ID: 1158034322

View in Genome Browser
Species Human (GRCh38)
Location 18:53006083-53006105
Sequence ACTGAAGACACACATATATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158034322_1158034323 17 Left 1158034322 18:53006083-53006105 CCACATATATGTGTGTCTTCAGT 0: 1
1: 0
2: 2
3: 15
4: 248
Right 1158034323 18:53006123-53006145 CATTTTCTTTATGTTAATACAGG 0: 1
1: 0
2: 2
3: 43
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158034322 Original CRISPR ACTGAAGACACACATATATG TGG (reversed) Intronic
903128570 1:21263743-21263765 ACTGATGACACACACAGAGGGGG - Intronic
904814957 1:33188896-33188918 AGAGAAGACACAAAAATATGTGG - Intergenic
904930525 1:34083336-34083358 ACTTAAAACACAGATATATAGGG - Intronic
906029822 1:42709716-42709738 ACTGAAGACAGACATCGAAGAGG - Intergenic
907944921 1:59127114-59127136 ACTGAAGACACAGAAAGGTGTGG + Intergenic
908047451 1:60185666-60185688 GCTGAAGATACACAAAAATGTGG - Intergenic
908536303 1:65081156-65081178 ATTATATACACACATATATGTGG - Intergenic
909115354 1:71527346-71527368 ATGGAAGACACACTTATTTGTGG - Intronic
909298312 1:73979865-73979887 ACTAAAGACACACATGAATAAGG - Intergenic
910281546 1:85506853-85506875 ACTGAAGACAGAAACATAGGAGG + Intronic
911829153 1:102529093-102529115 ACTGAAGACAAACATTTCTTTGG - Intergenic
912385638 1:109269950-109269972 ACTGAAGACACTGACATACGTGG + Exonic
912855661 1:113166796-113166818 ACTGAAGATAAACATACATAGGG + Intergenic
913644928 1:120846873-120846895 ACTGAAGACATTCACATGTGAGG - Intergenic
913655279 1:120954386-120954408 ACTGAAGACATTCAGATGTGAGG - Intergenic
913677972 1:121160134-121160156 GCTGAATACACCCACATATGTGG + Intergenic
914006639 1:143738070-143738092 ACTGAAGACATTCAGATGTGAGG - Intergenic
914081799 1:144416692-144416714 ACTGAAGACATTCACATGTGAGG + Intergenic
914095607 1:144542380-144542402 ACTGAAGACATTCAGATGTGAGG - Intergenic
914099304 1:144570163-144570185 ACTGAAGACATTCACATGTGAGG - Intergenic
914176707 1:145285204-145285226 ACTGAAGACATTCACATGTGAGG + Intergenic
914299682 1:146367505-146367527 ACTGAAGACATTCACATGTGAGG + Intergenic
914302913 1:146391588-146391610 ACTGAAGACATTCAGATGTGAGG + Intergenic
914531434 1:148526683-148526705 ACTGAAGACATTCACATGTGAGG + Intergenic
914636958 1:149561057-149561079 ACTGAAGACATTCACATGTGAGG - Intergenic
914645465 1:149648555-149648577 ACTGAAGACATTCAGATGTGAGG - Intergenic
916434508 1:164765089-164765111 ACTGTTGACAACCATATATGTGG - Intronic
916663274 1:166942417-166942439 CCTGAAGACACATTTCTATGGGG - Intronic
918532029 1:185533936-185533958 ACCCCCGACACACATATATGTGG + Intergenic
918804400 1:189020663-189020685 ATTGAATAAACACATAAATGTGG + Intergenic
920465271 1:206178647-206178669 GCTGAATACACCCACATATGTGG + Intergenic
921729994 1:218567035-218567057 ACTGAATAAACAAATACATGGGG + Intergenic
924492920 1:244557379-244557401 ACTGAAGAAACACATATAAATGG - Intronic
1065651261 10:27894477-27894499 ACTGATAAAACAAATATATGGGG + Intronic
1066531424 10:36344396-36344418 ACTGAAGACTCAGATATCTATGG - Intergenic
1069259718 10:66379941-66379963 AATGAAGATGCACAAATATGTGG + Intronic
1070688912 10:78510466-78510488 AATGAAGACACAAAGAGATGAGG + Intergenic
1071195876 10:83159106-83159128 ACAGAAAACACACTTATATTTGG - Intergenic
1071580566 10:86765718-86765740 ACAGAAGTTACACATATTTGTGG + Intronic
1075354437 10:121757868-121757890 CCAGAATACACACAAATATGAGG - Intronic
1076758118 10:132585802-132585824 GCTGACGACACACATCTGTGGGG - Intronic
1077968375 11:7160285-7160307 ACTCCAGATCCACATATATGGGG - Intergenic
1078446190 11:11406883-11406905 CCTGAAGACCCACACCTATGGGG - Intronic
1078712179 11:13804439-13804461 ACTAAAGACATAAATATATGGGG + Intergenic
1081226048 11:40523834-40523856 AATGAAGACACATGTGTATGTGG - Intronic
1082131976 11:48501420-48501442 ACTGGATACACACCTATATATGG - Intergenic
1082244817 11:49910034-49910056 ACTGGATACATACATATATATGG + Intergenic
1082565435 11:54672029-54672051 ACTGGATACACACCTATATATGG - Intergenic
1082755944 11:57076540-57076562 TGTGTATACACACATATATGTGG + Intergenic
1083067281 11:59938360-59938382 CCTGAAGCCACACATAGGTGTGG - Intergenic
1086999195 11:93396269-93396291 ACTGAAAACACACATCTAAAAGG + Exonic
1088445609 11:109924035-109924057 TCTGAAAACTCACAAATATGTGG + Intergenic
1088613149 11:111598663-111598685 CCTGAAGAAATACATATATGTGG - Intergenic
1089717842 11:120380801-120380823 ACTGAATAAACAGATAAATGTGG - Intronic
1090909189 11:131103830-131103852 AATGAAAACCCAAATATATGAGG + Intergenic
1093853932 12:24075521-24075543 ACTGCAGACAGATATATAAGGGG + Intergenic
1093886884 12:24471918-24471940 AATGAACAAACACATTTATGAGG - Intergenic
1094224832 12:28033268-28033290 GCTGAAGACCCAAATATGTGTGG - Intergenic
1099246430 12:80198235-80198257 ATTGAAGACACAGATAAAAGAGG - Intergenic
1099619795 12:84988229-84988251 CATGAAGACACAAATACATGAGG - Intergenic
1099917963 12:88919704-88919726 AATGAAAACACATAAATATGAGG + Intergenic
1100368521 12:93943618-93943640 AGTGAAGACAAAAATACATGGGG - Intergenic
1102271940 12:111544638-111544660 ACTGGGGACACACATCTAAGGGG + Intronic
1102503972 12:113372368-113372390 ACTGAACACACATATAGATTGGG + Intronic
1106758624 13:32846567-32846589 ACTGTAGACACACATCTGGGAGG + Intergenic
1106862145 13:33921371-33921393 ACTGAAGACACACAACTTAGAGG + Intronic
1108130477 13:47294158-47294180 AAAGAAGACATACATACATGTGG - Intergenic
1108474441 13:50799930-50799952 AGTGTCTACACACATATATGTGG - Intronic
1109595467 13:64548330-64548352 AATGAATACACACATATATATGG - Intergenic
1110597734 13:77337691-77337713 TCTGAAGACTCACATAGATATGG + Intergenic
1111357887 13:87133445-87133467 ACTGGAGACAGACGAATATGGGG + Intergenic
1112304090 13:98257797-98257819 ACTGTAGCCACACATCAATGAGG - Intronic
1113047242 13:106169024-106169046 AATATATACACACATATATGTGG - Intergenic
1114646168 14:24257384-24257406 TCTGCAGAAACACATGTATGTGG + Intronic
1115525704 14:34278647-34278669 ACTGAAAACACAAAATTATGGGG + Intronic
1117613612 14:57509433-57509455 ATTGAAGACACTCTTATGTGGGG + Intergenic
1118072292 14:62258294-62258316 GCTGAAGACACAGAAATAGGTGG + Intergenic
1120444324 14:84575209-84575231 AATAAAGACAAACATATATAAGG - Intergenic
1120904492 14:89608480-89608502 ACAGCATACATACATATATGTGG + Intronic
1121164353 14:91777554-91777576 TCGGAAGACACACCTCTATGGGG + Intronic
1126834927 15:52652270-52652292 ACTGAAGAAACACATTTCAGGGG - Intronic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1127562206 15:60150592-60150614 ACTGGAGAGACACATATCTGTGG - Intergenic
1128354997 15:66919859-66919881 GCGGAGGACACACATGTATGGGG - Intergenic
1129526180 15:76216492-76216514 ACTGAAATCACAGATATTTGTGG - Exonic
1131723294 15:95195300-95195322 ACTGGAGACACTCATAAATGTGG - Intergenic
1132076854 15:98828674-98828696 TGTGAAGACACACAGACATGAGG + Intronic
1134393756 16:13843458-13843480 ACTTAAGACCCACATATATGGGG + Intergenic
1134512471 16:14859508-14859530 ACTGAAGACAAATACATCTGTGG + Intronic
1134700111 16:16258009-16258031 ACTGAAGACAAATACATCTGTGG + Intronic
1134971715 16:18536653-18536675 ACTGAAGACAAATACATCTGTGG - Intronic
1136285461 16:29237920-29237942 AATGAATACACAGATAAATGGGG - Intergenic
1137015214 16:35367594-35367616 AATGAAGACTCTCTTATATGTGG - Intergenic
1140702603 16:77595641-77595663 ACTGATGTCACATATAAATGGGG + Intergenic
1140959013 16:79894875-79894897 AGTGAAGACATACTTATATCAGG + Intergenic
1141062991 16:80892169-80892191 TCTGAAGACACAGATACATCTGG - Intergenic
1141299959 16:82805436-82805458 AGTGAAGAAACAGATGTATGAGG + Intronic
1142090788 16:88208052-88208074 AATGAATACACAGATAAATGGGG - Intergenic
1143983305 17:10889535-10889557 TCTGAAGAGACACAAACATGCGG - Intergenic
1145955659 17:28852751-28852773 ACTGAAGAAAAAAATATCTGGGG + Intronic
1146744901 17:35319809-35319831 CCTGGAGAAACAGATATATGTGG - Intergenic
1149173978 17:53847139-53847161 ATTATATACACACATATATGAGG - Intergenic
1150585487 17:66513982-66514004 ACTGAAACCACACATAAGTGGGG - Intronic
1150891129 17:69151318-69151340 AATGAAGATACAAATAAATGAGG - Intronic
1151130506 17:71892015-71892037 AGTGAAGACAAAGATGTATGTGG + Intergenic
1151874521 17:76859371-76859393 AGGAAAGACACACATTTATGAGG + Intergenic
1153282405 18:3426562-3426584 ATGGAAGACAGACATATATTAGG - Intronic
1153916788 18:9752742-9752764 AATGAATACACACATATTCGAGG + Intronic
1155340151 18:24805538-24805560 AATGAAGACCCAAAGATATGGGG - Intergenic
1156552065 18:38028383-38028405 AATGAAGGCACACACATAGGGGG + Intergenic
1157476356 18:48026038-48026060 ACTGAAGACACACAGCTTGGAGG + Intergenic
1158034322 18:53006083-53006105 ACTGAAGACACACATATATGTGG - Intronic
1158461525 18:57650108-57650130 ACTGAGGAGATAGATATATGGGG + Intronic
1159197699 18:65139822-65139844 AATTAAGACACAAATATATATGG + Intergenic
1159987845 18:74865856-74865878 AGAGAATACACACATATGTGAGG - Intronic
1160289029 18:77573082-77573104 AATGCAGACACACACATATGCGG + Intergenic
1163432360 19:17275959-17275981 TCCCAAGACACACATAAATGAGG - Intronic
1164522033 19:28986843-28986865 ACTGAATACATAAATAAATGAGG + Intergenic
1164772102 19:30817082-30817104 GCTGAAGAAACACTTGTATGAGG - Intergenic
1165394006 19:35554165-35554187 ACTGAAGATACACAGAGATAGGG - Intronic
1166609178 19:44173862-44173884 ACTAAACAAAAACATATATGAGG - Intronic
1167153300 19:47722526-47722548 ACTCAAGACACACAGGTAAGAGG - Intronic
925942310 2:8832498-8832520 ACTGGATAGATACATATATGGGG - Intronic
927164880 2:20307965-20307987 TATGAAGACTCACCTATATGTGG + Exonic
927942713 2:27115309-27115331 ACTGAAGAGTTAAATATATGAGG - Intronic
929216425 2:39418377-39418399 ACTGAATAAATACATAAATGAGG + Intronic
929750192 2:44703477-44703499 ACTGAAGAAAGACATAATTGTGG + Intronic
931532012 2:63225961-63225983 AGTGAACACACACATATAATTGG - Intronic
932030596 2:68179854-68179876 ACTTAAACCACAAATATATGTGG + Exonic
932332734 2:70907246-70907268 CCTGAAAACCCTCATATATGTGG + Intronic
934631028 2:95922295-95922317 ACTGAAGAGACAGAGACATGAGG - Intronic
939252450 2:139699572-139699594 ACAGTAGTCACAGATATATGTGG + Intergenic
939785651 2:146508198-146508220 TCAGTAGACACACACATATGAGG - Intergenic
940550147 2:155143935-155143957 AATGAAGACACAGAGATATAGGG + Intergenic
942874077 2:180771896-180771918 ATTAAACACAGACATATATGAGG + Intergenic
943573347 2:189600906-189600928 ACTGAAAATACAAATATGTGTGG - Intergenic
943670806 2:190658352-190658374 ACTGGAGACACAGAAAAATGAGG - Intronic
945197225 2:207248131-207248153 AATGCATACACACATGTATGTGG + Intergenic
947887508 2:233585469-233585491 GCCGTAGACACACATATAGGGGG - Intergenic
1170486893 20:16827010-16827032 AAAAAACACACACATATATGTGG + Intergenic
1174123543 20:48285878-48285900 ATTGAGAACACACAGATATGTGG - Intergenic
1177122871 21:17159734-17159756 TTTGATGACACACATATTTGAGG + Intergenic
1177723654 21:24939899-24939921 ACATAAGACACAAATATTTGTGG - Intergenic
1178220520 21:30652757-30652779 ACTGAAGACCTACATCTGTGAGG + Intergenic
1178392219 21:32208174-32208196 ACTGCAGACAAACATTTCTGTGG + Intergenic
1182180616 22:28343961-28343983 ACTGAATTTATACATATATGTGG - Intronic
1184221964 22:43106607-43106629 ACAGAGGACACAAATATATCAGG - Intergenic
949402291 3:3678513-3678535 ACTGAAAACACTCATGAATGAGG - Intergenic
949449964 3:4174540-4174562 ACTAAAAACACACACACATGGGG + Intronic
950436899 3:12985576-12985598 CCAGAAGTCACACATATTTGTGG - Intronic
950558132 3:13707263-13707285 ACTGAGGAAACCCCTATATGAGG + Intergenic
951216972 3:20034174-20034196 GCTGAAGACACATATATATTGGG + Intergenic
951792969 3:26507005-26507027 ACCTAAGACACAGATAAATGAGG + Intergenic
952191749 3:31029981-31030003 GCTGAAGACACACAGATTTATGG - Intergenic
957533497 3:81471122-81471144 GCTGAAGACATAGATTTATGAGG - Intergenic
958095930 3:88944229-88944251 ACTGACGAGAGACATATCTGAGG - Intergenic
958266437 3:91443144-91443166 ACTGAATACATAAATAAATGGGG + Intergenic
959306895 3:104678481-104678503 AATGAAGCCACAGATATTTGTGG - Intergenic
959499715 3:107092120-107092142 ACAGAGGACACACATATGTTTGG - Intergenic
960344185 3:116512134-116512156 AGTGAAGACACAGATATCCGAGG + Intronic
960989393 3:123300966-123300988 TCTGAAGACCAAAATATATGGGG + Intronic
961215174 3:125154086-125154108 ACTGAAGACCCACAGATATTGGG + Intronic
963089890 3:141474071-141474093 CTTGAAGACACAGATATCTGTGG - Intergenic
963513198 3:146275175-146275197 GCTGAGGACAGACATATATGTGG - Intergenic
971808995 4:31399017-31399039 ACTGAAGACATCCATATTTAAGG + Intergenic
974170569 4:58261378-58261400 ATTGAAGAAACAAATAAATGGGG + Intergenic
974194507 4:58554671-58554693 ACTGAATTCACATATATATTTGG - Intergenic
976523131 4:86053280-86053302 ACTGAAAACACAATGATATGAGG + Intronic
977142066 4:93386398-93386420 ACTGAAGACTTATATTTATGAGG - Intronic
977586748 4:98782991-98783013 TCTGTATTCACACATATATGTGG + Intergenic
977899952 4:102410671-102410693 TATGTACACACACATATATGTGG - Intronic
979067368 4:116155435-116155457 ACTGAAGACAAACATGCATCAGG - Intergenic
980009407 4:127579489-127579511 AATGAAGACAGACATATAGCAGG + Intergenic
982101448 4:151972130-151972152 TCTGAACACACACATAATTGTGG - Intergenic
982729139 4:158936833-158936855 ACTGCTGACACAGACATATGTGG + Intronic
986412915 5:7499622-7499644 ACTAAAGAAGTACATATATGTGG + Intronic
987948492 5:24646501-24646523 ATTGAATACACACATATACCAGG - Intergenic
988077385 5:26369957-26369979 ACTGAATCTACACATATAAGTGG + Intergenic
988327815 5:29793597-29793619 AATTCAGAAACACATATATGGGG + Intergenic
988666415 5:33333089-33333111 AGTGAATACACAAATATCTGTGG - Intergenic
988960619 5:36367636-36367658 ACTGAAGAAACAGAGAGATGAGG - Intergenic
989214682 5:38892151-38892173 AATGAAGACACACAGCTGTGGGG - Intronic
991491860 5:67191706-67191728 GCTTAAGTCACACATATATAGGG + Intronic
991500913 5:67276485-67276507 ACAGAAGACCCACAGATATATGG - Intergenic
991970602 5:72137231-72137253 ATTGAATTCACTCATATATGTGG - Intronic
994427210 5:99606160-99606182 ATTGAACAATCACATATATGTGG - Intergenic
995235423 5:109824178-109824200 ATAGACCACACACATATATGGGG + Intronic
995829328 5:116336335-116336357 ACTTTAGACACTGATATATGAGG - Intronic
997059998 5:130489220-130489242 CCTGGAGAAACACAGATATGTGG + Intergenic
997406202 5:133648870-133648892 ACTATAGACACACATACATGAGG - Intergenic
1000449635 5:161369802-161369824 ACTGAAGAAAGACAGATAAGAGG - Intronic
1001096150 5:168777007-168777029 ATTGAAAAAACACATATATGTGG - Intronic
1004664620 6:17738408-17738430 AGTGGAGGCACTCATATATGGGG + Intergenic
1005076058 6:21908995-21909017 CCTGAAGACAAAAATATTTGAGG - Intergenic
1007827788 6:44614162-44614184 CCTGAAGCCACACAAATATCTGG - Intergenic
1008022424 6:46595495-46595517 AGTGAAAATACACTTATATGTGG - Intronic
1008348678 6:50461600-50461622 ACTTAGGAAACACATATATAAGG - Intergenic
1010563775 6:77383874-77383896 AATGAATACACTCATATAAGTGG - Intergenic
1011519658 6:88191778-88191800 ATTCAAGACACACATAAATAGGG + Intergenic
1012038925 6:94178814-94178836 TCAGAAGACTCAAATATATGTGG - Intergenic
1013548493 6:111183802-111183824 ACTGAAGACACAGTTACTTGAGG - Intronic
1013673473 6:112430869-112430891 AATGATGACACAAATATAGGTGG + Intergenic
1014332774 6:120091570-120091592 ACTGAAAACAAACATATAATGGG + Intergenic
1015325363 6:131918197-131918219 AAAGAAGACATACAGATATGGGG + Intergenic
1022203780 7:28143250-28143272 TCTGAAGACACACAAGTATCAGG - Intronic
1022223433 7:28339088-28339110 CCTGAAGAGACAAAGATATGTGG - Intronic
1023599949 7:41872320-41872342 AATGATGACACAGTTATATGTGG - Intergenic
1024777100 7:52800097-52800119 TCTGAACTCACACATCTATGGGG - Intergenic
1024922300 7:54572097-54572119 TGTTAAGACACACATATGTGTGG + Intergenic
1026479267 7:70764298-70764320 AATGAAGACACACAAAGAAGAGG - Intronic
1027726080 7:81807733-81807755 ACTGAAAATACACATATTAGCGG - Intergenic
1028287342 7:89018861-89018883 AGAGAAGACACACATAAATAAGG - Intronic
1030521035 7:110598480-110598502 ACTGAAGAGGCAGTTATATGTGG - Intergenic
1031247069 7:119327472-119327494 ACTGAAATCAGACATATATTAGG - Intergenic
1032730165 7:134633611-134633633 TCTAAAGACACACATATATTTGG + Intergenic
1032842203 7:135723220-135723242 ACTGAAGACAGCCATCTATCTGG + Intronic
1036465250 8:8991469-8991491 ACTGAAGCCACATATATTTAAGG + Intergenic
1038412682 8:27370361-27370383 AATGAAGAGACATGTATATGTGG + Intronic
1038988627 8:32841433-32841455 AATAAAAACACAAATATATGTGG - Intergenic
1039320635 8:36426701-36426723 ACTGAAGGAAAACATATTTGGGG - Intergenic
1039935786 8:42043813-42043835 GCTGAAGTCACACAAATATTAGG - Intronic
1041593938 8:59624115-59624137 ACTGAAAACACTCATTTAGGAGG - Intergenic
1041974869 8:63786338-63786360 AATCAAGCCACACATAAATGAGG - Intergenic
1042768934 8:72357397-72357419 ACTGAAGACAAGAATATAGGAGG - Intergenic
1042903676 8:73751807-73751829 ACTGAACACATAAATATATTGGG - Intronic
1043219972 8:77649091-77649113 CCAAAAGACACACCTATATGTGG + Intergenic
1043824073 8:84903511-84903533 ACTGAACACACACACATATGAGG + Intronic
1044920105 8:97160768-97160790 AAAGAAGACACAAATAAATGAGG - Intergenic
1046377997 8:113412301-113412323 ATTGAAGACACACAACTCTGAGG - Intronic
1046707420 8:117470591-117470613 CCTGAAGACCAACATAGATGAGG + Intergenic
1048454380 8:134564820-134564842 ACTGAAGAAACACAAATTAGAGG + Intronic
1049817452 8:144612875-144612897 AATCAATACTCACATATATGTGG - Intergenic
1050080490 9:1910639-1910661 ACTGAAAGCACACTTAAATGGGG - Intergenic
1050626928 9:7514351-7514373 ACTAAAGACACATATAAATGGGG - Intergenic
1051916278 9:22211776-22211798 ACTGAACATACACAGATATTTGG - Intergenic
1052159958 9:25245905-25245927 GCTGAAGACACTCATATAATAGG + Intergenic
1053053789 9:34981613-34981635 AGTGAAGACAGACAGATGTGTGG + Exonic
1053676308 9:40432730-40432752 ACTGAAGTCTCAGATGTATGTGG - Intergenic
1053926082 9:43058846-43058868 ACTGAAGTCTCAGATGTATGTGG - Intergenic
1054287411 9:63192163-63192185 ACTGAAGTCTCAGATGTATGTGG + Intergenic
1054289376 9:63268255-63268277 ACTGAAGTCTCAGATGTATGTGG - Intergenic
1054387410 9:64572801-64572823 ACTGAAGTCTCAGATGTATGTGG - Intergenic
1054508313 9:65943564-65943586 ACTGAAGTCTCAGATGTATGTGG + Intergenic
1055661217 9:78505905-78505927 TCAGAAGACACACACATCTGGGG + Intergenic
1056092561 9:83218874-83218896 AGTGAGGACACACAGGTATGTGG - Intergenic
1056802114 9:89699472-89699494 GCTGAAGCCACACATACATATGG - Intergenic
1057532355 9:95861845-95861867 AAAGAAGACACAAATAAATGGGG - Intergenic
1060430786 9:123549991-123550013 AATCAGGACACAGATATATGTGG + Intronic
1060744183 9:126119300-126119322 ACTGAAGACACACCAGTTTGGGG + Intergenic
1061714177 9:132508655-132508677 TCTGAACACACACAGCTATGAGG - Intronic
1186154469 X:6711183-6711205 ACTGAAGACCCAAAGATACGAGG + Intergenic
1188324102 X:28778290-28778312 ATTGTAAACACACAGATATGTGG + Intronic
1190033825 X:47000917-47000939 ACTGAAGCCACACATGAATTAGG - Intronic
1190124248 X:47689449-47689471 ACTAAGCACACACATATCTGGGG + Intergenic
1194222537 X:91213525-91213547 ATTAACGACACAGATATATGTGG + Intergenic
1194437958 X:93893258-93893280 ACTGGAGAAACAAAGATATGTGG - Intergenic
1194686369 X:96922807-96922829 ACAGAAGAAACAGATATAGGTGG - Intronic
1195724065 X:107895868-107895890 ACTTAAGAGACAGAAATATGGGG - Intronic
1196234644 X:113263737-113263759 ACTGGAAACTCACAAATATGTGG - Intergenic
1197293662 X:124690522-124690544 TGTGTATACACACATATATGTGG + Intronic
1197689633 X:129484695-129484717 ACTGAAGACACAAATAAATTGGG + Intronic
1200559066 Y:4677290-4677312 ATTAACGACACAGATATATGTGG + Intergenic
1201548583 Y:15194550-15194572 ACTGAAGACCCAAAGATACGAGG + Intergenic
1201786131 Y:17781298-17781320 ACTTAAGAAATACATATATTAGG - Intergenic
1201815422 Y:18124690-18124712 ACTTAAGAAATACATATATTAGG + Intergenic
1202093448 Y:21217996-21218018 CCTGAAGAAACAAAGATATGTGG + Intergenic