ID: 1158036472

View in Genome Browser
Species Human (GRCh38)
Location 18:53037707-53037729
Sequence GTCCACCTGATTTCAAAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158036472_1158036479 22 Left 1158036472 18:53037707-53037729 CCGGTCTTTGAAATCAGGTGGAC 0: 1
1: 0
2: 1
3: 17
4: 155
Right 1158036479 18:53037752-53037774 TTTATGGGTTCACAACGTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 88
1158036472_1158036478 19 Left 1158036472 18:53037707-53037729 CCGGTCTTTGAAATCAGGTGGAC 0: 1
1: 0
2: 1
3: 17
4: 155
Right 1158036478 18:53037749-53037771 CCATTTATGGGTTCACAACGTGG 0: 1
1: 0
2: 0
3: 5
4: 56
1158036472_1158036475 6 Left 1158036472 18:53037707-53037729 CCGGTCTTTGAAATCAGGTGGAC 0: 1
1: 0
2: 1
3: 17
4: 155
Right 1158036475 18:53037736-53037758 TCATTCTCACATTCCATTTATGG 0: 1
1: 0
2: 2
3: 28
4: 234
1158036472_1158036476 7 Left 1158036472 18:53037707-53037729 CCGGTCTTTGAAATCAGGTGGAC 0: 1
1: 0
2: 1
3: 17
4: 155
Right 1158036476 18:53037737-53037759 CATTCTCACATTCCATTTATGGG 0: 1
1: 0
2: 2
3: 24
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158036472 Original CRISPR GTCCACCTGATTTCAAAGAC CGG (reversed) Intronic
902449880 1:16490363-16490385 ATCCTCCTGATTTTAAAGACAGG - Intergenic
903258113 1:22116187-22116209 GTCTATCTGATTTCAAAGCCTGG + Intergenic
903564140 1:24252089-24252111 GACCACCTGAGTTCAAATTCTGG - Intergenic
906533468 1:46537887-46537909 GTACACCAGATTTCAAATCCTGG - Intergenic
907872558 1:58456191-58456213 GAGCAACTGATTTCAAAGACTGG + Intronic
907887367 1:58605962-58605984 GTGCACCGGATTTTATAGACAGG + Intergenic
908143113 1:61208526-61208548 GTCTTCCTGACTCCAAAGACAGG - Intronic
908389600 1:63672661-63672683 GTGCACCAGATTTTATAGACCGG + Intergenic
909495940 1:76278849-76278871 ATCCACCTGATTTTAAATCCTGG - Intronic
909690568 1:78402776-78402798 ATCCAAATGAGTTCAAAGACAGG - Intronic
911585445 1:99684897-99684919 GTCCACCTGATTCCACAGCTAGG + Intronic
912556572 1:110520546-110520568 GTCCACCCGAGTTCAAATCCTGG + Intergenic
912938381 1:114023582-114023604 GTGCACCGGATTTTATAGACAGG - Intergenic
919492087 1:198217113-198217135 GTCACCCTGATATCAAAGCCAGG + Intronic
920847818 1:209608285-209608307 GTCCACCTGGCTTCCAAGCCTGG - Intronic
922212587 1:223497214-223497236 GTGCACCGGATTTTATAGACAGG - Intergenic
1063995765 10:11617572-11617594 GACCACCTGAGTTCAAATCCTGG + Intergenic
1069314034 10:67075597-67075619 GCCCATCTGATTTCCTAGACTGG - Intronic
1070642855 10:78181672-78181694 GTCCTCCTGATTGCAGAGCCAGG - Intergenic
1072789983 10:98311024-98311046 GTCCTGCTCATTTCAAAGCCTGG + Intergenic
1074311863 10:112329236-112329258 GTGCACCAGATTTTATAGACTGG - Intergenic
1074338110 10:112598756-112598778 GTCCAGCTTATTTAAAAGAAAGG - Intronic
1075470459 10:122685076-122685098 ATCCATCTTATTTTAAAGACAGG - Intergenic
1080931338 11:36814548-36814570 GTAGAGCTGACTTCAAAGACTGG + Intergenic
1081117491 11:39222013-39222035 GAAAACCTGATTTCAAAGAAAGG + Intergenic
1082314290 11:50698102-50698124 GTCAACCTGATACCAAAGACAGG + Intergenic
1082732954 11:56822410-56822432 GATCACCTGATCTCAAAGGCAGG - Intergenic
1083257142 11:61503502-61503524 GTCCATCTTATTGCAAAGCCCGG - Intergenic
1084584732 11:70051220-70051242 TTCCACCTGAATTCAAAAACAGG - Intergenic
1084611002 11:70203049-70203071 GTCCACCTGTTTGCAAAGCGCGG - Intergenic
1087601497 11:100322121-100322143 CTCCAGATGATTTCAAAAACTGG - Intronic
1089031192 11:115331055-115331077 CTCCATCTGATTTCAACTACAGG + Intronic
1090131946 11:124152697-124152719 CTCCATCTGATTCCAAGGACTGG + Intergenic
1090921000 11:131205692-131205714 GTCTACCTGATTCCAAGGCCTGG + Intergenic
1091910116 12:4223760-4223782 GTCCACCTGGTACCAAAGATGGG + Intergenic
1092793361 12:12088249-12088271 GTGCACCGGATTTTATAGACAGG + Intronic
1101606886 12:106253838-106253860 GTCCACCTGGGTTCAAATCCTGG - Intronic
1101913773 12:108880292-108880314 GTCCTCCCAATGTCAAAGACAGG + Intronic
1102297450 12:111747956-111747978 GTTCACCTGATTCCAAGGCCCGG + Intronic
1102583839 12:113909513-113909535 GTCCACCTGACTCCAATGGCTGG + Intronic
1106286031 13:28318602-28318624 GCCAAGCTGCTTTCAAAGACTGG + Intronic
1108812352 13:54243426-54243448 GTCCACTGGATCTCAAAGACAGG + Intergenic
1111932960 13:94530298-94530320 GTCATCCTGATACCAAAGACTGG + Intergenic
1112286084 13:98105603-98105625 GTGCACCAGATTTTACAGACAGG - Intergenic
1116538287 14:46063975-46063997 GTGCACCGGATTTCATAGGCAGG + Intergenic
1117194569 14:53326930-53326952 GTCCACCAGATTTGAGAGAGTGG - Intergenic
1117868592 14:60174681-60174703 GTGCACCAGATTTTATAGACAGG - Intergenic
1118536024 14:66765563-66765585 GTACACATGGATTCAAAGACAGG + Intronic
1119812112 14:77530768-77530790 GTTCTTCTGGTTTCAAAGACTGG + Intronic
1120440782 14:84536170-84536192 CTCCCACTGACTTCAAAGACGGG - Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1123802483 15:23835583-23835605 GTCCACCTGGTTTCAAGAAGAGG + Intergenic
1126216060 15:46156623-46156645 GTGCACCGGATTTTATAGACAGG + Intergenic
1130879491 15:88042874-88042896 GTCTATCTGACTTCAAAGTCTGG + Intronic
1131467438 15:92667158-92667180 GTCCACCTGAGCTCAAAGGTGGG - Intronic
1132494863 16:257812-257834 GTCCCCCTTATTTTAGAGACAGG - Intronic
1132531260 16:451104-451126 CTCCACATTATTTTAAAGACAGG - Intronic
1140486285 16:75296177-75296199 CTCCACCTGATCTCCCAGACAGG - Intronic
1140769483 16:78190362-78190384 TTCCACCTTATTTCAAGGTCGGG - Intronic
1142208880 16:88798033-88798055 ATACACTAGATTTCAAAGACCGG + Intergenic
1143252087 17:5530813-5530835 GTCCATCTGATTCCGAAGTCTGG - Intronic
1143416076 17:6751628-6751650 GACCACGTGATGTCAAGGACAGG + Intergenic
1145853493 17:28127973-28127995 GTTCACCTGATTTGCAAGAGAGG + Intronic
1146514463 17:33478589-33478611 GGCCAGCTGTTTTCAAAGCCAGG + Intronic
1146596537 17:34174099-34174121 GTGCACCAGATTTTATAGACAGG + Intronic
1150590923 17:66561518-66561540 ATACACCTTATTTCTAAGACAGG - Intronic
1151711974 17:75812272-75812294 GCCCACCTGATGTCGTAGACAGG - Exonic
1151905426 17:77045322-77045344 GTCCAACTGAGGTAAAAGACTGG + Intergenic
1154260843 18:12831182-12831204 ATCTACCTGATTTCAAAAACAGG + Intronic
1156448961 18:37255801-37255823 ATCCACCTGAGCTCAAAGAAGGG + Intronic
1156828593 18:41463742-41463764 GACCACCTCATGTCAAAGCCGGG - Intergenic
1158036472 18:53037707-53037729 GTCCACCTGATTTCAAAGACCGG - Intronic
1159227387 18:65556888-65556910 ATCATCCTGATATCAAAGACTGG - Intergenic
1163481176 19:17557147-17557169 TTCCACCTGATTTCTCAGTCTGG + Intronic
927724284 2:25409171-25409193 GGCCACAGGATTTCAAAGTCAGG + Intronic
928251156 2:29681840-29681862 GTGCTCCTGAGATCAAAGACAGG - Intronic
930621992 2:53653173-53653195 GTGCACCAGATTTTATAGACAGG + Intronic
932928744 2:76008299-76008321 GTGCACCGGATTTTATAGACAGG - Intergenic
934713660 2:96531044-96531066 GTCCACCTGACTCCAGAGCCGGG + Intergenic
934953079 2:98592548-98592570 GTCTTCCTGATTTCAAATACTGG - Intronic
935409946 2:102751226-102751248 GTTCACCGGATTTTATAGACAGG + Intronic
935588271 2:104821456-104821478 TTCCACAAGATTACAAAGACTGG - Intergenic
936842725 2:116792344-116792366 GTCTCCCTAATTTCAAAGCCTGG - Intergenic
942230925 2:173860326-173860348 GTCTGCTTGATTCCAAAGACAGG + Intergenic
943734340 2:191337796-191337818 ATCCACCATATTTCAAAGTCTGG - Intronic
945024842 2:205610338-205610360 GTACACAGGATTTCAAACACAGG - Intronic
1170068227 20:12338797-12338819 GTGCACCTGATTTTATAGACAGG + Intergenic
1170695281 20:18652220-18652242 GTGCACTTAATTTCAAGGACGGG - Intronic
1174894561 20:54435015-54435037 ATCAACCTGATTTTAAAGAAAGG + Intergenic
1175124039 20:56738460-56738482 GAACACCTGACTTCAAAGTCTGG + Intergenic
1177436218 21:21056660-21056682 GTCAAACTGATCTGAAAGACAGG + Intronic
1180116481 21:45708980-45709002 GTAGATGTGATTTCAAAGACTGG + Intronic
1180399155 22:12392495-12392517 GTCATCCTGATACCAAAGACGGG + Intergenic
1181753779 22:25008559-25008581 GGCCACCTGATTTCAAATCCTGG + Intronic
949336477 3:2980772-2980794 GTACACCAGATTTTATAGACAGG + Intronic
951266987 3:20578805-20578827 GTACATCTGAACTCAAAGACAGG + Intergenic
952885226 3:38007825-38007847 GTCCACCTCATGTCTAAGAACGG - Exonic
956735045 3:72231853-72231875 ATCTACCTGATATCAAAGCCAGG - Intergenic
956791295 3:72682055-72682077 GTCCAACCGGTTTCAAGGACAGG - Intergenic
957279462 3:78131160-78131182 GTCTACCTTATCTCCAAGACTGG - Intergenic
966043195 3:175517823-175517845 GTACACCGGATTTTATAGACAGG + Intronic
967353846 3:188545835-188545857 GTCCACCTGGGCTCAAAGACAGG + Intronic
967393484 3:188980452-188980474 ATCTTCCTGATTTCAAAGAGTGG + Intronic
969145432 4:5119270-5119292 GTCCACATAATTTCACACACAGG - Intronic
969500703 4:7550964-7550986 GCCCATCTCATTTCAAAGCCAGG + Intronic
970134464 4:12906951-12906973 ATCCACCTGATACCAAAGCCTGG + Intergenic
971062372 4:22986852-22986874 GTGCACCTGACTCCAAAGATTGG - Intergenic
971067193 4:23046400-23046422 GACCACCTGAGTTCAAATTCTGG - Intergenic
972823760 4:42732876-42732898 GCCCACCTGTATTGAAAGACTGG + Intergenic
977705362 4:100064745-100064767 GTCCAAGTGCTGTCAAAGACTGG - Intergenic
977906293 4:102481556-102481578 GTCATCCTGATATCAAAGCCTGG + Intergenic
982267251 4:153549295-153549317 GAACAACTGTTTTCAAAGACTGG - Intronic
984486141 4:180372412-180372434 GGTCACCTGAATTCAAATACTGG + Intergenic
985140568 4:186835698-186835720 GTTGACATAATTTCAAAGACTGG - Intergenic
986212707 5:5689386-5689408 GTGCACCAGATTTTATAGACAGG + Intergenic
986276142 5:6276743-6276765 ATCCATCTGATTCCAAAGAGTGG - Intergenic
988799425 5:34682535-34682557 TTCCATCTCATTTGAAAGACTGG - Intronic
989501838 5:42177210-42177232 TTCCAGCTGCTTTCAAAGGCTGG + Intergenic
992609762 5:78497084-78497106 GTCCACCTGATCTCAACAAATGG + Intronic
997427076 5:133810624-133810646 GTGCACCAGATTTTATAGACAGG + Intergenic
998444512 5:142188187-142188209 GTCCACCTGGATTAAAACACTGG + Intergenic
999455190 5:151709458-151709480 GTGCACCAGATTTTATAGACTGG - Intergenic
999726474 5:154442458-154442480 GTCCACCTGTTCCCAAAGAAGGG + Intergenic
1000821920 5:165995411-165995433 GTCCACCTTAATTCCAGGACGGG - Intergenic
1000933032 5:167275150-167275172 GTCCAACTGATTTTTAAGAAAGG - Intergenic
1003484643 6:6564957-6564979 TCCCCCCTGATTTCAAAGACAGG - Intergenic
1008761408 6:54856133-54856155 TTCTAACTGATTTCAAAGACAGG - Intronic
1014291825 6:119567008-119567030 GTGCACCGGATTTTATAGACAGG - Intergenic
1014640073 6:123898757-123898779 GTCCAGCTAATACCAAAGACAGG - Intronic
1015515598 6:134079819-134079841 GTGCACCGGATTTTACAGACAGG - Intergenic
1016458404 6:144256439-144256461 ATTAACCTGATTCCAAAGACTGG - Intergenic
1016915490 6:149240361-149240383 GTCCCCCTTGTTTCATAGACTGG - Intronic
1017218218 6:151935331-151935353 TTCCACCTGTTTTCCAAGTCTGG - Intronic
1017664249 6:156703905-156703927 GTGCAGCTGATTGCATAGACTGG + Intergenic
1021101323 7:16587931-16587953 GTGCACCGGATTTTACAGACAGG + Intergenic
1022304824 7:29137303-29137325 GTGCACCAGATTTTATAGACAGG + Intronic
1023129084 7:36984708-36984730 GTCCACTTGACTTCAAATAATGG - Intronic
1023230902 7:38027970-38027992 GGCCACGTGATTTCACAGGCGGG + Intergenic
1023662529 7:42484960-42484982 GTCCCTCTGTTTTCAATGACAGG + Intergenic
1024770473 7:52715797-52715819 GTGCACCGGATTTTATAGACAGG + Intergenic
1025153728 7:56584535-56584557 GTGCACCAGATTTTATAGACTGG - Intergenic
1026214713 7:68338156-68338178 GTTCATCTGATTTTATAGACAGG + Intergenic
1026245227 7:68613640-68613662 GTGCATCAGATTTCATAGACAGG - Intergenic
1028679196 7:93506010-93506032 GTACACCGGATTTTAGAGACAGG - Intronic
1028938442 7:96491959-96491981 GTACACCTGAATTCAAACATAGG - Intronic
1031177131 7:118367944-118367966 GCCTACCTTATTTTAAAGACAGG - Intergenic
1032519026 7:132528666-132528688 GTCCACCTGTTTACAATGCCTGG + Intronic
1033250463 7:139754001-139754023 TTCCACCTGACTTCAAAGACGGG + Intronic
1036634808 8:10541539-10541561 GCTCACCTGATTACAGAGACTGG - Intronic
1038872437 8:31509799-31509821 GTCATCCTGATACCAAAGACTGG + Intergenic
1038880302 8:31604297-31604319 TTACACCTGATTTCACAGGCTGG - Intergenic
1039160046 8:34607983-34608005 CAACAACTGATTTCAAAGACTGG - Intergenic
1039838723 8:41278536-41278558 CTCTACTGGATTTCAAAGACAGG - Intronic
1042488105 8:69368748-69368770 GTCTATCTGATTCCAAAGACCGG + Intergenic
1044066531 8:87706015-87706037 TTCCAGCTGCTTTCACAGACTGG + Intergenic
1044656891 8:94557749-94557771 GTGCACCAGATTTTATAGACAGG + Intergenic
1044865385 8:96565728-96565750 GTCCATCTGATTGGAAAGGCTGG + Intronic
1046320394 8:112566907-112566929 GTACACCAGATTTTATAGACAGG - Intronic
1047181471 8:122592930-122592952 GTCCACCTCAGTTCACAGACAGG + Intergenic
1048502191 8:134988437-134988459 CTGCAGCTGATTCCAAAGACTGG + Intergenic
1052263089 9:26540127-26540149 GTGCACCAGATTTTATAGACAGG - Intergenic
1054781190 9:69167358-69167380 GTTCACCTAATGTCGAAGACAGG + Intronic
1056777530 9:89524475-89524497 GTCCATCTGGGTTCAAGGACAGG - Intergenic
1057421332 9:94915465-94915487 GTCAACCAGATTTCAAAGGAAGG - Intronic
1057925937 9:99148979-99149001 GTCCACCTGCTTTCCAGCACTGG + Intronic
1058664302 9:107296187-107296209 GTGCACCTGGTTCCAAAGTCTGG + Intronic
1058908720 9:109501320-109501342 GTCAATCTGATCTCAAAGTCAGG + Intergenic
1059763374 9:117360700-117360722 GCCAACCTGATTTCAAGGCCTGG + Intronic
1060084715 9:120686693-120686715 GTCCACCTGACTTTAAAGATTGG - Intronic
1186996360 X:15127657-15127679 GTACATCTGATTTCACAGTCTGG + Intergenic
1189290691 X:39883557-39883579 GTCTATCTGATGTCAAAGACTGG - Intergenic
1190759521 X:53427986-53428008 ATCCACCTGATCCCAAAGAAAGG - Exonic
1191915280 X:66194382-66194404 TTTCACCTCATCTCAAAGACTGG - Intronic
1195939819 X:110158821-110158843 GACTACCTGGTTTCAAATACTGG + Intronic