ID: 1158036471

View in Genome Browser
Species Human (GRCh38)
Location 18:53037706-53037728
Sequence TCCACCTGATTTCAAAGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158036471_1158036475 7 Left 1158036471 18:53037706-53037728 CCCGGTCTTTGAAATCAGGTGGA 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1158036475 18:53037736-53037758 TCATTCTCACATTCCATTTATGG 0: 1
1: 0
2: 2
3: 28
4: 234
1158036471_1158036479 23 Left 1158036471 18:53037706-53037728 CCCGGTCTTTGAAATCAGGTGGA 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1158036479 18:53037752-53037774 TTTATGGGTTCACAACGTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 88
1158036471_1158036478 20 Left 1158036471 18:53037706-53037728 CCCGGTCTTTGAAATCAGGTGGA 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1158036478 18:53037749-53037771 CCATTTATGGGTTCACAACGTGG 0: 1
1: 0
2: 0
3: 5
4: 56
1158036471_1158036476 8 Left 1158036471 18:53037706-53037728 CCCGGTCTTTGAAATCAGGTGGA 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1158036476 18:53037737-53037759 CATTCTCACATTCCATTTATGGG 0: 1
1: 0
2: 2
3: 24
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158036471 Original CRISPR TCCACCTGATTTCAAAGACC GGG (reversed) Intronic
901128112 1:6943382-6943404 GGCACCTGATTTCAGAGAGCGGG + Intronic
901881482 1:12196550-12196572 TCTATCTGATTCCAAACACCTGG - Intronic
903258114 1:22116188-22116210 TCTATCTGATTTCAAAGCCTGGG + Intergenic
904148423 1:28414887-28414909 TTCATCTCATTTCAGAGACCTGG + Intronic
907872559 1:58456192-58456214 AGCAACTGATTTCAAAGACTGGG + Intronic
910765311 1:90776327-90776349 TCTGCCTGATTTCAAAGCCCAGG + Intergenic
916818494 1:168375599-168375621 TCCACCTCCTTTCAAAGACAAGG - Intergenic
917537336 1:175883990-175884012 CACACCAGATTTCAAAAACCTGG - Intergenic
917655635 1:177122771-177122793 TCCTCCTTATTTCAAAGAACTGG + Intronic
918329798 1:183447809-183447831 TCCAGCTGATTTTAAGGTCCTGG - Intergenic
918745734 1:188196474-188196496 TCAACCTCCTTTCAAAGACAAGG + Intergenic
919993784 1:202729169-202729191 TCCACCTGGTTACAAAGAGCAGG + Exonic
920263916 1:204707879-204707901 TCCACCTGACCTCAAACACCAGG + Intergenic
923447954 1:234089932-234089954 TTCTCCTGGTTTCAAAGGCCTGG - Intronic
923450173 1:234109806-234109828 TCCTCCTGACTTCAGAGCCCAGG - Intronic
923493562 1:234505699-234505721 CACATCTGATTTCAAAGCCCAGG - Intergenic
923970014 1:239189846-239189868 TCCACCTGATCCCAAAGTGCTGG - Intergenic
1064029756 10:11876282-11876304 TCTGTCTGATTTCAAGGACCAGG - Intergenic
1064383632 10:14869757-14869779 GCCATCTGAGTTCAAAAACCTGG - Intronic
1064709348 10:18107808-18107830 CCAAGCTGATTTCAAAGATCAGG - Intergenic
1065255610 10:23864193-23864215 TACACCTGATGTGAAAGCCCAGG + Intronic
1070559947 10:77558742-77558764 TCCACCTGATTTGGAATTCCAGG - Intronic
1070987840 10:80703383-80703405 TCCACCTCATTTCTGTGACCCGG - Intergenic
1071238174 10:83673738-83673760 TCCACCTGATGTCTAGGTCCAGG + Intergenic
1072544925 10:96429796-96429818 TTCACCTATTTTCAAAGGCCTGG - Intronic
1073446988 10:103587191-103587213 TCAAGCTGATTTCATTGACCAGG + Intronic
1073914941 10:108391789-108391811 TCCTCCTGATTGCAAAGTCCAGG - Intergenic
1074201687 10:111243197-111243219 CCTGTCTGATTTCAAAGACCAGG + Intergenic
1074715770 10:116217213-116217235 GCCACCGGATCTCAATGACCTGG + Intronic
1076607669 10:131700143-131700165 CCCACCTGGTTTCACAGCCCTGG + Intergenic
1077129480 11:963471-963493 CACACCAGACTTCAAAGACCTGG - Intronic
1077881241 11:6352254-6352276 TCCACCTCATTCTAAAGATCAGG - Intergenic
1079160154 11:17984757-17984779 TCTATCTGACTTCAAAGCCCAGG + Intronic
1080124199 11:28712143-28712165 TCCAGCTGGTCTCAAACACCTGG - Intergenic
1080263183 11:30373007-30373029 TCCACCTGACTTCAGAGCCCTGG - Intergenic
1083257141 11:61503501-61503523 TCCATCTTATTGCAAAGCCCGGG - Intergenic
1084429014 11:69101149-69101171 TCCACCTCATCTCACACACCAGG - Intergenic
1085769661 11:79313544-79313566 TCCTGCTGATTTCAAGGATCTGG + Intronic
1086483507 11:87271523-87271545 TACATCAGATTTCAAAGACTTGG + Intronic
1091979850 12:4855984-4856006 TCCACTTGCTTTCACAGGCCAGG - Intergenic
1092763108 12:11827318-11827340 TCCAAGTGCTTTCAAAGGCCCGG - Intronic
1093007802 12:14069399-14069421 ACAACCTAATTTCAAAGAGCTGG + Intergenic
1094008162 12:25777725-25777747 TCTATCTGTTTTCTAAGACCAGG + Intergenic
1101585882 12:106085170-106085192 TCCATCTTATTACAAAAACCAGG - Intronic
1102297451 12:111747957-111747979 TTCACCTGATTCCAAGGCCCGGG + Intronic
1106432849 13:29697740-29697762 TCCACCTGTTTCCAAAGTCCTGG + Intergenic
1109493425 13:63133703-63133725 TACCCCTAATTTCAAAGTCCTGG + Intergenic
1110283662 13:73724548-73724570 TCCTCCAGAATTCAAATACCTGG - Intronic
1112755924 13:102633350-102633372 TACACCAAATTTCAAAGACTTGG + Intronic
1115101659 14:29708608-29708630 TCCACCTGCTTCCAAAGTGCAGG - Intronic
1116771117 14:49128337-49128359 TCATCCTGATTCCAAAAACCTGG - Intergenic
1118751458 14:68810805-68810827 TCTACCTGTTTTGAAAGACATGG + Intergenic
1119031400 14:71195692-71195714 TCCTCCTGACTTAAAGGACCAGG - Intergenic
1120343554 14:83254014-83254036 GCCACCTCTTCTCAAAGACCTGG - Intergenic
1120511693 14:85423440-85423462 TTAACCTGAATTCAAATACCAGG + Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1122214563 14:100194240-100194262 TCCACCACATTGCCAAGACCAGG + Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1125747210 15:42005144-42005166 TGCTCCTGATGTCAAAGACTTGG - Intronic
1126278475 15:46914200-46914222 TCCAGCTGGTTTCAAACTCCTGG + Intergenic
1130137766 15:81196220-81196242 TCCACCTGTCTCCAAAGCCCAGG - Intronic
1131530560 15:93187735-93187757 TCCATCTGATTCCAGAGCCCAGG - Intergenic
1133065988 16:3207377-3207399 TTTCCCTGATGTCAAAGACCTGG - Intergenic
1135241624 16:20811995-20812017 ACTACCTGAGTTCAAACACCAGG - Intronic
1136515087 16:30763292-30763314 ACCTTCTGCTTTCAAAGACCAGG + Intronic
1138317612 16:56083789-56083811 TACACCTGATATGGAAGACCTGG - Intergenic
1139659831 16:68413108-68413130 TTCACCTGGTGTCAAAGAGCAGG - Intronic
1140069901 16:71640297-71640319 GCCACCTGATTTTAAGGACGTGG - Intronic
1140769482 16:78190361-78190383 TCCACCTTATTTCAAGGTCGGGG - Intronic
1141181789 16:81758185-81758207 TCAGGCTGATTTCAAAGTCCTGG + Intronic
1144032137 17:11332692-11332714 TCCACTTGAATTTAAAGGCCTGG - Intronic
1145212368 17:21023687-21023709 TCCACGTGATGTCAGACACCCGG + Intronic
1145749407 17:27344400-27344422 CCCACCTTGTTTCAAAGTCCTGG - Intergenic
1147211141 17:38873125-38873147 TCCACCTGTTTTCAGAAACCTGG - Intronic
1151856185 17:76723811-76723833 GCCACCTGAATTCAAACCCCTGG - Exonic
1151868814 17:76822638-76822660 TCCACCTCATTCTAAAGCCCAGG - Intergenic
1152296920 17:79472947-79472969 CCCAGCTGATCTCAAACACCAGG + Intronic
1153286368 18:3458527-3458549 TCCACAGGTTTTCAAAGAGCTGG - Intronic
1156522096 18:37730506-37730528 TCCACCAGACTTCAGACACCTGG - Intergenic
1156539045 18:37892025-37892047 TCCACTTGCTTGCACAGACCTGG + Intergenic
1156877164 18:42028710-42028732 TCAACCTCATTTCAAAGATGAGG - Intronic
1157389239 18:47287579-47287601 TCCAACTGATTTCAAAGCAGTGG + Intergenic
1158036471 18:53037706-53037728 TCCACCTGATTTCAAAGACCGGG - Intronic
1160007024 18:75075341-75075363 ACCACCTGATGTCACAGTCCTGG + Intergenic
1160068038 18:75595917-75595939 TCCACGTGATTTCAAAAGTCAGG + Intergenic
1161461020 19:4397685-4397707 GCCATCTGATTTCAAAGTGCTGG + Intronic
1167405729 19:49307085-49307107 CCCAGCTGATTTCAAACTCCTGG + Intronic
926707035 2:15844223-15844245 TCCACCTGAGGGCAGAGACCTGG - Intergenic
928072215 2:28228273-28228295 TCTACCTGATTTCTATTACCTGG - Intronic
928750498 2:34465493-34465515 TCCCTTTGATTTCAAAGCCCAGG - Intergenic
929035778 2:37690304-37690326 TCCACCTCATTTTATAGAACTGG + Intronic
930431145 2:51278094-51278116 TCACCCTGAGTTCAAAGACAAGG + Intergenic
931108382 2:59083101-59083123 ACCACCTGGTTCCAAAGCCCAGG + Intergenic
931906410 2:66848256-66848278 CACTCCTGATTTCAAAGACCTGG - Intergenic
935588270 2:104821455-104821477 TCCACAAGATTACAAAGACTGGG - Intergenic
936827569 2:116600906-116600928 TCAACTTGATTTCAAATAACTGG + Intergenic
936980881 2:118264095-118264117 TCCTCCTGATTCCAATGAACAGG + Intergenic
937373049 2:121315752-121315774 TCCACCTGATATCAAGAACATGG + Intergenic
938750085 2:134320173-134320195 TCCTCCTCCTTTTAAAGACCAGG + Intronic
941203597 2:162544602-162544624 TACACCTGATTTAAAAGTCATGG - Intronic
944982416 2:205136563-205136585 TCCACATGACTTGAAAGAGCTGG + Intronic
945392269 2:209278594-209278616 TCCACCTCTTTTCTGAGACCTGG - Intergenic
1173132371 20:40406555-40406577 TTCACCAGGTATCAAAGACCTGG + Intergenic
1173899134 20:46574237-46574259 TCTCCCTGATTTCAGAGTCCGGG - Intronic
1176389748 21:6157394-6157416 TGCACCTGCCTGCAAAGACCAGG + Intergenic
1178936907 21:36870817-36870839 TCCAACTGTTTTAAAAGACCTGG + Intronic
1179733719 21:43380844-43380866 TGCACCTGCCTGCAAAGACCAGG - Intergenic
1180648890 22:17362503-17362525 TACACCAGATTTCAAAGACTTGG + Intronic
1183813668 22:40280089-40280111 TCCACCTAATTCCAAAGACATGG + Exonic
1185276343 22:49951604-49951626 TCCACCTGTCTTCACAGGCCAGG + Intergenic
949498894 3:4659473-4659495 TCCAGCTGGTCTCAAACACCTGG - Intronic
949665945 3:6339813-6339835 TCCATCTGACTCCAAAGACAAGG + Intergenic
950606565 3:14086590-14086612 CACACCAGATTTCAAAGACTTGG - Intergenic
952524119 3:34192048-34192070 TTCTCTTGATTTCAGAGACCAGG - Intergenic
952885225 3:38007824-38007846 TCCACCTCATGTCTAAGAACGGG - Exonic
954251815 3:49373600-49373622 TCCAGCTGGTTTCAAACAACTGG - Intronic
956735044 3:72231852-72231874 TCTACCTGATATCAAAGCCAGGG - Intergenic
959778987 3:110205433-110205455 TCCACCTAATACCAAAAACCTGG + Intergenic
959948856 3:112155687-112155709 TTCACCTGATATAAAAGACCTGG - Intronic
961146278 3:124596565-124596587 CACACCAGATTTCAAAGACTTGG - Intronic
963963256 3:151334451-151334473 TCCACCTGTTTTTAAAGTACTGG + Intronic
964705901 3:159618192-159618214 TCTACCTGATCTCAAAGCACTGG + Intronic
967353847 3:188545836-188545858 TCCACCTGGGCTCAAAGACAGGG + Intronic
967471160 3:189863631-189863653 TCCTTCTGATGTCAAAGACTAGG - Intronic
967738459 3:192979637-192979659 TCCACTAGATATCAAAGTCCAGG + Intergenic
968079260 3:195835195-195835217 TCAACCTCATTTCACAGACGAGG - Intergenic
972818627 4:42673493-42673515 TCCAACTGATTCCAAAGAAAAGG - Intergenic
973863669 4:55090576-55090598 TTCCCCTGATTTCAAAGTGCTGG + Intronic
974658677 4:64858699-64858721 TCAAGGTGATTTCAAAGGCCAGG + Intergenic
974828207 4:67155971-67155993 TTCATCTGAGTTCAAAGCCCAGG - Intergenic
977059990 4:92246037-92246059 TACACCAGATTTCAAAGAATTGG + Intergenic
980204762 4:129703155-129703177 TCCACCTGACTTTAAAAATCTGG + Intergenic
981440532 4:144777195-144777217 TCCAGCTGATGTCAATGACCTGG + Intergenic
982139542 4:152304855-152304877 TCCTCCCTATTCCAAAGACCAGG + Intergenic
982154509 4:152504771-152504793 TCTACCAGATTTCAAAAACTTGG + Intronic
982465015 4:155719492-155719514 TCCATGTGACTTCAAAGCCCAGG + Intronic
982954795 4:161750365-161750387 TACACCAGGTTTCAAAGACTTGG + Intronic
985616237 5:923433-923455 TCCACCTGGGTTCTAGGACCTGG - Intergenic
986276141 5:6276742-6276764 TCCATCTGATTCCAAAGAGTGGG - Intergenic
988634532 5:32968837-32968859 TCCTCCTGTTTTCAAATACTTGG - Intergenic
990284063 5:54282195-54282217 TCCACATGATTTCCAACACTAGG + Intronic
992369972 5:76133189-76133211 TCCTCCTGATTTTATATACCAGG - Intronic
995062509 5:107826524-107826546 TCCACCAGCTTTTAAAGAGCAGG - Intergenic
995420521 5:111961872-111961894 TCTACATGATTTCAAAATCCAGG - Intronic
995674375 5:114646074-114646096 ACAACCAGATTTCAAAGACTTGG + Intergenic
998228198 5:140342903-140342925 TCCACCTGAAGTCAGAGATCTGG + Intronic
998661995 5:144248984-144249006 TCGATCTGATTTCCAAGATCAGG - Intronic
1000203229 5:159032343-159032365 GCCATCTGATTTCAAAGACTAGG + Intronic
1000592589 5:163176553-163176575 TCCACCTGATGTGAAAGAGGAGG + Intergenic
1001021429 5:168186164-168186186 TCCATCTGATTCCAGAGGCCAGG + Intronic
1004241003 6:13922455-13922477 CACACCAGATTTCAAAGACTTGG - Intergenic
1006524713 6:34594002-34594024 TCCACTGGAGTTCTAAGACCTGG + Intronic
1007464958 6:42045277-42045299 TCTATCTGATTTCAAAGTCTAGG - Intronic
1008761407 6:54856132-54856154 TCTAACTGATTTCAAAGACAGGG - Intronic
1012478788 6:99644841-99644863 CACACCAGATTTCAAAGACTTGG - Intergenic
1012995851 6:105973196-105973218 TCAATCTGAGTCCAAAGACCTGG - Intergenic
1013654777 6:112235029-112235051 TCCTCCTGACATCAAAGACTAGG + Intronic
1014465730 6:121754695-121754717 TCCACATGAGTTTAAAGACTTGG - Intergenic
1017227347 6:152037436-152037458 TTCACGTGATTTCAGAGGCCTGG - Intronic
1021235951 7:18142701-18142723 GCCACCTGAAATCAAAGGCCTGG - Intronic
1024529357 7:50378373-50378395 TCCACCTCATTACAAAGGCGAGG - Intronic
1024633094 7:51265243-51265265 CACACCTGCTTTTAAAGACCTGG + Intronic
1026099229 7:67371053-67371075 TCCACTTTTTTTCAAAGACTCGG - Intergenic
1030348611 7:108458683-108458705 TCAACCTGGCTTCATAGACCAGG - Intergenic
1030852306 7:114504767-114504789 TCCACATGATTCCAAACATCTGG - Intronic
1037483089 8:19323245-19323267 ACTACCGGATTTCAAAGACTTGG + Intronic
1037996257 8:23354493-23354515 TGCACCTGGTTTCAAAGTCAAGG + Intronic
1038519657 8:28219539-28219561 AACACCAGATTTCAAAGACTTGG + Intergenic
1038941497 8:32310749-32310771 TTCACCTCATTTGAAAGTCCAGG + Intronic
1039838722 8:41278535-41278557 TCTACTGGATTTCAAAGACAGGG - Intronic
1041746675 8:61214724-61214746 TGCACCTGATTTCAGATGCCTGG + Intronic
1043600711 8:81934382-81934404 TCCTCCTGCTTTCAAATACTAGG - Intergenic
1045362345 8:101444792-101444814 TCCACCTGTGTTCAAAGCACAGG + Intergenic
1047034754 8:120925120-120925142 TCCTTCTGACTTCAAAGCCCAGG - Intergenic
1047338146 8:123955510-123955532 CCTGCCTGATTTCAAAGCCCAGG - Intronic
1047353283 8:124096179-124096201 ACCAGATGATTTCAAACACCTGG - Intronic
1056295019 9:85184180-85184202 TCTGCCTGATTTCAAAGCCTTGG + Intergenic
1058225354 9:102354583-102354605 TACACCTTATTTCAAACACTTGG - Intergenic
1059560661 9:115331777-115331799 TCCACCTAATTTAAACTACCTGG - Intronic
1059626607 9:116073755-116073777 CCCACCTGACTCCAAAAACCTGG - Intergenic
1061004781 9:127922235-127922257 TCTACCTGACTTCACAAACCTGG - Intronic
1061473446 9:130845600-130845622 GTCACCTGATATCAAACACCTGG - Intronic
1062091478 9:134680790-134680812 TCTGCCTGATGTCAAAGTCCCGG - Intronic
1062482471 9:136758986-136759008 TACTCCTCATTTCAAAGATCAGG - Intergenic
1189290690 X:39883556-39883578 TCTATCTGATGTCAAAGACTGGG - Intergenic
1189588781 X:42489746-42489768 TCCACTTGTTTCCAAAGTCCAGG + Intergenic
1190817065 X:53938350-53938372 TCTACATGATTTCAAAATCCAGG + Exonic
1191915279 X:66194381-66194403 TTCACCTCATCTCAAAGACTGGG - Intronic
1193199526 X:78672074-78672096 CCCACTTAACTTCAAAGACCAGG + Intergenic
1198138649 X:133780626-133780648 TCAACCTGCTTTCACAGAGCCGG + Intronic
1199231139 X:145437277-145437299 CCCAGCTGATTTCAAACTCCTGG + Intergenic