CACAGCAGAATGGAGTGGTCAGG - Intergenic
905236257 1:36551536-36551558 CTCAGGAGGCTGAAGTGGGAGGG + Intergenic
905600202 1:39243507-39243529 CTCAGGAGTCTGAGGTGGGAGGG - Intronic
906226524 1:44127002-44127024 CTCAGGAGGCTGAAGTGGAAAGG - Intronic
906564613 1:46789972-46789994 CCCATGTGTCTGAAGAGGTCTGG - Intronic
908085023 1:60622710-60622732 CTCAGGAGGCTGGAGTGGGCTGG + Intergenic
908540120 1:65114205-65114227 CACAGGAGGCTGAGGTGGGAAGG + Intergenic
911110951 1:94184644-94184666 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
911372900 1:97015345-97015367 CACAGGAGACTGAAGTATTTAGG + Intergenic
912429753 1:109622846-109622868 AGAAGGAGTCAGAAGTGGTCTGG + Intronic
913266169 1:117046955-117046977 TACAGGAGTCTAAAGTGGCTGGG + Intergenic
916167077 1:161973825-161973847 CTCAGGAGTCTGAAGAGGATGGG + Intergenic
917020373 1:170580220-170580242 TAAAGGAGTCTGAGGTGTTCAGG - Intergenic
918112853 1:181472870-181472892 CACAGGAGTCTATAATGTTCAGG - Intronic
918607809 1:186450444-186450466 CTCAGGAGACTGACGTGGTAAGG - Intronic
919147308 1:193651758-193651780 CACTGCAGACTGAAGTGTTCTGG - Intergenic
919631187 1:199961395-199961417 CTCAGGAGGCTGAAGTGGAAAGG + Intergenic
919853845 1:201692493-201692515 AACAGGAGTTTGTAATGGTCTGG + Intronic
919879845 1:201894406-201894428 CAGAGGAGACTGCAGTGGTTTGG - Intergenic
921838275 1:219800925-219800947 CACAGGAGTCAGGGGTGGCCAGG + Intronic
922118569 1:222638587-222638609 CTCAGGAGGCTGAAGTGGGAAGG + Intronic
922642132 1:227245035-227245057 CACTGCAGGCTGAAGTGCTCTGG + Intronic
922643276 1:227258065-227258087 CTCAGGAGACTGAAGTGGGAGGG + Intronic
923129440 1:231062603-231062625 CACAGAAGTCTTAAGTGCTTAGG + Intergenic
924494005 1:244568711-244568733 CACAGCAGTCTGAAGTGACCTGG - Intronic
1064091256 10:12387612-12387634 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
1064520838 10:16199004-16199026 CTCAGGAGGCTGAGGTGGGCAGG + Intergenic
1065002158 10:21347007-21347029 CTCAGGAGTCTGAGGTGGGAGGG - Intergenic
1067571892 10:47377917-47377939 CCCAGGTGCCTGAAGTGGCCTGG - Intronic
1068222795 10:54064640-54064662 CACAGGAGGCTGAGGTGGCAGGG + Intronic
1070035577 10:72719977-72719999 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
1070316218 10:75315250-75315272 CTCAGGAGGCTGAAGTGGGAGGG + Intergenic
1070975002 10:80599535-80599557 CACATGGGTGTGAAGTGCTCTGG + Intronic
1071575092 10:86719282-86719304 CGCAGGAGGCTGAAGTGGGAGGG + Intronic
1072375692 10:94813655-94813677 CACAGCAGTCTGAAGTTGACTGG - Intronic
1072389568 10:94969307-94969329 CACAGCAGTCTGAAGTTGACTGG - Intronic
1073301490 10:102473704-102473726 CACAGCAGGCTGAGGTGGTCCGG - Exonic
1074413535 10:113247682-113247704 CTGAGGAGTCTGCAGTGGGCTGG + Intergenic
1075496834 10:122928539-122928561 CACAGGAGTCTATAGGGGTTTGG - Intergenic
1078431172 11:11289937-11289959 CAGAGGAGTCTGAAGAGGGCTGG + Intronic
1080212680 11:29805282-29805304 CACAGCACTCTGAACTGGTTAGG + Intergenic
1082099033 11:48156692-48156714 CACAGGAGGCTGAAGTGGGAGGG - Intronic
1084079405 11:66811059-66811081 CTCAGGAGGCTGAAGTGGGAAGG - Intronic
1084180325 11:67442845-67442867 CTCAGGACTCAGCAGTGGTCAGG - Intronic
1084884266 11:72193227-72193249 CTCAGGAGGCTGAGGTGGGCAGG + Intronic
1085120538 11:73964721-73964743 CACAGGACACTGAAGAGGTTGGG + Intronic
1085189478 11:74605974-74605996 CTCAGGAGGCTGAAGTGGGAAGG + Intronic
1085266288 11:75240027-75240049 CCCAGGAGTCTTAAGAGGTTTGG + Intergenic
1086392510 11:86379874-86379896 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1086873779 11:92070823-92070845 CTCAGGAGGCTGAAGTGGGAGGG + Intergenic
1086904769 11:92405641-92405663 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1087745887 11:101946398-101946420 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1090044241 11:123316947-123316969 CACAGGTGTTGCAAGTGGTCAGG + Intergenic
1091367904 11:135037512-135037534 CACAGGAGACTAATGTTGTCAGG + Intergenic
1091617582 12:2061399-2061421 AACCAGAGTCTGAGGTGGTCTGG + Intronic
1092898659 12:13037953-13037975 CTCAGGAGGCTGAAGTGGGAAGG + Intergenic
1094172633 12:27509736-27509758 CACAGGAGGCTGAGGTGGGAGGG - Intergenic
1097142751 12:56916495-56916517 CTCAGGAGGCTGAGGTGGGCGGG - Intergenic
1097835507 12:64269026-64269048 CTCAGGAGGCTGAAGTGGAAGGG + Intronic
1100177878 12:92051388-92051410 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1100544833 12:95591628-95591650 CTGAGGTGTCTGCAGTGGTCAGG - Intergenic
1100946325 12:99787995-99788017 CACTGCAGGCTGAAGTGCTCTGG + Intronic
1101466078 12:104950610-104950632 CTCAGGAGACTGAGGTGGTAGGG - Intronic
1102322455 12:111948986-111949008 CTCAGGAGGCTGAGGTGGTGGGG + Intronic
1103387503 12:120544547-120544569 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1103937149 12:124482766-124482788 CAGACGAGCCTGAAGTTGTCTGG + Intronic
1104695254 12:130858692-130858714 CTCAGGAGTCTGAGGTGGGAGGG + Intergenic
1106449728 13:29869373-29869395 CTCAGGAGGCTGAGGTGGTTGGG + Intergenic
1109751854 13:66703787-66703809 CTCAGGAGGCTGAAGTGGGAAGG + Intronic
1112953595 13:105032949-105032971 CACAGAAGTATGAGGTGGTGAGG + Intergenic
1114247986 14:20932849-20932871 CACAGTAGGCTAAAGTGCTCTGG + Intergenic
1114250819 14:20958948-20958970 CACAGTAGGCTAAAGTGCTCTGG + Intergenic
1115265367 14:31494682-31494704 CACAGCAGTCTGAAGTTGACCGG + Intronic
1115637534 14:35304968-35304990 CTCAGGAGACTGAAGTGGGAGGG + Intronic
1117384346 14:55195633-55195655 CACAGCAGGCTGAAGTGCTCTGG - Intergenic
1118096828 14:62546555-62546577 CACTGCAGGCTAAAGTGGTCTGG + Intergenic
1118202578 14:63690145-63690167 CTCAGGAGGCTGAAGTGGGGAGG - Intronic
1118578137 14:67265446-67265468 CACAGGAGGCTGAGGTGGGAGGG + Intronic
1119275397 14:73350637-73350659 CACAGGAGGCTGAGGTGGGAAGG - Intronic
1123539109 15:21269863-21269885 CACAGGAGGCTGAGGTGGGAGGG - Intergenic
1123819984 15:24019101-24019123 CACAGGAGACTGAGGTGGGAGGG - Intergenic
1124357654 15:29008599-29008621 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1127127459 15:55825878-55825900 CACCGGAGTCTGCAGTGATTAGG + Intergenic
1127861411 15:62997206-62997228 CACAGGAGGCTGAGGTGGGAGGG + Intergenic
1128426437 15:67546143-67546165 CACAGGAGTCTGCCATGATCTGG - Intronic
1129960797 15:79682195-79682217 CCCAGGAGTTTGGAGAGGTCTGG + Intergenic
1132684450 16:1156485-1156507 CCCAGGAATCTGAAGCGCTCTGG - Intronic
1133050311 16:3113694-3113716 CACAGGAGATGGAAGAGGTCTGG + Intronic
1133173741 16:3998301-3998323 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1134171174 16:11970959-11970981 CACAGGAGCCTGAGGTGGGAGGG - Intronic
1136126554 16:28186778-28186800 CTCAGGAGGCTGAAGTGGGGAGG - Intronic
1136143789 16:28303620-28303642 CTCAGGAGACTGAAGTGGGAGGG - Intronic
1136468145 16:30459315-30459337 CCCAGGAGGCTGAAGTGGGAGGG - Intergenic
1138188888 16:54998219-54998241 CCCAGGAGCCTGAGGTGGGCAGG - Intergenic
1138215855 16:55204816-55204838 CACAGGACTCAGCAGTGGACTGG + Intergenic
1138229270 16:55325424-55325446 TACAGAAGTCTGAGGTGGCCGGG + Intronic
1138296207 16:55887343-55887365 AACAAGAGTCTGAAGTCATCAGG - Intronic
1139466362 16:67156106-67156128 CACAGGAGGCTGAAGCGGGTTGG - Intronic
1139843156 16:69898425-69898447 CACAGGAGTATGAATTGGTTAGG - Intronic
1141583935 16:85020472-85020494 CCCAGGACTCTGACTTGGTCTGG + Intergenic
1142016264 16:87749689-87749711 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
1142817699 17:2440045-2440067 TACAGGAGTTTGAACTAGTCTGG + Intronic
1143413612 17:6728605-6728627 CACTGCAGGCTGAAGTGCTCTGG + Intergenic
1144007775 17:11116675-11116697 CCCAGGAGGCTGAGGTGGGCAGG - Intergenic
1145842159 17:28004477-28004499 CAAAGGAGACTGAAATGGTGAGG + Intergenic
1146494940 17:33313216-33313238 CTCAGGAGGCTGAGGTGGGCAGG + Intronic
1146863002 17:36321448-36321470 CTCAGGAGGCTGAAGTGGGAAGG + Intronic
1147093331 17:38125531-38125553 CTCAGGAGGCTGAAGTGGGAAGG + Intergenic
1147103876 17:38194957-38194979 CTCAGGAGGCTGAAGTGGGAAGG - Intergenic
1147187268 17:38719696-38719718 CAGAGGAGCCTGGAGTGGTCGGG + Intronic
1147981615 17:44278302-44278324 AACAAGAGAATGAAGTGGTCAGG + Intergenic
1148425615 17:47593449-47593471 CTCAGGAGGCTGAAGTGGGAAGG + Intronic
1149291577 17:55223242-55223264 CTCAGGAGGCTGAAGTGGAAGGG - Intergenic
1150849463 17:68690712-68690734 CACAGGACCCAGAAGTGGACTGG + Intergenic
1150975658 17:70083809-70083831 CACTGGAGTCTAAAGTTGTAGGG + Intronic
1151572549 17:74934224-74934246 CTCAGGAGGCTGAAGTGGGGGGG - Intergenic
1151957086 17:77385836-77385858 CCCAGGAGGGTGAAGTGGGCTGG + Intronic
1152393247 17:80015551-80015573 CACAAAAGTCTGCAGAGGTCAGG + Intronic
1153680435 18:7495520-7495542 CTCAGGAGGCTGAGGTGGTAGGG - Intergenic
1156351012 18:36300846-36300868 CACAGGAGGCTGAGGTGGGAGGG - Intronic
1156447551 18:37248736-37248758 CAGAGGACTATGAAGTGGTGAGG - Intronic
1156960109 18:43017699-43017721 CACAGGAGACTTATGTGGTAGGG + Intronic
1157571444 18:48714982-48715004 CACAGGTGTCTGCAGTGAGCGGG + Intronic
1157902788 18:51536293-51536315 CACAGGAATCTTAAGAGTTCTGG - Intergenic
1158030896 18:52963515-52963537 CACAGGAGTCTGAAGTGGTCAGG + Intronic
1158949149 18:62475646-62475668 CACATTAGTCTGCAGTGGTGAGG + Intergenic
1159266205 18:66083132-66083154 CAAAGGAGGCTGCAGTGATCAGG - Intergenic
1159556471 18:69951072-69951094 CCCAGGAGGCTGAAGTGGGAGGG - Intronic
1161572007 19:5035904-5035926 CACAGGAGACTGAGGTGGGGAGG + Intronic
1161804559 19:6435114-6435136 CACAGGAGGCTGAGGTGGGAGGG + Intergenic
1163135346 19:15307121-15307143 CAGAGGTGACTGAACTGGTCAGG + Intronic
1163679134 19:18670615-18670637 CAGAGGAGTCGGCAGTGGGCTGG + Exonic
1164851522 19:31488307-31488329 CACAGCATTCTGAAATGATCTGG - Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165134125 19:33655046-33655068 CCCAGGAGTCTGACAGGGTCTGG + Intronic
1165531332 19:36404398-36404420 AACAGGAGTGTGGAGTGGTGGGG - Intronic
1165927205 19:39334373-39334395 CACAGGAGGCTGAGGTGGGAGGG - Intronic
1166728132 19:45041283-45041305 GACAGGAGAGGGAAGTGGTCAGG - Intronic
1167000321 19:46741906-46741928 CCCAGGAAGCTGAAGTGGGCAGG + Intronic
1167430882 19:49453747-49453769 CACAGGAATCCTAAGGGGTCTGG - Intronic
925217410 2:2109328-2109350 CACAGGAATCTGGAGGGGGCTGG - Intronic
927773962 2:25887722-25887744 CACAGGAGTCTGAAGTGCTCAGG - Intergenic
931017282 2:57997785-57997807 CTCAGGAGGCTGAAGTGGGTGGG + Intronic
932124859 2:69134790-69134812 CTCAGGAGTTTGAAGTACTCTGG - Intronic
932171014 2:69556448-69556470 CACAGGATTTTGAAGAGCTCAGG + Intronic
933316417 2:80720668-80720690 CTCAGGAGGCTGAGGTGGTAGGG - Intergenic
934534182 2:95119502-95119524 CACAGGAGGCTGAAGTGGGAGGG + Intronic
936906150 2:117537317-117537339 TACAGGCGTCTCCAGTGGTCAGG + Intergenic
937512417 2:122611278-122611300 CATAGGAGGCTAAAGTGCTCTGG + Intergenic
937988216 2:127648114-127648136 CACAGTACTCTGACTTGGTCTGG - Exonic
938916539 2:135946887-135946909 CTCAGGAGTCTGAAGTGGGAGGG - Intronic
939772938 2:146346316-146346338 CACATGGCTCTGAAGTGGTCTGG - Intergenic
940657213 2:156502532-156502554 CTCAGGAGGCTGAGGTGGTAGGG - Intronic
942707476 2:178792958-178792980 CACATGAGTTTGAAGTGGAATGG - Intronic
943757743 2:191574647-191574669 CACAGGAAGCTGAAGAGGTGAGG - Intergenic
944497178 2:200318906-200318928 GACAGTAGTCTGCAGTGCTCCGG + Intronic
945783994 2:214211337-214211359 CAAATGATTTTGAAGTGGTCAGG + Intronic
946756403 2:222952157-222952179 CACACTAGTTTGATGTGGTCTGG + Intergenic
947182102 2:227420465-227420487 CACAGGAGCAGAAAGTGGTCAGG - Intergenic
947707397 2:232287504-232287526 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
947820962 2:233069116-233069138 AACAGGAGCCTGAAGTGAGCAGG - Intronic
948440601 2:237984885-237984907 CTCAGGAGTCTGAGGTGGGAAGG - Intronic
949032779 2:241804859-241804881 CAAAGGAGGCTGGAGTGGTTGGG + Intergenic
1174838277 20:53877981-53878003 CTGAGGAGTCAGAAGTGCTCTGG - Intergenic
1175086653 20:56465134-56465156 CTCAGAAGTCTGAAATGGGCCGG + Intergenic
1177193707 21:17880284-17880306 CTCAGGAGGCTGAGGTGGTAGGG + Intergenic
1181521340 22:23450306-23450328 CACAGGAGTCTCAGGTGCTGTGG - Intergenic
1182496449 22:30711630-30711652 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1183513058 22:38247071-38247093 CAGAGGAGGCTGATGTGGGCTGG - Intronic
1185072177 22:48662413-48662435 AAGAGGAGTCTGCAGAGGTCAGG + Intronic
950064384 3:10100078-10100100 CACAGGAGGCTGAGGTGGGAGGG + Intronic
952371352 3:32726050-32726072 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
954270778 3:49506867-49506889 CTCAGGAGGCTGAGGTGGTGGGG + Intronic
956081500 3:65561486-65561508 CAAAGGATCCTGAAGTGTTCAGG + Intronic
957390323 3:79558111-79558133 AACAGGAGTTTGAACTGGGCAGG + Intronic
958501998 3:94923214-94923236 CTTAGGAGTCTGAAGTGGGAGGG + Intergenic
959875687 3:111379810-111379832 CACAGCAGTCTGAAGTCTACTGG + Intronic
961184129 3:124899744-124899766 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
961189300 3:124944224-124944246 CTCAGGAGTCTGAAGCAGTAGGG + Intronic
961863296 3:129935110-129935132 GAAAGTAGTGTGAAGTGGTCAGG - Intergenic
962815396 3:138992770-138992792 CACAGTGGTCTGCAGAGGTCAGG - Intergenic
963071201 3:141306807-141306829 CACTGGCTTCTGAAGTGCTCTGG - Intergenic
963338358 3:144003187-144003209 CTCAGGAGTCTGAGGTGGGAGGG + Intronic
966595217 3:181719698-181719720 CAGAGGACTCTGGAGTGGTGAGG - Intergenic
969487436 4:7480149-7480171 CACAGGGGTCTGAAGTGTGGTGG + Intronic
973572630 4:52256158-52256180 TACAGGAGGCTGAAGTGGCCAGG + Intergenic
975696717 4:77021293-77021315 CACTGGATTCTGACGGGGTCTGG - Intronic
976609942 4:87019865-87019887 GACTGGTGTCTGAAGGGGTCGGG + Intronic
976965568 4:91036012-91036034 CACAGGAGTCGGATGTGGGCAGG + Intronic
978729543 4:112009420-112009442 CACAGGATTCAGGAGTGGTGAGG - Intergenic
982027333 4:151263912-151263934 CTCAGGAGGCTGAAGTGGGGAGG - Intronic
982172087 4:152671796-152671818 CACAGGAGTCTGAACTGGCAGGG + Intronic
982828380 4:160028095-160028117 CACAGCAGGCTGAAGTGCTTTGG - Intergenic
983840855 4:172455479-172455501 CACAGCAGCCTGAAGTGACCTGG + Intronic
985347016 4:189016848-189016870 CATATTAGTCTGAAGTGGTTTGG - Intergenic
986636983 5:9832895-9832917 GACATGTGTCTGAGGTGGTCAGG + Intergenic
987019256 5:13852640-13852662 CACAGCAGTCTGAAGTCGACCGG + Intronic
988630892 5:32930514-32930536 CTCAGGAGGCTGAAGTGGGAGGG - Intergenic
989598454 5:43179913-43179935 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
990653649 5:57930582-57930604 CACAGAAGTCTGAGCTGGACAGG - Intergenic
992634925 5:78718235-78718257 CACATGAGCATGAAGTGCTCCGG + Intronic
993860388 5:93129527-93129549 CATAGGAACCTTAAGTGGTCAGG + Intergenic
994668910 5:102743175-102743197 CACAGTAAGCTAAAGTGGTCTGG + Intergenic
995514232 5:112938446-112938468 CTCAGGAGGCTGAGGTGGGCAGG + Intergenic
998231513 5:140364009-140364031 CACAGGACCCTGAAGTCCTCGGG - Intronic
999626756 5:153529321-153529343 CCCAGGAGTCTGAGGTCCTCTGG - Intronic
1001209522 5:169796992-169797014 CACAGGAGTCCCTTGTGGTCAGG - Intronic
1003513498 6:6800795-6800817 CAAAGGGGTCTGAACTGGTGTGG - Intergenic
1004229121 6:13814786-13814808 CACAGGACTCTGAAGGGCACCGG - Intergenic
1004904531 6:20224496-20224518 CTCAGGAGTCTGAGGTGGGAGGG - Intergenic
1005294371 6:24410576-24410598 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1006859660 6:37162456-37162478 CAGAGGAGGCTGAAGAGGTCCGG - Intergenic
1009812702 6:68689309-68689331 AACAGGAGTTTGAAGTGGTGGGG - Intronic
1009959514 6:70501363-70501385 CACAGCAGTCTGAAGCCGACTGG - Intronic
1011621904 6:89251052-89251074 CTCAGGAGGCTGAAGTGGGTGGG - Intergenic
1013390234 6:109679227-109679249 CACCGCAGTCTGAAGTGACCTGG + Intronic
1013431037 6:110054976-110054998 CACAGGTGTCTGCAGTGGTCAGG - Intergenic
1014699234 6:124662985-124663007 CTCAGCAGTCAGAAGTGGTGTGG + Intronic
1016813300 6:148281532-148281554 CACAGGAGGCTGAAGTCATCAGG - Intronic
1016842768 6:148541064-148541086 AAGAGGAGTCTTAAGTGGTATGG + Intronic
1017731095 6:157316766-157316788 CACAGGAGGCTGAGGTGGGAAGG + Intronic
1019339838 7:503736-503758 TGCAGGCGTGTGAAGTGGTCTGG + Intronic
1019589999 7:1826172-1826194 CACAGGAGTCTCAGGTGCTGTGG + Intronic
1024664911 7:51536632-51536654 CACAGCAGTCTGAAGTCACCTGG - Intergenic
1025020669 7:55476888-55476910 CACAAGGCTCTGAAGTGGGCAGG - Intronic
1026093016 7:67317007-67317029 CTCAGGAGGCTGAAGTGGGAGGG - Intergenic
1026352744 7:69531770-69531792 CACAGGAGGCTGAGGTGGGAAGG + Intergenic
1026588158 7:71674621-71674643 CTCAGGAGTCTGAGGTGGGAGGG - Intronic
1026885788 7:73943612-73943634 CTCAGGAGGCTGAAGTGGGAGGG + Intergenic
1026896019 7:74010505-74010527 CACAGCTGTCTGCAGTGGTGGGG - Intergenic
1027035839 7:74924610-74924632 CTCAGGAGGCTGAAGTGGGAGGG + Intergenic
1029579673 7:101427303-101427325 CTCAGGAGGCTGAAGTGGAATGG - Intronic
1031732554 7:125316541-125316563 CACTGCAGACTGAAGTGCTCTGG + Intergenic
1031805207 7:126299670-126299692 CTCAGGAGGCTGAGGTGGTAGGG - Intergenic
1032106592 7:129036322-129036344 CACAGGAGGCTGAGGTGGGAGGG - Intronic
1033142680 7:138841434-138841456 CACAGGAGGCTGCAGATGTCTGG - Intronic
1035661190 8:1350149-1350171 CACAAGAGCATGAAGTAGTCGGG - Intergenic
1035814261 8:2522003-2522025 CACGGGAGTCTGAAGAGGGAGGG + Intergenic
1036215021 8:6872123-6872145 CACAGGAGAATGAAGAGGTTTGG - Intronic
1036215063 8:6872523-6872545 CACAGGAGAATGAAGAGGTTTGG + Intronic
1038074600 8:24057529-24057551 CTCAAGAGTCTGGAGTGGGCTGG - Intergenic
1038258122 8:25969810-25969832 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
1038258275 8:25970938-25970960 CTCAGGAGGCTGAAGTGGGAGGG - Intronic
1038504249 8:28070882-28070904 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1039896514 8:41720103-41720125 CACAGGAGTCTAGAGTGGTCAGG - Intronic
1040964015 8:53065706-53065728 CACAGGAGTCTGGAGCCCTCAGG - Intergenic
1041077206 8:54179630-54179652 CAGAGGAGGCTGAGTTGGTCAGG - Intergenic
1042738697 8:72018474-72018496 AACAGGTGTATGAAGTGGTATGG - Intronic
1044405264 8:91819014-91819036 CACAGCAGTCTGAAGTGACCTGG + Intergenic
1048702046 8:137102371-137102393 CAGAGAAGTCTGATGTGGTGGGG + Intergenic
1049203690 8:141353659-141353681 CAGAGGAGGCTGAAGTGGGAAGG + Intergenic
1049568109 8:143353306-143353328 CTCAGGAGGCTGAAGTGGGAGGG + Intronic
1050234396 9:3562760-3562782 CACAGCAGTCTGAAGTCAACCGG - Intergenic
1050929730 9:11308130-11308152 CAAAGGAGTCTGAGGGGTTCAGG - Intergenic
1054150020 9:61594913-61594935 CTCAGGAGGCTGAAGTGGGAGGG + Intergenic
1055102158 9:72477279-72477301 CACATGAGCCTGAAGGGGTGGGG - Intergenic
1055731952 9:79287516-79287538 CACAGCAATCAGAAGTGATCAGG - Intergenic
1055880847 9:81001533-81001555 CATAATAGTCTGAAGTGATCTGG - Intergenic
1056951402 9:91043327-91043349 CACGGGAGTCGGGAGTGGTTTGG - Intergenic
1057084767 9:92199063-92199085 CATAGGAGGCTGAGGTGGGCGGG + Intergenic
1059748939 9:117229744-117229766 CACAGGACTCTGAATGGGCCAGG - Intronic
1059752359 9:117259771-117259793 AACAGGTGTCCGAAGTGGTCAGG - Intronic
1060694992 9:125701714-125701736 CACAATAGTATGAAGTGGTATGG - Intronic
1061674234 9:132206824-132206846 CAGTGGAGGCTGATGTGGTCTGG - Intronic
1062079175 9:134611389-134611411 AACAGGAGTCTGCTGTGGTTTGG + Intergenic
1062262956 9:135671921-135671943 CACGGGAGTCTGAAGGAGGCTGG + Intergenic
1186785458 X:12952744-12952766 CTCAGGAGGCTGAAGTGGGAGGG - Intergenic
1190693633 X:52933281-52933303 CACAGGGGGCTGAAGTGGGAGGG - Intronic
1190748822 X:53343382-53343404 CTCAGGAGTTTGAAGTGGGAGGG + Intergenic
1193894796 X:87099989-87100011 CACTGTAGGCTGAAGTGCTCTGG + Intergenic
1194203514 X:90983578-90983600 CACAGCAGTCTGAAGTTGACCGG + Intergenic
1195774826 X:108391547-108391569 CACAGCAGTCTGAGGTCGACTGG - Intronic
1196055604 X:111351830-111351852 CACAGGAGGCTGAAGTGGGGAGG - Intronic
1196703417 X:118696071-118696093 CTCAGGAGGCTGAAGTGGGAAGG + Intergenic
1196777690 X:119355370-119355392 GCCAGGGGTCTGGAGTGGTCAGG - Intergenic
1197333587 X:125183485-125183507 CATTGGAGTCTGAAGTCATCAGG + Intergenic
1198720234 X:139609716-139609738 CTCAGGAGGCTGAAGTGGAAGGG + Intronic
1199593497 X:149488934-149488956 AACAGGTGTCTCAGGTGGTCTGG - Intronic
1199598521 X:149526471-149526493 AACAGGTGTCTCAGGTGGTCTGG + Intronic
1201379628 Y:13360141-13360163 CGCAGGAGTCTGAGGTGGGAGGG - Intronic
1201705660 Y:16933920-16933942 CACAGGAGGCTGAGGTGGGAGGG - Intergenic