ID: 1158033710

View in Genome Browser
Species Human (GRCh38)
Location 18:52999119-52999141
Sequence TTCACTGCACAAAGCAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158033710_1158033715 26 Left 1158033710 18:52999119-52999141 CCACTTCTGCTTTGTGCAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 242
Right 1158033715 18:52999168-52999190 AAATAATTTGTTTTTTCTTCTGG 0: 1
1: 1
2: 12
3: 179
4: 1493
1158033710_1158033717 28 Left 1158033710 18:52999119-52999141 CCACTTCTGCTTTGTGCAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 242
Right 1158033717 18:52999170-52999192 ATAATTTGTTTTTTCTTCTGGGG 0: 1
1: 1
2: 11
3: 152
4: 1437
1158033710_1158033716 27 Left 1158033710 18:52999119-52999141 CCACTTCTGCTTTGTGCAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 242
Right 1158033716 18:52999169-52999191 AATAATTTGTTTTTTCTTCTGGG 0: 1
1: 0
2: 14
3: 212
4: 1768
1158033710_1158033711 -4 Left 1158033710 18:52999119-52999141 CCACTTCTGCTTTGTGCAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 242
Right 1158033711 18:52999138-52999160 TGAAAGCCCTAAAGAGCTGTTGG 0: 1
1: 0
2: 1
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158033710 Original CRISPR TTCACTGCACAAAGCAGAAG TGG (reversed) Intronic
901031016 1:6306848-6306870 TTCACTGAAAAATGCAAAAGAGG - Intronic
901859675 1:12066264-12066286 TTTACTGGAAAAAACAGAAGTGG - Intronic
901962976 1:12841944-12841966 GTCACTGCACACAGCCAAAGTGG - Intergenic
901990167 1:13106250-13106272 GTCACTGCACACAGCCAAAGTGG - Intergenic
902272998 1:15318074-15318096 TTCACTGCATAAAGTAGTTGTGG + Intronic
903190556 1:21653433-21653455 AGCACTGCCCAGAGCAGAAGGGG - Intronic
903907124 1:26695614-26695636 TTCCCTTCACAAAGGAGGAGGGG - Intergenic
905961976 1:42050580-42050602 GACACTGCACAAGGCAGAAGAGG + Intergenic
908422291 1:63970835-63970857 TTCAGGGCACAGAGCAGAAGTGG + Intronic
912239817 1:107894308-107894330 TTCACTACTCAAAGAAGAAAAGG + Intronic
912438993 1:109684089-109684111 TACACTGAACAAAGGAGAAAGGG - Intronic
912441515 1:109702534-109702556 TACACTGAACAAAGGAGAAAGGG - Intronic
912604481 1:110974588-110974610 TTCAAAGCTCATAGCAGAAGTGG - Intergenic
912878642 1:113388166-113388188 GTCACTGCACAGAGCAGGAACGG - Intergenic
912880065 1:113403045-113403067 TTCAGTGCAGGAAACAGAAGGGG + Intronic
914703321 1:150152070-150152092 TCTACTGCAGAAAGCAGAAGAGG - Intronic
915029540 1:152866071-152866093 TTTCCTCAACAAAGCAGAAGGGG - Intergenic
915115866 1:153599105-153599127 TTCTCTCAAGAAAGCAGAAGTGG + Intergenic
915272284 1:154762110-154762132 TAAACTGCACCATGCAGAAGAGG + Intronic
915499924 1:156308716-156308738 TTCACTGCCCAAAGAACAAGAGG - Intergenic
916099440 1:161381525-161381547 TTCATTACAAAAAGAAGAAGGGG + Intergenic
916487761 1:165274594-165274616 TTTACTGCAGAAATCAGAAGTGG + Intronic
916771326 1:167911636-167911658 TACACTGAACAAAGGAGACGGGG - Intronic
918621639 1:186612286-186612308 TTCAATGAGCCAAGCAGAAGAGG + Intergenic
922512045 1:226177122-226177144 GTCACTGCACAATGCGGCAGAGG + Intronic
924040965 1:239983402-239983424 TTTACTGCAAGAAGCAGAAAAGG - Intergenic
1062904766 10:1172504-1172526 CTCACTGCACACAGCGGCAGAGG + Intergenic
1063384737 10:5609017-5609039 TTCTCTGCTCAAGGCAGCAGGGG + Intergenic
1064275455 10:13901272-13901294 TTCACTGCAAAAAGCAGCTAAGG + Intronic
1064668733 10:17686104-17686126 TTAACTGCATAAAGCAGGAAAGG - Intronic
1065775505 10:29115927-29115949 CTCATGGCAGAAAGCAGAAGGGG - Intergenic
1065846757 10:29750534-29750556 TTCACTGCACAAAGAAGTTGGGG + Intergenic
1065912482 10:30320922-30320944 ACCACTGCACACAGCAGGAGTGG + Intronic
1067122478 10:43485991-43486013 TTTTCTGAACAAACCAGAAGAGG + Intergenic
1067715094 10:48684823-48684845 TTTCCTGGAGAAAGCAGAAGTGG - Intergenic
1070836419 10:79449851-79449873 TGCACTGCACAAAGAAGTTGGGG - Intergenic
1071347386 10:84705870-84705892 TCCAGGGCCCAAAGCAGAAGAGG + Intergenic
1072063916 10:91846522-91846544 TTCAGTGCCCAAAGCAGAGGTGG - Intronic
1072380120 10:94859230-94859252 TTCACTGCTCAAACCGCAAGTGG + Intergenic
1074266677 10:111911149-111911171 TTCACTGATTAAAACAGAAGAGG - Intergenic
1078140634 11:8690154-8690176 CTCACGGCAGAAAGCAGAAGGGG - Intronic
1079424343 11:20326019-20326041 ATCACTGACCACAGCAGAAGGGG - Intergenic
1079771530 11:24466204-24466226 TTTATTGCTCAAAGCGGAAGAGG + Intergenic
1079787493 11:24692499-24692521 TTCACTGTAAAAAGAAAAAGTGG + Intronic
1080685225 11:34509694-34509716 TCCAGTCCAGAAAGCAGAAGTGG - Intronic
1084950189 11:72660800-72660822 TTCACTGCACGTAGAAGTAGGGG + Intronic
1086072775 11:82817910-82817932 TACACTGAACACAGCACAAGTGG - Intergenic
1086891515 11:92264109-92264131 TTGAATGCACAAAGTAGAAGAGG - Intergenic
1087648406 11:100834809-100834831 TTCCCTGTCCAAAGCAGAAGGGG - Intronic
1090855203 11:130604997-130605019 TTGAGTGAACAAAGGAGAAGTGG + Intergenic
1092421712 12:8337264-8337286 TTCACTGCACAAAGTGGATTTGG + Intergenic
1092486214 12:8904163-8904185 GTCACTTCACAAGTCAGAAGAGG + Intergenic
1093191391 12:16078919-16078941 TTGACTCCACAAAGAAGAATTGG - Intergenic
1093985577 12:25528726-25528748 TTCACTGCAGATGGAAGAAGGGG - Intronic
1095626847 12:44325267-44325289 TTCACTGTAGAAAGATGAAGGGG - Intronic
1097586958 12:61526644-61526666 TTTACTGCACAAATCAGCAGTGG - Intergenic
1097596675 12:61641753-61641775 TTCACTGCAAAAACTAGAAAAGG - Intergenic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1101416964 12:104516783-104516805 CTCAGGGCACCAAGCAGAAGGGG + Intronic
1102735449 12:115155128-115155150 TTCACTGGATAAAGCAAATGTGG - Intergenic
1104735259 12:131132428-131132450 TGCACTGGCCTAAGCAGAAGGGG + Intronic
1105063319 12:133173489-133173511 TTCACAGCAGAAAGTAAAAGGGG - Intronic
1105346266 13:19575368-19575390 TTCACAGCACCAATCAGAGGGGG - Intergenic
1108137835 13:47385073-47385095 GTCACTGCAGAAAGCAAAACTGG + Intergenic
1108974025 13:56413892-56413914 ATCACTGCAAATAACAGAAGAGG + Intergenic
1110068635 13:71143517-71143539 TTCATGGCAGAAAGCACAAGAGG - Intergenic
1110869776 13:80437115-80437137 TTAGCTGCACACAGCAGGAGAGG + Intergenic
1111632412 13:90859200-90859222 TTCACTTCAGAAAACAGAAAGGG - Intergenic
1114306730 14:21430329-21430351 TTCACTGAGCAAAGTAGGAGGGG + Intronic
1114398753 14:22390077-22390099 ATCAGGGCACACAGCAGAAGGGG + Intergenic
1114597798 14:23928806-23928828 TAAACTGCACAAAGCAGAAATGG - Intergenic
1114703458 14:24702628-24702650 TTACCTGCACAAAGAAGGAGCGG - Intergenic
1116148293 14:41103252-41103274 TTGACTGGACAAAGCAAATGTGG - Intergenic
1116216781 14:42026552-42026574 GTCACATCACAGAGCAGAAGGGG + Intergenic
1116760632 14:49008780-49008802 TTCACTGTAAAAATCAGAAAAGG + Intergenic
1118069077 14:62225254-62225276 TTCCATGCACATAGCAGATGAGG - Intergenic
1119656587 14:76421653-76421675 GCCACTCCACAAAGCAGCAGGGG + Intronic
1120288741 14:82539437-82539459 CTAACTGCACAGAGTAGAAGTGG - Intergenic
1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG + Intergenic
1126413053 15:48392151-48392173 TTTACTGTACAAAGCTCAAGTGG + Intergenic
1127092495 15:55480811-55480833 GTCACTTTACAAAACAGAAGAGG + Intronic
1128261322 15:66235029-66235051 TACTCTGCACAAAGCAGGAGAGG + Intronic
1128875687 15:71199317-71199339 TTCTCTGCACAAGTCAGAACTGG + Intronic
1129965997 15:79736171-79736193 TGCACTGCCCCAAGCAGAATTGG + Intergenic
1131007235 15:88987946-88987968 GTCACTGCAGAAGACAGAAGGGG - Intergenic
1131977036 15:97957356-97957378 CTCACCACAAAAAGCAGAAGGGG + Intergenic
1133510848 16:6455701-6455723 TACACTTCACAAAGCAGGAATGG + Intronic
1133876019 16:9735324-9735346 GTCAGTGGAGAAAGCAGAAGAGG + Intergenic
1134368509 16:13601940-13601962 ATCACGGCACAAGGCAAAAGAGG + Intergenic
1136911007 16:34144387-34144409 TGCACTGCAGAAAGCCGCAGGGG + Intergenic
1138284094 16:55794627-55794649 GTCACTGCCCACACCAGAAGTGG - Intergenic
1138284908 16:55802360-55802382 GTCACTGCCCACACCAGAAGTGG + Intergenic
1138731090 16:59195936-59195958 TTCACTGCATAAATAAGAGGTGG + Intergenic
1139306961 16:65994903-65994925 CTAACTTCACATAGCAGAAGGGG - Intergenic
1139599355 16:67977240-67977262 AGCACTGCACAAAGCTGAGGTGG + Intronic
1140270678 16:73463783-73463805 TGCAGTGCACTAAACAGAAGGGG + Intergenic
1140634872 16:76900390-76900412 ATCACTGCACAGAGCACAGGAGG - Intergenic
1144413756 17:15025848-15025870 TTCACTGCTCAGTGCAGCAGAGG + Intergenic
1145125309 17:20294850-20294872 TTCAGTGCTCAAAACAGTAGAGG - Intronic
1145944293 17:28761367-28761389 CAGACTGCCCAAAGCAGAAGTGG + Intronic
1147419637 17:40316080-40316102 TTGACTGCAGAAGGCAGGAGAGG - Intronic
1147935970 17:44011326-44011348 TTCACAGCCCAGAGCAGAACAGG + Exonic
1148735060 17:49860627-49860649 ACCACTGCCCAGAGCAGAAGTGG + Intergenic
1149513313 17:57259972-57259994 TTCAGTGCAGGAGGCAGAAGCGG + Intronic
1151128001 17:71865958-71865980 TCCTCTGCACAAAGGAGAAGAGG + Intergenic
1153057898 18:966077-966099 TTCGCTTCACAACGCAGACGAGG - Intergenic
1153537864 18:6122038-6122060 ATCACTGCACAACTCATAAGTGG - Intronic
1154973619 18:21435567-21435589 TTCACTGTACAAAGGAGTAGAGG + Intronic
1155268775 18:24119303-24119325 TTCATTACACAAACCAGAAAAGG - Intronic
1156359516 18:36372011-36372033 CTCTCTGCATAAAGCAGAATGGG + Intronic
1157980551 18:52374831-52374853 TTCATTTCACACAGCAGATGAGG + Intronic
1158033710 18:52999119-52999141 TTCACTGCACAAAGCAGAAGTGG - Intronic
1159120263 18:64160820-64160842 TTAACTGCACACTTCAGAAGGGG - Intergenic
1159189646 18:65025152-65025174 AACACTGCACAAAGCAGAAAGGG + Intergenic
1159213008 18:65352979-65353001 TTCACTGTAAAATGAAGAAGCGG + Intergenic
1162656170 19:12131963-12131985 ATCACTGCACAATGCAGCAGAGG + Exonic
1162708553 19:12574258-12574280 TTTGCGGCAGAAAGCAGAAGGGG - Intronic
1163783241 19:19261397-19261419 TTCTCCGCGAAAAGCAGAAGTGG - Intronic
1166260116 19:41633144-41633166 TACACTCCACAGAGTAGAAGTGG + Intronic
1167948396 19:53007779-53007801 TTCAGTGCAGAAAGAAGCAGAGG - Intergenic
1167953299 19:53045000-53045022 TTCAGTGCAGAAAGAAGCAGAGG - Intronic
925197293 2:1936622-1936644 TTCACTGCAGTCAGCAGAAAAGG - Intronic
925964737 2:9053459-9053481 TTCACTTCTCAGAGCAAAAGGGG + Intergenic
926526898 2:13992254-13992276 TATGCTGCACAAAGCAGAGGGGG + Intergenic
927400149 2:22701877-22701899 AGCACTGCTCAGAGCAGAAGAGG + Intergenic
927421345 2:22934485-22934507 TTTACTGCAAAAAGCAGTAAAGG + Intergenic
928260414 2:29761621-29761643 TTCCCAGCAGACAGCAGAAGAGG - Intronic
928998535 2:37324041-37324063 TTCACTGCTCAAAGAAACAGTGG + Intronic
931577107 2:63729783-63729805 TTCACTACATAAAGCAGCATAGG - Intronic
932374365 2:71222482-71222504 TTGAGTGAACAAAGCAAAAGAGG + Intronic
933230833 2:79805611-79805633 TTCACTGCACTCAGCAAAACAGG - Intronic
933283020 2:80353701-80353723 CTCAGTGCAAAAAGTAGAAGTGG - Intronic
933558929 2:83867582-83867604 TTCACTTCAGAAAGAAGAATGGG + Intergenic
933568048 2:83975449-83975471 ATCACTGAACAAAGGAGAAAGGG + Intergenic
933899387 2:86838237-86838259 GGAACTGTACAAAGCAGAAGTGG + Intronic
935180263 2:100682879-100682901 TTGACTGGGCAAAACAGAAGAGG + Intergenic
935781176 2:106510991-106511013 GGAACTGTACAAAGCAGAAGTGG - Intergenic
935896227 2:107740504-107740526 CACACTGCACAAAGCAGATGAGG + Intergenic
937858442 2:126689702-126689724 CTCATGGCAAAAAGCAGAAGGGG - Intronic
937858944 2:126693313-126693335 CTCATGGCAAAAAGCAGAAGGGG - Intronic
939167765 2:138657653-138657675 TTCATTGCACAAAGCATAGTTGG - Intergenic
939519574 2:143212940-143212962 TTCAGTGCAGAAAGCATAATTGG + Intronic
941206486 2:162579570-162579592 TTCACTGCACCAAGGATGAGAGG - Intronic
941850223 2:170173017-170173039 ATGACTCCACAAAGCAAAAGAGG - Intergenic
942140810 2:172976106-172976128 CTAACTTCACAAAGCAGAAAAGG + Intronic
943568183 2:189541692-189541714 TTCCCAGGACAAAGCTGAAGCGG - Intergenic
944841030 2:203623865-203623887 TTCACAGCACCTAGCAGAACTGG + Intergenic
945172831 2:207014581-207014603 TTCAATGCTCAGAACAGAAGAGG - Intergenic
945771160 2:214044779-214044801 GTCACAGCACAAAGCAAAACTGG + Intronic
947572177 2:231244841-231244863 GGCTCTGCCCAAAGCAGAAGAGG + Intronic
1172587480 20:36094693-36094715 TTCCCTGCCAAAAGCAGCAGAGG + Intronic
1174311272 20:49656699-49656721 TTCACTGCAGAAAGCAAAAAGGG + Exonic
1174668311 20:52281815-52281837 TTCCCTGCACAAAAAAAAAGGGG - Intergenic
1175171096 20:57082090-57082112 TTCACTGAAGCAAGCAGCAGAGG - Intergenic
1175493194 20:59393153-59393175 GTCACAGGACAAAGCAAAAGGGG - Intergenic
1175745902 20:61456951-61456973 CTCGCTGCACAAAGAAGAATTGG + Intronic
1178925822 21:36774192-36774214 TCCACGGCACAAAGCTGAGGTGG + Intronic
1179650701 21:42806705-42806727 ACCTCTCCACAAAGCAGAAGAGG - Intergenic
1180093370 21:45543381-45543403 TCCACTGCACAGAACAGAAGGGG + Intronic
1181327518 22:22061201-22061223 TACACTGAATAAAGCAGAACAGG - Intergenic
1181945365 22:26512659-26512681 GTCACAGTACAAAGCAGGAGCGG - Intergenic
1181967225 22:26665662-26665684 TTTCCTGCACAGACCAGAAGAGG - Intergenic
1183295206 22:37025203-37025225 GTCACTGCCCAAAGCACAGGAGG - Intronic
1183375655 22:37463439-37463461 GTGTCTACACAAAGCAGAAGGGG - Intergenic
1184766244 22:46573969-46573991 TCCTCTGCTCAAAGCAGAACTGG - Intergenic
950203742 3:11062305-11062327 TTTACTGCAAACAGCAAAAGAGG - Intergenic
951380576 3:21979234-21979256 ATAACTGCACCAAACAGAAGGGG + Intronic
954745734 3:52786547-52786569 CTCAGTGAGCAAAGCAGAAGAGG - Intronic
955146253 3:56323054-56323076 CTCACAGCAGAAAACAGAAGGGG - Intronic
955640703 3:61080927-61080949 ATCACGGCAAAAAGCGGAAGAGG + Intronic
956362550 3:68464532-68464554 TTCACTGCTCCAACCAGAAGGGG - Intronic
958136003 3:89492454-89492476 TTCAATACACAAAGCAAAATTGG - Intergenic
959407222 3:105975288-105975310 TTCACTGCACTAATCAGTATAGG - Intergenic
960102520 3:113759888-113759910 TTCAATAAACAAAGCAGAGGCGG + Intronic
960298186 3:115968949-115968971 TTCACTGCAGAAAGCAAGACTGG - Intronic
961681920 3:128605053-128605075 TTCACTGCAGAGAGGAGCAGGGG - Intergenic
964460462 3:156919453-156919475 GTCACTGCACAATTCAGCAGAGG - Intronic
967440038 3:189496551-189496573 CTGTCTCCACAAAGCAGAAGTGG + Intergenic
968021110 3:195390233-195390255 TTCAAATCACAAAGTAGAAGAGG - Intronic
968294130 3:197560554-197560576 TACACAGAACAAAGCAGACGGGG - Intronic
970578244 4:17448520-17448542 TCCCCTGCACAGATCAGAAGGGG + Intergenic
971245850 4:24926972-24926994 TGCAGTGGACTAAGCAGAAGTGG + Intronic
971523557 4:27586234-27586256 TTCATTGTACACAGCTGAAGTGG - Intergenic
975881264 4:78910790-78910812 TTCACTGCTCTTAGGAGAAGGGG - Exonic
977349293 4:95860553-95860575 TTCAATCCATAAAGTAGAAGAGG + Intergenic
978034821 4:103979050-103979072 TGCACTCCACAAAGTGGAAGCGG - Intergenic
981913437 4:150008705-150008727 TTAACTACACAAAGGGGAAGTGG + Intergenic
984279678 4:177654450-177654472 TTGACTGCATAAAACAAAAGGGG + Intergenic
985172036 4:187160935-187160957 ATCACTGCACAAAGTCCAAGTGG - Intergenic
986155222 5:5167666-5167688 TTCGCTAGACAAAGGAGAAGTGG - Intronic
988408554 5:30856131-30856153 TTCCCTGCACAATGAAGAAAAGG - Intergenic
988541755 5:32116400-32116422 TTCACTCCACAAAACAGAAGAGG + Intergenic
989029982 5:37109036-37109058 TTCTCTGCACAAAGCCCTAGAGG + Intronic
989557189 5:42811326-42811348 TTCAGTCCACAGTGCAGAAGTGG - Intronic
990240898 5:53815717-53815739 GTCTCTGAACAAAGCAGAAAAGG + Intergenic
990255172 5:53960925-53960947 ATCACTGCAGGAAACAGAAGAGG + Intronic
990364331 5:55054546-55054568 TACACTCCACAGAGCAGGAGTGG + Intergenic
990603687 5:57386067-57386089 TACACTGTACCAAGCAGAATGGG + Intergenic
990641929 5:57795427-57795449 GTCACTGTACAATGCAGCAGAGG - Intergenic
992328521 5:75689285-75689307 TAAATTGCACATAGCAGAAGAGG - Intronic
992471961 5:77066599-77066621 TTCAGTGAACCAAGCAGAAGGGG + Intergenic
992810001 5:80377171-80377193 CTCACGGCAAAAGGCAGAAGAGG - Intergenic
993248984 5:85490794-85490816 TTAACTTCAAAAAGAAGAAGTGG + Intergenic
994117827 5:96080969-96080991 TTCAATGCACAAAGAAGAGATGG + Intergenic
999737140 5:154521329-154521351 GTCACAGCACAAAGCGGAGGAGG + Intergenic
1001869169 5:175135657-175135679 TTCAGGGCAGAAAGCAAAAGTGG + Intergenic
1004041928 6:11987985-11988007 TACACTTCCCAAAGCAGAAGTGG - Intergenic
1005103632 6:22200035-22200057 TTCACTACACAGAGGAGCAGAGG - Intergenic
1008693063 6:54002569-54002591 TTCACAGCATAAAGAAAAAGAGG - Intronic
1010448719 6:75978241-75978263 TACAACACACAAAGCAGAAGAGG - Intronic
1012749061 6:103133869-103133891 TACACTCCACAGAGCAGGAGAGG - Intergenic
1013457938 6:110348848-110348870 TTCTTTGCACAGAGCAGAGGTGG - Intronic
1013558307 6:111279605-111279627 TGCACTGGACCAAGCAGCAGTGG - Intergenic
1016015389 6:139179136-139179158 TTTAATGCACAAAGCTGTAGTGG + Exonic
1016329387 6:142940887-142940909 TTCTCGGCAGAAAGCAGAGGGGG - Intronic
1016360164 6:143259108-143259130 CTCATGGCAGAAAGCAGAAGTGG - Intronic
1016500635 6:144717271-144717293 TTCTCTCCACAAAGAGGAAGAGG + Intronic
1019775985 7:2912547-2912569 TTCACTGGACAAAGCAGCTCAGG + Intronic
1021561611 7:21973293-21973315 TTTACTTCAAAAACCAGAAGAGG + Intergenic
1021783756 7:24132844-24132866 TGCCCTTCCCAAAGCAGAAGGGG - Intergenic
1023593208 7:41800619-41800641 TTCACGTCACAATTCAGAAGAGG + Intergenic
1024087893 7:45911856-45911878 TTCTCTGCTCCAAGCAGAAGGGG - Intergenic
1024303367 7:47904829-47904851 TTCATTTCTCAAAGCAGTAGGGG + Intronic
1025789850 7:64679499-64679521 TCCACTGCACAACCCAGATGGGG + Intronic
1026477416 7:70748986-70749008 TTCACTGGACCATGCAGAAAAGG - Intronic
1026955640 7:74374924-74374946 TTTAATGCTTAAAGCAGAAGAGG - Intronic
1028138590 7:87247356-87247378 TTCATTGCAGAAATCAGATGTGG - Intergenic
1031563293 7:123264139-123264161 TGCACTGAACGAAGCAGATGAGG - Intergenic
1031925353 7:127633348-127633370 TTCACAGCAAAAAGAAGCAGCGG - Intergenic
1033973351 7:147069796-147069818 TGTATTGAACAAAGCAGAAGTGG - Intronic
1034877620 7:154739301-154739323 TTTGGTGCCCAAAGCAGAAGAGG + Intronic
1035160273 7:156944869-156944891 TTCCCTGCACAATGAAGACGTGG + Intergenic
1037300421 8:17445602-17445624 CTCACTGCAGAAAGTGGAAGAGG - Intergenic
1037949559 8:23010025-23010047 ATCCCTGCACAGAACAGAAGTGG - Intronic
1037953337 8:23033784-23033806 TTCCTTGCACACACCAGAAGAGG + Intronic
1039027603 8:33274852-33274874 TCCACTGCACAAGGCAGTAATGG - Intergenic
1040445959 8:47493934-47493956 TTCCCTTCAAAAAGCATAAGGGG + Intronic
1040760697 8:50838977-50838999 TTTATTGTACAAAGAAGAAGGGG + Intergenic
1045934118 8:107659061-107659083 TTTAGTGCACAAGTCAGAAGTGG - Intergenic
1047049495 8:121095028-121095050 TACACTGCACAAAGCAAAAATGG + Intergenic
1049016295 8:139922493-139922515 TTGTCTTCACAAAGCAGATGAGG + Intronic
1049535603 8:143179596-143179618 TGCACTCCACAGAGCAGGAGAGG + Intergenic
1050582532 9:7075577-7075599 CTCACTGTGGAAAGCAGAAGTGG - Intronic
1052901836 9:33800111-33800133 TCCACTGCACGCAGCAGAGGAGG + Intergenic
1053350210 9:37409088-37409110 TTCTCTGCACAGAGCAGCAGGGG + Intergenic
1055034563 9:71804624-71804646 TTCCCTGTACAAAGCAAAAGTGG + Intronic
1055128766 9:72750643-72750665 TTCATTCCCCAAAGCTGAAGTGG + Intronic
1057149096 9:92780350-92780372 CTCATGGCAGAAAGCAGAAGAGG - Intergenic
1058898948 9:109424727-109424749 TACACCACACAGAGCAGAAGAGG + Intronic
1059465377 9:114466099-114466121 TTCACAGCTCACAGCAGCAGCGG - Intronic
1061151933 9:128833736-128833758 TTACCTTCACAAAACAGAAGCGG + Exonic
1061872095 9:133526584-133526606 TTCATTGCAAACAGCAGAAATGG - Intronic
1061969727 9:134038112-134038134 TTTACTCCAGAAAACAGAAGAGG + Intronic
1185660241 X:1722044-1722066 TAGACTGCACAAAGCAAATGTGG - Intergenic
1186754241 X:12653481-12653503 CTCAGTGCATAAAGCAGTAGAGG + Intronic
1186980049 X:14949052-14949074 TTCTTTGCATAAAGAAGAAGTGG - Intergenic
1188078631 X:25808518-25808540 GTCACAGCAGAAAGCAGAACTGG - Intergenic
1190000414 X:46681132-46681154 TTTGCTGCACAAAGCAAAGGTGG - Intronic
1192115136 X:68403050-68403072 AACACTGCACAAATCAGAAATGG + Intronic
1192770628 X:74185927-74185949 TTCACTGCTCTTAGGAGAAGGGG - Intergenic
1194145685 X:90259231-90259253 TCCAGTGCCAAAAGCAGAAGGGG - Intergenic
1194606833 X:95991033-95991055 CACACTGCACCAAGCTGAAGAGG - Intergenic
1196750654 X:119114622-119114644 TTTTCTGCAAAAAGCAGAGGAGG - Intronic
1197229622 X:123990115-123990137 TACACTCCACAGAGTAGAAGCGG + Intronic
1197673564 X:129305353-129305375 TTCAATGCATAATGCAGCAGTGG - Intergenic
1197857484 X:130931862-130931884 TTCAAAGCTCATAGCAGAAGTGG + Intergenic
1198979470 X:142378896-142378918 TTGACTGCACAATGAACAAGAGG + Intergenic
1199547655 X:149023696-149023718 TAGACTGCACAAAGAAGATGTGG + Intergenic
1199896269 X:152130576-152130598 TGCAATGCAAAAAGCTGAAGGGG - Intergenic
1199930133 X:152509563-152509585 TACACTTCAAAAAGCAGAAAAGG + Intergenic
1200491436 Y:3828526-3828548 TCCAGTGCCAAAAGCAGAAGGGG - Intergenic
1200861987 Y:8002884-8002906 TTTACTGCACCAGGCAGAAGAGG + Intergenic
1201668962 Y:16493532-16493554 TACACTGAACAAAGGAGACGGGG - Intergenic