ID: 1158037903

View in Genome Browser
Species Human (GRCh38)
Location 18:53056340-53056362
Sequence AATCCCCGTGTGTTGAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1860
Summary {0: 1, 1: 2, 2: 43, 3: 353, 4: 1461}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158037903_1158037907 2 Left 1158037903 18:53056340-53056362 CCCTTTCTCAACACACGGGGATT 0: 1
1: 2
2: 43
3: 353
4: 1461
Right 1158037907 18:53056365-53056387 AATTCGAGATGAGATTTGGGTGG 0: 391
1: 9076
2: 12924
3: 9942
4: 7736
1158037903_1158037906 -1 Left 1158037903 18:53056340-53056362 CCCTTTCTCAACACACGGGGATT 0: 1
1: 2
2: 43
3: 353
4: 1461
Right 1158037906 18:53056362-53056384 TACAATTCGAGATGAGATTTGGG 0: 403
1: 8457
2: 12329
3: 9573
4: 6505
1158037903_1158037905 -2 Left 1158037903 18:53056340-53056362 CCCTTTCTCAACACACGGGGATT 0: 1
1: 2
2: 43
3: 353
4: 1461
Right 1158037905 18:53056361-53056383 TTACAATTCGAGATGAGATTTGG 0: 355
1: 3839
2: 11950
3: 12661
4: 10322
1158037903_1158037908 3 Left 1158037903 18:53056340-53056362 CCCTTTCTCAACACACGGGGATT 0: 1
1: 2
2: 43
3: 353
4: 1461
Right 1158037908 18:53056366-53056388 ATTCGAGATGAGATTTGGGTGGG 0: 406
1: 9051
2: 12505
3: 10716
4: 7104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158037903 Original CRISPR AATCCCCGTGTGTTGAGAAA GGG (reversed) Intronic
900702354 1:4056116-4056138 CATCCCCATGTGTCGAGGAAGGG + Intergenic
900722717 1:4187883-4187905 AATTCCCATGTGTTGAGGGAGGG - Intergenic
900743736 1:4346053-4346075 AATCCCCATGTGTCGAGGGAGGG + Intergenic
900865168 1:5263586-5263608 AATTCCTGTGTGTTGTGGAAGGG + Intergenic
900895909 1:5482694-5482716 AATTCCCATGTGTTGAGGGAGGG + Intergenic
901710840 1:11113837-11113859 AATCCCCATGTGTTGTGGGAGGG + Intronic
902102399 1:14002323-14002345 AATTCCCATGTGTTGTGAAAGGG + Intergenic
902165561 1:14568621-14568643 AATCCCCATGTGTTGTGGGAGGG - Intergenic
902673856 1:17994657-17994679 AATCCCCATGTGTTGAGGGAGGG + Intergenic
902699102 1:18159441-18159463 AATTCCCATGTGTTGTGGAAGGG + Intronic
902949932 1:19874334-19874356 AATCCCCACGTGTTGAGGGAGGG + Intergenic
903149099 1:21392782-21392804 AATCCCCACGTGTTGAGGGAGGG - Intergenic
904425632 1:30421098-30421120 AATCCACATGTGTTGAGTATAGG - Intergenic
904573528 1:31486246-31486268 AATCCCCATGTGTCGAGGGAGGG + Intergenic
904818438 1:33222841-33222863 AATTCCCATGTGTTGTGAGAGGG + Intergenic
904856597 1:33502473-33502495 AATCTCCATGTGTTGTGGAAGGG + Intergenic
905352450 1:37356960-37356982 AATCCCCACGTGTTGAGGGAGGG + Intergenic
905382074 1:37569810-37569832 AATCCCCATGTGTTGTGGGAAGG + Intronic
906035917 1:42750426-42750448 AATTCCCATGTGTTGTGGAAGGG + Intronic
906831302 1:49034582-49034604 AATCCCCATGTGTTGTGGGAGGG + Intronic
906909446 1:49931605-49931627 ATTCCCCATGTGTTGAGGGAGGG - Intronic
907147531 1:52248959-52248981 AATCCCCATGTGTTGGGGGAGGG + Intronic
907382594 1:54103526-54103548 AATCCCCACGTGTTGAGGGAGGG - Intronic
907696515 1:56735586-56735608 AATCCCCATGTGTCGAGGGAGGG + Intronic
907733781 1:57092353-57092375 AATCCCCATGTGTTGAGGGAGGG + Intronic
907785738 1:57610812-57610834 AATCCCCAGATGTTGAGAAACGG - Intronic
907877960 1:58513094-58513116 AATCCCCATGTGTCGAGGGAGGG + Intronic
908012199 1:59790155-59790177 AATCCCCATGTGTTGTGGGAGGG + Intergenic
908118567 1:60964715-60964737 AATCCCCATGTGTTGTGGGAGGG - Intronic
908241497 1:62192763-62192785 AATTCCCCTGTCTTGATAAATGG - Intergenic
908315891 1:62932198-62932220 AATCCCCATGTGTCGAGGTAGGG + Intergenic
908427961 1:64026840-64026862 AATCCCCATGTGTTGAGGGAGGG - Intronic
908564074 1:65336347-65336369 AATCCCCATGTGTTGTGGGAGGG - Intronic
908919132 1:69169132-69169154 AATTCCCATGTGTTGTGGAATGG + Intergenic
908919388 1:69171039-69171061 AATTCCCATGTGTTGCGGAAGGG + Intergenic
909083567 1:71145761-71145783 AATCCACGTGTGTTTGGAGAGGG + Intergenic
909250358 1:73345065-73345087 AATTCCCATGTGTTGTGAGAGGG + Intergenic
909320170 1:74275429-74275451 AATCCCCATGTGTTGTGGGAGGG - Intronic
909436492 1:75648077-75648099 AATCCCCATTTGTTGGGGAAGGG + Intergenic
909573311 1:77142786-77142808 AATCCCCATGTGTGGAGAGAAGG - Intronic
909633088 1:77787203-77787225 AATTCCCATGTGTTGTGAGAGGG - Intronic
909757996 1:79251547-79251569 AATCCCCGTGTGTTGGGGAAGGG - Intergenic
909849182 1:80438531-80438553 AATCCCCATGTGTTGAGGGAGGG - Intergenic
909940996 1:81611804-81611826 AATCCCCACGTGTTGAGGAAGGG + Intronic
909973657 1:82020923-82020945 AATCCCCATGTGTCGAGGGAGGG + Intergenic
909984483 1:82143864-82143886 AATCCCCATGTGTTGTGGGAGGG + Intergenic
910147558 1:84100292-84100314 AATCCCCACGTGTTGAGGGAGGG - Intronic
910374998 1:86558789-86558811 AATCCCCACGTGTTGTGGAAGGG - Intronic
910380096 1:86617223-86617245 AATCCTCATGTGTTGAGGGAGGG - Intergenic
910417049 1:87012516-87012538 AATTCCCATGTGTTGTGAAAGGG - Intronic
910698972 1:90051694-90051716 AATCCCCATGTGTTGAGGGAGGG + Intergenic
910726778 1:90348270-90348292 AATCCCCCTGTGTTGAGGGAGGG + Intergenic
910797653 1:91115095-91115117 AATCCCCATGTGTCAAGAGAGGG - Intergenic
911106876 1:94140346-94140368 AATCCCCATGTGTTGTGGGAGGG + Intergenic
911343664 1:96671243-96671265 AATCCCCATGTGTCAAGAGAGGG - Intergenic
911376230 1:97055662-97055684 AATCCCCATGTGTTGTGGGAGGG + Intergenic
911434107 1:97832722-97832744 AATCCCCATGGGTTGAGGGAAGG + Intronic
911535102 1:99090211-99090233 AATTCCCATGTGTTGTGAGAGGG + Intergenic
911686140 1:100779963-100779985 AATTCCCATGTGTTGTGGAAGGG - Intergenic
911817057 1:102367165-102367187 AATCCTCATGAGTTGAGGAAGGG + Intergenic
911821835 1:102433996-102434018 AATCCCCACGTGTTGAGGAAGGG + Intergenic
911841886 1:102693398-102693420 AATCCCCGTGTGTTATGGGAGGG + Intergenic
911848591 1:102785089-102785111 AATCCCCATGTGTTGTGGGAGGG - Intergenic
912044182 1:105434212-105434234 AATCCCCATGTGTTGAAGGAGGG - Intergenic
912301765 1:108524983-108525005 AATCCCCATGTGTCGAGGGAGGG - Intergenic
912328565 1:108794581-108794603 AATCCCCATGTGTTGTGGGAGGG - Intronic
912614432 1:111084002-111084024 AATCCCCATGTGTCAAGGAAGGG + Intergenic
912936399 1:114007143-114007165 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
912958207 1:114171200-114171222 AATCCCCTTGTGTTGAGGGAGGG - Intergenic
912960834 1:114194193-114194215 AATTCCCATGTGTTGAGGGAGGG - Intergenic
913059573 1:115192695-115192717 AATCCCCATGTGCTGTGAGAGGG + Intergenic
913205684 1:116536476-116536498 AATTCCCATGTGTCGAGAGAGGG + Intronic
913717877 1:121556577-121556599 AATCCCCGGATGTTGTGAACTGG - Intergenic
914924049 1:151868374-151868396 AATCCCCATGTGTTGGGGACAGG - Intergenic
915766932 1:158372748-158372770 AATCCCCATGTGTTGAGGGAGGG - Intergenic
915885786 1:159719192-159719214 AATCCCCATGAGTTGAGGGAGGG + Intergenic
915952955 1:160202065-160202087 AAACACCATGTGTTCAGAAAAGG - Intergenic
916004766 1:160649465-160649487 AATCCCCAAGTGTTGAGAAAGGG + Intergenic
916304306 1:163312049-163312071 AATCCCCGGGTGTTGAGGGAGGG + Intronic
916910382 1:169340164-169340186 AATCCCCATGTGTCAAGACAGGG + Intronic
917140281 1:171828331-171828353 AATCCCCAGGTGTTGAGAGTGGG - Intergenic
917652905 1:177096555-177096577 AATCCCCATGTGTTATGAGAGGG + Intronic
918429513 1:184444303-184444325 AATTCCCATGTGTTGTGGAAGGG + Intronic
918718030 1:187817345-187817367 AATCCCCATGTGTTGTGGGAAGG - Intergenic
918737650 1:188086619-188086641 AATCCCCATGTGTTGTGGGAGGG - Intergenic
918789525 1:188808425-188808447 AATCCCCATGTATTGAGGGATGG - Intergenic
918806611 1:189055308-189055330 AATCCCCATGTGTTGATGAAAGG + Intergenic
918871380 1:189978694-189978716 AATTCCCATGTGTTGTGAGAGGG - Intergenic
918956605 1:191216845-191216867 AATCCCAATGTGTTGAAGAAGGG - Intergenic
919021846 1:192115850-192115872 AATCCCCATGTGTTGTGGGAGGG + Intergenic
919044340 1:192431561-192431583 AATCCCCGTATGTTGAGGAAGGG + Intergenic
919317495 1:195991865-195991887 AATCCCCGTGTCTCGTGAGAGGG + Intergenic
919362545 1:196612549-196612571 AATTCCCATGTGTTGTGAGAGGG + Intergenic
919366748 1:196670410-196670432 AATCCCTGTGTGTTGAGGGAAGG + Intronic
919456700 1:197829221-197829243 AATCCCCATGTGTGGAGGGAGGG + Intergenic
919480892 1:198087717-198087739 AATCCTCATGTGTTGAGGGAGGG - Intergenic
919573421 1:199277026-199277048 AATTCCCATGTGTTGTGAGAAGG + Intergenic
919829870 1:201532771-201532793 AATCCAGCTGTGGTGAGAAATGG - Intergenic
920141792 1:203821060-203821082 AATCCCCATGTGTTAAGGGAGGG + Intronic
920779875 1:208978898-208978920 AATTCCCGTGTGTCGAGGGAGGG + Intergenic
920779882 1:208978927-208978949 AATCCCCATATGTTGAGGGAGGG + Intergenic
921284830 1:213599969-213599991 AATCCCCATGTGTAGAGGGAGGG + Intergenic
921466466 1:215493425-215493447 AATTCCCATGTGTTGTGGAAGGG + Intergenic
921653468 1:217706380-217706402 AATCCCCACATGTTGAGGAAGGG + Intronic
921653475 1:217706409-217706431 AATCCCCATGTGTTGAGGAAGGG + Intronic
921718859 1:218448567-218448589 AATCCCCATGTGTTGTGGGAGGG + Intergenic
921720700 1:218467576-218467598 AATGCCAGTGGGATGAGAAAAGG - Intergenic
921880625 1:220250659-220250681 AATCCCCATGTGTTGTGGGAGGG + Intronic
922098356 1:222461508-222461530 AATCCCCATGTGTTGGGGGAGGG + Intergenic
923088887 1:230723028-230723050 AATCCCCATGTGTCAAGAGAGGG + Intergenic
923330863 1:232923355-232923377 AATTCCCATGTGTTGTGAAGGGG - Intergenic
923331315 1:232927511-232927533 AATTCCCATGTGTTGAGGGAGGG - Intergenic
923339374 1:232994675-232994697 AATCCCCATGTGTTGAGGGAGGG + Intronic
923758005 1:236811273-236811295 AATTCCCGCGTGTTGTGAGAGGG - Intronic
923981907 1:239334157-239334179 AATTCCCATGTGTTGTGGAAGGG - Intergenic
923988433 1:239408047-239408069 AATCCCCATGTGTGGTGAGAGGG + Intronic
924111869 1:240708060-240708082 AATACCTGGGTGCTGAGAAAAGG + Intergenic
924126413 1:240857793-240857815 AATCCCCATGTGTTGTGGGAGGG + Intronic
924701583 1:246459026-246459048 AATCCCCGTGTGTTGAAGGAGGG + Intronic
1062770325 10:94912-94934 AATCCCCATGTGTCAAGGAAGGG - Intergenic
1063008282 10:1995875-1995897 AATCCAGGTGTGTTGAGGGAGGG + Intergenic
1063053009 10:2474241-2474263 AATCCCCATGTGTCGTGAGAGGG - Intergenic
1063594197 10:7418740-7418762 AATCCCCATGTATTGAGAGAGGG - Intergenic
1063738878 10:8795090-8795112 AATCCCAGTGTGTTGAGAAAGGG - Intergenic
1063834626 10:9998452-9998474 AATCCCCACATGTTGAGGAAGGG + Intergenic
1064105541 10:12498108-12498130 AATCCCCATGTGTTGTGGGAGGG - Intronic
1064161848 10:12953319-12953341 AATTCCCGTGTGTTGTGAGAGGG - Intronic
1064178158 10:13093394-13093416 AATTCCCGTGTGTTGTGGGAGGG - Intronic
1064361198 10:14666474-14666496 AATCCCCATGTGTTGTGGGAGGG - Intronic
1064453711 10:15467342-15467364 AATCCCCATGTGTTGCGGGAGGG - Intergenic
1064896172 10:20239615-20239637 AATCCCCACGTGTTGAGAGAGGG - Intronic
1064902572 10:20311247-20311269 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
1065159765 10:22908033-22908055 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1065209520 10:23389241-23389263 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1065233793 10:23625901-23625923 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1065277739 10:24102850-24102872 AATCCCCATGTGTTGTGGGAAGG + Intronic
1065405472 10:25358422-25358444 AATTCCCATGTGTTGTGGAAGGG + Intronic
1065460441 10:25957182-25957204 AATTCCCATGTGTTGTGGAAGGG + Intronic
1066098507 10:32095932-32095954 AATTCCCTTGTGTTGTGAGAGGG + Intergenic
1066346905 10:34596614-34596636 CATCCCCGTGTGTTGGGGAAGGG - Intronic
1066677612 10:37904687-37904709 AATCCCCATGTGTTGAAGGAAGG + Intergenic
1066701644 10:38135869-38135891 GATCCCCATGTGTTGTGAGAGGG - Intergenic
1066705564 10:38174340-38174362 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1066756103 10:38714508-38714530 AATCCCCAGGAGTTGAGAAAGGG - Intergenic
1066984879 10:42455994-42456016 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1067241387 10:44497587-44497609 CCTCCCTGTCTGTTGAGAAATGG - Intergenic
1067457425 10:46429606-46429628 AATTCCCGTGTGTTGTGGGAGGG - Intergenic
1067966791 10:50922681-50922703 AATCCCCACGTGTTGTGAGAGGG - Intergenic
1068089945 10:52421175-52421197 AATCCCCCTGTCTTGATAAATGG + Intergenic
1068158222 10:53228676-53228698 AATCCCCACGTGTCGAGAGAGGG - Intergenic
1068220101 10:54033045-54033067 AATCCCCATGTGTTGAGGGAGGG - Intronic
1068243672 10:54337405-54337427 AATCCCCAAGTGTTGAGGGAGGG + Intronic
1068244004 10:54341239-54341261 AATCCCCATGTATTGAGGGAGGG + Intronic
1068251966 10:54454921-54454943 AATCCCCATGTGTTGTGGGAGGG + Intronic
1068312073 10:55291986-55292008 AATTCCCATGTGTTGTGAGAAGG - Intronic
1068315184 10:55332632-55332654 AATTCCTATGTGTTGTGAAAGGG + Intronic
1068358624 10:55945509-55945531 AATCACAGTGTGTTTAAAAATGG + Intergenic
1068364782 10:56033557-56033579 AATTCCCATGTGTTGTGAGAGGG + Intergenic
1068366653 10:56059467-56059489 AATCCCCATGTGTGGAGGGAAGG + Intergenic
1068781508 10:60923672-60923694 AATTCCCATGTGTTGTGAGAGGG + Intronic
1069121106 10:64570531-64570553 AATTCCCATGTGTTGTGAAAGGG + Intergenic
1069156013 10:65032020-65032042 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1069217343 10:65838609-65838631 AATCTCCGTGTGTCGAGGGAAGG - Intergenic
1069261485 10:66403583-66403605 AATCCCCGTGTGTTGAGGGAGGG - Intronic
1070466700 10:76731260-76731282 AATCCCCATGTGTGGTGAGAAGG + Intergenic
1070989741 10:80721178-80721200 AATCCCCACGTGTTGTGGAAGGG - Intergenic
1071191104 10:83102030-83102052 AATCCTCATGTGTTGAGGGAGGG + Intergenic
1071605215 10:86981126-86981148 AATCCCCATGTGTTGGGGGAGGG + Intronic
1071753932 10:88514360-88514382 AATCCCCATGTGTCGAGGGAGGG - Intronic
1071936072 10:90531694-90531716 AATTCCCCTGTCTTGATAAATGG - Intergenic
1073525173 10:104174495-104174517 AATTCCCATGTGTTGTGGAAGGG - Intronic
1073549300 10:104382609-104382631 AATCCCCATGTGTCGAGGGAGGG + Intronic
1073648876 10:105337586-105337608 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1073654857 10:105402798-105402820 AATTCCCATGTGTTGTGGAAGGG + Intergenic
1073923987 10:108492884-108492906 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1073947523 10:108768156-108768178 AATCCCCAGGTGTTGAGGGAGGG + Intergenic
1074007240 10:109439707-109439729 AATCTCCATGTGTTGAGGGAGGG - Intergenic
1074068979 10:110048024-110048046 AATTCCCATGTGTTGTGAGAGGG + Intronic
1074226573 10:111489803-111489825 AATCCCCATGTGTCAAGGAAGGG + Intergenic
1074511861 10:114120295-114120317 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1074640368 10:115371878-115371900 AATTCCCATGTGTTGTGGAAAGG + Intronic
1074686443 10:115966361-115966383 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1074690798 10:116002541-116002563 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1074965964 10:118490898-118490920 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1074996146 10:118759128-118759150 AATCCCAGTGTGTCCAGAATTGG + Intergenic
1075826031 10:125357691-125357713 AATTCACATGTGTTGTGAAAGGG - Intergenic
1075988461 10:126810246-126810268 AATTCCCACGTGTTGTGAAAGGG + Intergenic
1076078884 10:127559915-127559937 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1076099676 10:127766062-127766084 AATTCCCCTGTCTTGATAAATGG - Intergenic
1076377495 10:130001409-130001431 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1076455589 10:130591540-130591562 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
1076657440 10:132034237-132034259 AATCCCCAGGTGTTGAGGGAAGG + Intergenic
1076728878 10:132428599-132428621 AAGCCCCCTGCCTTGAGAAATGG + Intergenic
1076798189 10:132808896-132808918 AAGCCTCGTCTGTGGAGAAAGGG + Exonic
1076856641 10:133118694-133118716 AATCCCCATGTGTTGAGGGCAGG - Intronic
1077396253 11:2324496-2324518 AATCCCCATGTGTTCTGAAAGGG + Intergenic
1077575615 11:3380820-3380842 AATTCCCGTGTGTTGTGGGAGGG + Intergenic
1077699149 11:4423913-4423935 AATCCCCATGTGTTGAGGGAAGG + Intergenic
1077710137 11:4528112-4528134 AATCCCCACATGTTGAGGAAGGG + Intergenic
1077908426 11:6552765-6552787 AATCCCCATATGTTGAGGGAGGG - Intronic
1077985184 11:7344015-7344037 AATTCCCATGTGTTGTGAGAGGG - Intronic
1078385583 11:10889225-10889247 AATTCCCCTGTCTTGATAAATGG - Intergenic
1078518628 11:12046280-12046302 AATCCCCACGTGTGGAGGAAGGG + Intergenic
1078584557 11:12571165-12571187 GATCCCCATGTGTCGAGGAAGGG - Intergenic
1079533055 11:21478267-21478289 AATCCCCATGTGTCGAGGGAGGG - Intronic
1079556073 11:21760229-21760251 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1079626209 11:22619797-22619819 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1079630050 11:22663223-22663245 AATCCCCAAATGTTGAGAGAGGG - Intronic
1079896595 11:26126926-26126948 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1079991670 11:27253008-27253030 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1080114263 11:28604529-28604551 AATCCCAGTGTGCTGAGGGACGG + Intergenic
1080153494 11:29079510-29079532 AATTCCCATGTGTTGTGAGAGGG + Intergenic
1080205561 11:29725007-29725029 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1080243560 11:30154635-30154657 AGTCCCCATGTGTTGAGGGAGGG - Intergenic
1080285048 11:30601231-30601253 AATCCCCATATGTTGTGAGACGG + Intergenic
1080401224 11:31937758-31937780 ACTCCCCATGTGTTGAGGGAAGG - Intronic
1080768755 11:35321228-35321250 AATCCCCATGTGTTGTGGAAGGG - Intronic
1080824893 11:35839531-35839553 AATCCCTGCGTGTTGAGGAAGGG - Intergenic
1080927050 11:36768461-36768483 AATCCCCATGTGTTGTGGAAGGG - Intergenic
1080975535 11:37335453-37335475 AATCCCCATGTGTTGTGGGATGG + Intergenic
1081033966 11:38118149-38118171 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1081230523 11:40580439-40580461 AATCCCCAGGTGTTGAGGTAGGG - Intronic
1081316740 11:41639146-41639168 AATTCCCCTGTCTAGAGAAATGG + Intergenic
1081452424 11:43184328-43184350 AATTCCCATGTGTTGAGAGAGGG - Intergenic
1081455257 11:43215596-43215618 AATCCCCTTGTGTTGTGGAAGGG + Intergenic
1081737742 11:45415972-45415994 AATCCCCATGTGTTGGGGGAGGG + Intergenic
1082143154 11:48633207-48633229 TATCCCCATGTGTTGTGGAAGGG + Intergenic
1082570347 11:54730570-54730592 TATCCTCATGTGTTGTGAAAGGG + Intergenic
1082638613 11:55627543-55627565 AATCCCCATGTGTTGTGAGAGGG + Intergenic
1083051896 11:59784773-59784795 AATCCCCATGTGTTGTGGGAGGG - Intronic
1083135966 11:60677424-60677446 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1083361924 11:62115085-62115107 AATCCCCTTGTGTCGAGCAAGGG - Intergenic
1083361930 11:62115114-62115136 AATCCCCCTGTATTGAGGGAGGG - Intergenic
1083497716 11:63072848-63072870 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1083519290 11:63292795-63292817 AATCCCCATGTGTTATGAGAGGG - Intronic
1084277763 11:68063668-68063690 AATCCCCATGTGTGGAGGGAGGG + Intronic
1084390850 11:68875771-68875793 AATCCCCACGTGTTGTGGAAGGG + Intergenic
1084452029 11:69244767-69244789 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1084658645 11:70534396-70534418 AATCCCCATGTGTTGTGGGAGGG - Intronic
1084880529 11:72168260-72168282 AACTCCCATGTGTTGTGAAAGGG + Intergenic
1085497906 11:76988618-76988640 AATCCCTATGTGTTGGGGAAGGG - Intronic
1085866625 11:80302632-80302654 AATTCCCGTGTGTTGTGGGAGGG + Intergenic
1085959249 11:81440301-81440323 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1086127106 11:83360293-83360315 AATCCCCATGTGTTGTGGAAGGG + Intergenic
1086231563 11:84576951-84576973 AATTCCCGTGTGTTGTGGGAGGG + Intronic
1086309590 11:85521168-85521190 AATCCCCATGTGTTGGGTGAGGG + Intronic
1086348282 11:85920246-85920268 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1086412950 11:86560169-86560191 AGTCCCCATGTGTTGAGGGAGGG + Intronic
1086593303 11:88541853-88541875 AATCCCCATGTGTGGAGGAAGGG + Intronic
1086613243 11:88782505-88782527 AATTCCCATGTGTTGTGGAAGGG - Intronic
1086782722 11:90928394-90928416 AATCCTCATGTGTTGAGGAAGGG - Intergenic
1086925076 11:92631403-92631425 AATCCCCAGGTGTTGAGGGAGGG + Intronic
1086989525 11:93287848-93287870 AATCCCCATTTGTTGAGGGAGGG - Intergenic
1087231048 11:95664464-95664486 AATTCCAGTGTGGTCAGAAAAGG + Intergenic
1087325038 11:96711226-96711248 AGTCCTCATGTGTTGAGGAAGGG + Intergenic
1087393506 11:97569055-97569077 AATCCCCATGTGTTGAGGGCGGG - Intergenic
1087393765 11:97570910-97570932 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1087400339 11:97658040-97658062 AATCCACATGTGTTGAGGGAGGG - Intergenic
1087437965 11:98146062-98146084 AATCCCCATGTGTTGAGGGAAGG - Intergenic
1087472067 11:98588104-98588126 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1087480519 11:98694045-98694067 AATCCCCATGTGTTGAGGTAGGG + Intergenic
1087694713 11:101363638-101363660 AATCCCCATGTGTTGGGAGAGGG + Intergenic
1087773761 11:102239162-102239184 AATCCCTATGTGTTGAGGGAGGG - Intergenic
1087812822 11:102626553-102626575 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1087831602 11:102825434-102825456 AATCCACATGTGTTGTGAGAGGG - Intergenic
1088072646 11:105809517-105809539 AATCCCCACGTGTTGAGGGAGGG + Intronic
1088162919 11:106895430-106895452 AATCCCCATGTGTCAAGGAAGGG + Intronic
1088273715 11:108062023-108062045 AATTCCCACGTGTTGAGACAGGG - Intronic
1088326087 11:108602916-108602938 AATCCCCATGTGTTGAGGGCAGG + Intergenic
1088412799 11:109553880-109553902 AATCCCCATGTGTTGAAGGAGGG - Intergenic
1088539263 11:110896146-110896168 CATCCCCATGTGTTGAGGAAGGG - Intergenic
1088611089 11:111577884-111577906 AATCCTCTTGTGTTGAGGGAAGG + Intergenic
1088844577 11:113654141-113654163 AATCCCCATGTGTTGAGGGAAGG - Intergenic
1088968282 11:114747728-114747750 AATTCCCATGTGTTGAGGGAAGG - Intergenic
1089096790 11:115926277-115926299 AATCCCCAAGTGTTGAGGGAGGG + Intergenic
1089379555 11:118017956-118017978 AATCCCCATGTGTTGTGGGAAGG - Intergenic
1090144296 11:124303308-124303330 AATCCCCGTGTGTCAAGAGAGGG - Intergenic
1090556998 11:127886655-127886677 AATTCCCGTGTGTTGTGGGAGGG - Intergenic
1090704978 11:129328020-129328042 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
1091155801 11:133371459-133371481 AATCCCCACGTGTTGAGGGAGGG + Intronic
1091470313 12:720745-720767 AATCCCCACGTGTGGAGGAAGGG - Intergenic
1091860235 12:3774765-3774787 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1092139477 12:6172966-6172988 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1092653145 12:10656025-10656047 AATTCCCATGTGTTGTGGAAGGG + Intronic
1092722135 12:11451790-11451812 AATCCCCATGTGTTGAAAGAGGG + Intronic
1092919725 12:13220536-13220558 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1093101024 12:15029579-15029601 AATTCCCTTGTCTTGATAAATGG - Intergenic
1093159822 12:15733413-15733435 AATCCCCATGTGTTGAGGGAGGG - Intronic
1093193713 12:16105400-16105422 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1093264303 12:16983487-16983509 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1093351159 12:18104436-18104458 AATCCCCACATGTTGAGAAAGGG - Intronic
1093474538 12:19539984-19540006 GGTCCCATTGTGTTGAGAAAGGG + Intronic
1093478881 12:19584250-19584272 AATCCCCATGTGTTGGGGGAGGG + Intronic
1093675239 12:21931133-21931155 AATCCCCATGTGTTGGGGGAGGG + Intronic
1093874870 12:24338646-24338668 AATCCCCATGTGTTGTGTGAGGG + Intergenic
1094169772 12:27479612-27479634 AATTCCCGTGTGTTGTGAGAGGG + Intronic
1094236856 12:28177896-28177918 AATCCCCACGTGTTGAGGGAGGG + Intronic
1094237297 12:28183580-28183602 TATCCCCATGTGTTGAGGAAGGG + Intronic
1094237304 12:28183609-28183631 GATCCCCATGTGTTGAGGGAAGG + Intronic
1094724171 12:33095496-33095518 AATCCCTATGTGTTGAGGAAGGG - Intergenic
1094729361 12:33157050-33157072 AATCCCCATGTGATGAGGGAGGG + Intergenic
1094733686 12:33207940-33207962 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1094738430 12:33260829-33260851 AATCCCCATGTGTTGGGGGAGGG + Intergenic
1095141795 12:38672995-38673017 AATTCCCATGTGTTGAGGGAGGG + Intronic
1095145654 12:38722805-38722827 AATCCCCCTGTGTCGAGGGAGGG + Intronic
1095175231 12:39084476-39084498 AATTCCCGTGTGTTGAGGGAGGG - Intergenic
1095214127 12:39528108-39528130 AATTCCCATGTGTTGTGAGAGGG - Intergenic
1095386218 12:41653664-41653686 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1095395286 12:41756186-41756208 AATCCCCATGTGTTGAGAGAGGG - Intergenic
1095395546 12:41758127-41758149 AATCCCCATGTGTTGAAGGAGGG - Intergenic
1095528837 12:43160714-43160736 AATCCCCATGTGTTGGGGGAGGG + Intergenic
1095685052 12:45024075-45024097 AATCCCCATGTGCTGAGGGAGGG + Intronic
1095789666 12:46150927-46150949 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1095839158 12:46673113-46673135 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1096212851 12:49779671-49779693 AATCCCCATGTGTTGTGGGAAGG + Intergenic
1096924043 12:55122320-55122342 AATCCTTGTGTGTTGAGGGAGGG - Intergenic
1097135188 12:56847158-56847180 AATCCCCACGTGTTGAGGAAGGG - Intergenic
1097227847 12:57489194-57489216 TTTCCCTGTGTGATGAGAAATGG + Intronic
1097501419 12:60409181-60409203 AATCCCCATGGGTTGAGGGAGGG - Intergenic
1097503646 12:60437924-60437946 AATCCCCATGTATTGGGGAAGGG + Intergenic
1097932548 12:65205220-65205242 AATCCCCATGTGTTGAGGGAGGG - Intronic
1097999724 12:65927073-65927095 AACTCCCGTGTGTTGAAAGAAGG - Intronic
1098715334 12:73822555-73822577 AATCCCCATGTGCTGAGGGAGGG - Intergenic
1098772742 12:74575232-74575254 AACCCCCATGTGTTGAGGGAGGG + Intergenic
1098782550 12:74705264-74705286 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1098994082 12:77097942-77097964 AATCCCCACGTGTTGTGAGAGGG - Intergenic
1099037868 12:77612811-77612833 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1099068284 12:78012021-78012043 AATCCCCATGTGTAGAGGGAGGG - Intronic
1099075088 12:78096714-78096736 AATCCCCATGTGTTGTGGGAGGG - Intronic
1099124248 12:78732609-78732631 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1099204242 12:79710630-79710652 AATCCCCATGTGTTGAGGGAAGG + Intergenic
1099218168 12:79878820-79878842 AATCCCCATGTGTTGTGGGAGGG - Intronic
1099242674 12:80156530-80156552 AATTCCCATGTGTTGTGGAAGGG + Intergenic
1099254937 12:80303823-80303845 AATCCCCATATGTTGAGGGAAGG - Intronic
1099295364 12:80822629-80822651 AATGCCCATGTGTTGTGGAAGGG - Intronic
1099386290 12:82017670-82017692 AATCCCCAGGTATTGAGAGAGGG + Intergenic
1099397506 12:82159066-82159088 AATCCCCCTGTGTGGAGGGAGGG + Intergenic
1099564187 12:84219536-84219558 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1099767491 12:87006735-87006757 AATCCCCATGTGTTGTGTAAGGG + Intergenic
1099779936 12:87181998-87182020 AATTCCCATGTGTTGTGAGAGGG + Intergenic
1099865105 12:88270118-88270140 AATTCTCATGTGTTGAGAGAGGG + Intergenic
1100070599 12:90711545-90711567 AATCCCCATGTGTCGAGGGAGGG - Intergenic
1100079049 12:90825268-90825290 AATCCCAGTGTGTCCAGAATTGG - Intergenic
1100123532 12:91396001-91396023 AATCCCCACGTGTCGAGGAAAGG + Intergenic
1100230543 12:92602122-92602144 AATCCCCATGTGTCAAGAGAGGG - Intergenic
1100383320 12:94082814-94082836 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1100534996 12:95499978-95500000 AATCCCCATGTGCTGAGAGAGGG - Intronic
1100636750 12:96441927-96441949 AATCCCCACGTGTTGAGAGAGGG + Intergenic
1100810169 12:98329951-98329973 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1100895919 12:99182271-99182293 AATCCCCATGTGTTGGGGGAGGG - Intronic
1101500348 12:105298496-105298518 AATTCCCATGTGTTGTGAGAGGG + Intronic
1101526269 12:105534243-105534265 AATCTCCATGTGTTGAGGGAGGG - Intergenic
1101535531 12:105612999-105613021 AATCCCCATGTATTGAGGGAGGG + Intergenic
1101692891 12:107097653-107097675 AATCCCCATGTGTTGTGGGAAGG + Intergenic
1101699372 12:107157615-107157637 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1102014560 12:109639186-109639208 AATCCCCATGTGTTGGGGGAGGG + Intergenic
1102164925 12:110798528-110798550 AATCCCCACGTGTTGAGTGAGGG - Intergenic
1102668737 12:114599365-114599387 AATCTCCATGTGTTGAGGGAGGG + Intergenic
1102669067 12:114601710-114601732 AATCCCCATGTGTTAAGGGAGGG + Intergenic
1102834415 12:116041138-116041160 AATCCTCATGTGTTGAGGGAGGG + Intronic
1102884659 12:116512474-116512496 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1102884889 12:116513984-116514006 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1103016490 12:117498659-117498681 AATCCCCATGTGTTGTGGGAGGG + Intronic
1103069509 12:117929262-117929284 AATTCCCTTGTGTTGTGGAAGGG + Intronic
1103156013 12:118685454-118685476 AATCCCCATGTGTTGTGAGACGG - Intergenic
1103485226 12:121278500-121278522 AATTCCCGTGTGTTGTGGGAGGG + Intronic
1103838562 12:123844265-123844287 AATCCCCAGGTGTTGAGGGAAGG - Intronic
1104080000 12:125421532-125421554 AATTCCCATGTGTTGTGAGAGGG - Intronic
1104128473 12:125869983-125870005 AATCCCCATGTGTTGAAGGAGGG + Intergenic
1104279071 12:127357173-127357195 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1104296865 12:127523711-127523733 AATCCCCACGTGTGGAGAGAGGG + Intergenic
1104386042 12:128352422-128352444 AATCCCCATGTGTTGTGGGAAGG - Intronic
1104431651 12:128721168-128721190 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1104452913 12:128885952-128885974 AATTCCCGTGTGTTGTGGGAAGG + Intronic
1104534192 12:129603036-129603058 AATCCCCATGTGTTGTGCGAGGG - Intronic
1105037946 12:132940101-132940123 AATCCCAGTGTGTCCAGAATGGG - Intronic
1105530099 13:21211379-21211401 AATTCCCGTGTGTTGTGGGAGGG + Intergenic
1105706169 13:22968784-22968806 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1106194666 13:27483091-27483113 AATCCCCATGTGTGGAGGTAGGG + Intergenic
1106311831 13:28561416-28561438 AATTCCCATGTGTTATGAAAGGG + Intergenic
1106395669 13:29378891-29378913 AATCCCCATGTGTTGGGGGAGGG + Intronic
1106633649 13:31504290-31504312 AATCTCCATGTGTTGAGGGAGGG + Intergenic
1106784146 13:33090424-33090446 AATCCCCATGTGTTGGGGGAGGG - Intergenic
1107436811 13:40387738-40387760 TATCCCCATGTGTTGAGGAAGGG - Intergenic
1107450150 13:40500932-40500954 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1107513795 13:41109737-41109759 AATCCCCATGTATTGAGGGAGGG + Intergenic
1107554638 13:41507241-41507263 AATTCCCATGTGTTGTGAGAGGG - Intergenic
1107988260 13:45794504-45794526 AATCCCCATGTGTTGTGGGAGGG + Intronic
1108459218 13:50648420-50648442 AATTCCCATGTGTTGGGAGAGGG + Intronic
1108463232 13:50688855-50688877 AAAGCCCCTGTGGTGAGAAAAGG + Intronic
1108603837 13:52017461-52017483 AATTCCCATGTGTTGTGGAAGGG + Intronic
1108707176 13:53000191-53000213 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1108726258 13:53184714-53184736 AATCCCCATGTGTTGGAAGAGGG - Intergenic
1108745545 13:53389692-53389714 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1108851818 13:54739387-54739409 AATCCCCATGTGTTGGGGGAAGG + Intergenic
1109085701 13:57968762-57968784 AATTCCCATGTGTTGTGAGAGGG - Intergenic
1109092405 13:58064978-58065000 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1109189685 13:59309311-59309333 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1109195282 13:59371826-59371848 AATCTCCATGTGTTGAGGGAGGG + Intergenic
1109326441 13:60872988-60873010 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1109488241 13:63057065-63057087 TATCCCCATGTGTTGAGGGAAGG + Intergenic
1109504370 13:63280229-63280251 AATTCCCATGTGTTGAGGGAGGG - Intergenic
1109616332 13:64837956-64837978 AATCTCCATGTGTTGAGGAAGGG + Intergenic
1109717235 13:66233153-66233175 AATTCCCACGTGTTGAGAAAGGG + Intergenic
1109861589 13:68206312-68206334 AATCCCCATGTGTTGTGGTAGGG + Intergenic
1109883618 13:68512950-68512972 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1109913850 13:68953920-68953942 AATCCCCGGGTGATAAGAGAGGG + Intergenic
1110159176 13:72354656-72354678 AATCCCCATGTGTTGAAAGCGGG - Intergenic
1110208505 13:72946354-72946376 AATCCCCATGTGTTGTGGGAGGG - Intronic
1110241313 13:73270260-73270282 AATCTCCATGTGTTGAGGGAGGG - Intergenic
1110383176 13:74877740-74877762 AATTCCCATGTGTTGTGAGAGGG + Intergenic
1110474772 13:75901138-75901160 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1110566103 13:76959143-76959165 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1110566377 13:76961123-76961145 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1110909166 13:80933654-80933676 AATCCCAATGTGTTGAGGGAGGG - Intergenic
1110955626 13:81549374-81549396 AATACCCATGTGTTGAGGGAGGG - Intergenic
1110991932 13:82052821-82052843 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1110991938 13:82052850-82052872 AATCCCTGTGTGTGGAGAGAGGG + Intergenic
1111029260 13:82574584-82574606 AATTCCCATGTGTTGAGGGAGGG - Intergenic
1111042061 13:82760880-82760902 AATCCCCATGGGTTGAGGGAGGG + Intergenic
1111175824 13:84595414-84595436 AATCCCCATGTGTCGAGGACAGG + Intergenic
1111185831 13:84734873-84734895 AATCCCCATATGTTGAGGGAGGG + Intergenic
1111219695 13:85188331-85188353 AATCCCCATGTGTTGTGGGATGG + Intergenic
1111222415 13:85221362-85221384 AATCCCCATGTGTCGAGGGAAGG + Intergenic
1111501011 13:89119932-89119954 AATTCCCATGTGTTGTGGAAAGG - Intergenic
1111591220 13:90349763-90349785 AATGCCCGTGTGTCCAGAATTGG - Intergenic
1111602187 13:90488741-90488763 AATCCCCATGTGTTGATGGAGGG + Intergenic
1111608277 13:90569012-90569034 AATCACCACGTGTTGAGAGAGGG + Intergenic
1111802225 13:92995175-92995197 AATTCCCATGTGTTGTGACAGGG + Intergenic
1111803016 13:93003595-93003617 AATCCCCAAGTGTTGAGGAAAGG - Intergenic
1111918267 13:94384004-94384026 AATCCCTATGTGTTGAGAACAGG - Intronic
1112130245 13:96515619-96515641 AATCCCCACGTGTCGAGAGAGGG + Intronic
1112175065 13:97014279-97014301 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1112268941 13:97950743-97950765 AATTCCCGTGTGTTGTGAAAGGG + Intergenic
1112521980 13:100104375-100104397 AATCCCCATGTGTTGAGGGAGGG + Intronic
1112637263 13:101228419-101228441 AATTCCCATGTGTTGTGGAAGGG + Intronic
1112651229 13:101400808-101400830 AATCCCCACGTGTGGAGAGAGGG + Intronic
1112840179 13:103565586-103565608 AATCCCCATATATTGTGAAAGGG - Intergenic
1112884920 13:104158509-104158531 AATACCCATGTGTTGGGGAAGGG - Intergenic
1113003899 13:105677180-105677202 AATCCCCATGTGTCGGGAAAGGG + Intergenic
1113187914 13:107710700-107710722 AATCCCCACGTGTTGAGGGAGGG - Intronic
1113190996 13:107745744-107745766 AATCCCCGCATGTTGTGGAAGGG + Intronic
1113327422 13:109295382-109295404 AATTCCCTTGTGTTGTGACAGGG - Intergenic
1113496826 13:110737586-110737608 AATCCCCATGTGTTTGGGAAGGG + Intergenic
1113726858 13:112610460-112610482 AATCCCCGGGTGTTGAGGAAGGG - Intergenic
1113809989 13:113134578-113134600 AATCCCCATGTGTAGTGAGAGGG - Intronic
1114432967 14:22678372-22678394 AATCCCCATGTGTTGAGGGTGGG + Intergenic
1114766209 14:25373432-25373454 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1114872029 14:26670155-26670177 AATCCCCGTGTTTTGGGGGAGGG - Intergenic
1114985856 14:28227886-28227908 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1115116013 14:29881179-29881201 AATTCCCATGTGTTGTGGAAGGG + Intronic
1115117496 14:29899844-29899866 AATCCCCATGTGTTGGGAGAGGG + Intronic
1115249667 14:31331914-31331936 AATCCCCAGGTGTTGAGGGAGGG - Intronic
1115263414 14:31476120-31476142 AATCCCCATGTGTTGAGGAAGGG - Intergenic
1115276464 14:31615050-31615072 AATCCTCATGTGTTGAGGAATGG + Intronic
1115505165 14:34086762-34086784 AATCACCGTGTGTTGAAGGAGGG - Intronic
1115525633 14:34278149-34278171 AATCCCCATGTGTCGAGGGAGGG + Intronic
1115527974 14:34300401-34300423 AATTCCCGTGTGTTGTGGGAGGG - Intronic
1115571616 14:34672001-34672023 AATCTCCATGTGTTGAGGGAGGG - Intergenic
1115807036 14:37063165-37063187 AATCCCCACGTGTTGTGAGAGGG - Intronic
1115811535 14:37114147-37114169 AATCAACGTGTGATGACAAATGG + Intronic
1115859815 14:37671768-37671790 AATCCCTATGTGGTGAGGAAGGG + Intronic
1115892785 14:38050762-38050784 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1115953162 14:38744525-38744547 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
1116080369 14:40163301-40163323 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1116100334 14:40425577-40425599 AATCCCCACGTGTTGTGGAAGGG - Intergenic
1116132092 14:40867215-40867237 AATCCCCAAGTATTGGGAAAGGG - Intergenic
1116303412 14:43216818-43216840 AATCCCCATGTGTTATGAGAAGG - Intergenic
1116364197 14:44039741-44039763 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1116399419 14:44487550-44487572 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1116470525 14:45281131-45281153 AATCCCCATGTGTGGAGGGAGGG + Intergenic
1116470532 14:45281160-45281182 AATCCCCATATGTTGAGGGAAGG + Intergenic
1116485370 14:45442820-45442842 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1116534003 14:46007845-46007867 AATCCCCATGTGTTGGGGAAGGG + Intergenic
1116622506 14:47224014-47224036 AATCCCCGTGTGTGGTAGAAGGG - Intronic
1116755414 14:48942047-48942069 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1116854361 14:49938593-49938615 AATTCCCATGTGTTGGGGAAGGG + Intergenic
1117141942 14:52797910-52797932 AACCCCCATGTGTTGAGGGAGGG - Intergenic
1117163133 14:53008481-53008503 AATCCCCAGGTGTTGAGGGAAGG + Intergenic
1117217361 14:53565234-53565256 AATCCCCATGTGTTGAAGGAGGG - Intergenic
1117272011 14:54154259-54154281 AATCCCCAGATGTCGAGAAAGGG - Intergenic
1118048844 14:62004391-62004413 AATCCCCATGTGTGGAGGGAGGG - Intronic
1118402695 14:65394364-65394386 AATTCCCATGTGTTGTGAGAGGG - Intergenic
1118634765 14:67737548-67737570 AATCCCCATGTGTTGAGGGAGGG - Intronic
1118799117 14:69172979-69173001 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1118956928 14:70491028-70491050 AATCCCCATGTGTTGAGGAAAGG - Intergenic
1119148223 14:72334970-72334992 AATTCCCTTGTGTCGTGAAAGGG + Intronic
1119165636 14:72490114-72490136 AATTCCCATGTGTTGTGAGAGGG + Intronic
1119174080 14:72556416-72556438 AATCCCCATGTGTTGAGAGCGGG - Intronic
1119586381 14:75839683-75839705 AATCCCCATGTGTTGTGAGAGGG - Intronic
1119862760 14:77948463-77948485 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1120082856 14:80235668-80235690 AATTCCCATGTGTTGTGGAAGGG + Intronic
1120155040 14:81084071-81084093 AATCTCCATGTGTTGGGAGAGGG - Intronic
1120208756 14:81613571-81613593 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
1120269790 14:82296668-82296690 AATCCCCATGTGTGGAGGGAGGG - Intergenic
1120281122 14:82439190-82439212 AATCCCCCTGTGTCTAGAGAGGG + Intergenic
1120307333 14:82787305-82787327 AATCCCCATATCTTGAGAGAGGG - Intergenic
1120374140 14:83678648-83678670 AATCCCCATGTGTCAGGAAAGGG - Intergenic
1120404945 14:84083384-84083406 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1120422897 14:84310974-84310996 AATCCTCATGTGTCGAGAGAGGG - Intergenic
1120430518 14:84408291-84408313 AATCCCCATGTGTCGAGGGAAGG - Intergenic
1120512406 14:85431177-85431199 AATCCCCAGGTGTTGAGAGAGGG - Intergenic
1120582748 14:86273150-86273172 AATCTCCGTGTGTTGGGGGAGGG - Intergenic
1120582979 14:86277395-86277417 AATTCCCATGTGTTAAGGAAGGG - Intergenic
1120615927 14:86704974-86704996 AATTCCCATGTGTTGTGAGAGGG + Intergenic
1120665344 14:87300040-87300062 AATCCCCATTTGTTGTGAGAGGG + Intergenic
1120769218 14:88360443-88360465 AATCCCCACGTGTTGGGGAAGGG + Intergenic
1121043319 14:90768510-90768532 AATACCCATGTGTTGAGGGAGGG - Intronic
1121210015 14:92201310-92201332 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1121470149 14:94146581-94146603 AATCCCCCTGTGTTGAGGGAAGG + Intronic
1121514120 14:94537805-94537827 AATCCCCATGTGCTGGGGAAGGG - Intergenic
1121659776 14:95626037-95626059 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1121715534 14:96071325-96071347 AATCCCCATGTGTTGTGGGAGGG - Intronic
1121723028 14:96124958-96124980 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1122436052 14:101700471-101700493 AATGCTGGAGTGTTGAGAAAGGG + Intergenic
1122442286 14:101740371-101740393 AATCTCCATGTGTTGAGGGAGGG - Intergenic
1122845993 14:104499434-104499456 AATCCCCATGTGTTGAGGGAGGG - Intronic
1122877253 14:104673942-104673964 AATCCCCATGTGTGGAGGGAGGG + Intergenic
1123158549 14:106254302-106254324 AATTCCCATGTGTTGTGAGAGGG - Intergenic
1123189352 14:106553360-106553382 AATTCCCATGTGTTGTGAGACGG - Intergenic
1202897304 14_GL000194v1_random:17587-17609 AATCCCCATGGGTTGAAGAAGGG + Intergenic
1123440359 15:20286567-20286589 AATCTCCAGGTGTTGAGAAGGGG - Intergenic
1123815875 15:23978239-23978261 AATCCCCCTGTGTTGGGGGAGGG - Intergenic
1123892577 15:24796092-24796114 AATCCCCATGTGTTGTGGAAGGG + Intergenic
1124158328 15:27247894-27247916 AATTCCCATGTGTTGTGAAAGGG - Intronic
1124418757 15:29498002-29498024 AATCCCCATGTGTTGAGGGAGGG + Intronic
1124572728 15:30880657-30880679 AATCCTCATGTGTTGAGAGATGG - Intergenic
1124705321 15:31959150-31959172 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1125162591 15:36663435-36663457 AATCCCCACGTGTTGTGGAAGGG + Intronic
1125302480 15:38270670-38270692 AATCCCCATGTGTTGAAAGAGGG - Intronic
1126238768 15:46417103-46417125 AATCCGCGTGTGTTGAGGGAGGG + Intergenic
1126399691 15:48256732-48256754 AATCCCCATGTGTTGTGGGAGGG - Intronic
1126502552 15:49362175-49362197 AATCCCCATGTGTTGGGGGAGGG + Intronic
1126843141 15:52736417-52736439 AATCCCCAAGTGTTGAGAGAGGG + Intergenic
1127754617 15:62079352-62079374 AATCTCAATGTCTTGAGAAAGGG - Intergenic
1128154784 15:65385504-65385526 CATCCCCGTGTGGGGAGAAGAGG - Intronic
1128284988 15:66429400-66429422 AATCCCCATGTGTTGAGAGAGGG - Intronic
1128989309 15:72245434-72245456 AATTCCCATGTGTTGTGGAAGGG - Intronic
1129058049 15:72836126-72836148 AATCCCCATATGTTGAGGGAGGG - Intergenic
1129508138 15:76100055-76100077 AATCCCCATGTGTTGAGGGAGGG - Intronic
1129911884 15:79234673-79234695 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1129970787 15:79776102-79776124 AATCCCCATGTGTTGAATGAAGG - Intergenic
1130098917 15:80877167-80877189 AATTCCCATGTGTTGTGAGAGGG - Intronic
1130338509 15:82978627-82978649 AAACCCCGTGTGTTGTGGGAGGG + Intronic
1130550279 15:84886279-84886301 AATCCCCATCTAGTGAGAAAGGG + Intronic
1131410541 15:92203891-92203913 AATTCCCACGTGTTGTGAAAGGG + Intergenic
1131464209 15:92642473-92642495 AATCCCCATGTGTTGTGAGAGGG + Intronic
1131718433 15:95139728-95139750 AATCCCCATGGGTTGAGGAAGGG - Intergenic
1131852515 15:96557830-96557852 AATTCCCCTGTGTTGAGGGAGGG + Intergenic
1131857777 15:96617071-96617093 AATCTCCATGTGGTGAGGAAAGG - Intergenic
1132288285 15:100681702-100681724 AATTTCCCTGTGTTGGGAAATGG - Intergenic
1133103313 16:3492157-3492179 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1133186132 16:4100027-4100049 AATCCCCATGTGTCGAGGGAGGG + Intronic
1133337064 16:5013153-5013175 AATCCCCAAGTGTTGAGGGAGGG - Intronic
1133648708 16:7788916-7788938 AATTCCCATGTGTTGTGCAAGGG + Intergenic
1133851230 16:9505719-9505741 AATCCCCATGTGTTGAAGGAAGG - Intergenic
1133921536 16:10157722-10157744 AATCCCCAAGTGTTGAAGAAGGG - Intronic
1134303048 16:13008465-13008487 AATCCCCACGTGTTGAGGGAGGG + Intronic
1134336319 16:13302780-13302802 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1134590280 16:15447442-15447464 AATCCCCATGTGTGGAGGGAGGG - Intronic
1134606138 16:15572783-15572805 AATCCCCGTGTGTTGTGGGAGGG + Intronic
1135168945 16:20165990-20166012 AATTCCCAGGTGTTGAGGAAGGG - Intergenic
1135168953 16:20166019-20166041 AATCCCCATGTGTCAAGGAAGGG - Intergenic
1135729250 16:24880750-24880772 AATCCCCGCGTGTTGGGGGAGGG - Intronic
1135808209 16:25563775-25563797 AATTCCCATGTGTTGAGGGAGGG + Intergenic
1135828782 16:25754771-25754793 AATCCCCATGTGTTGTGGGAGGG - Intronic
1135847849 16:25934946-25934968 AATCCCCGCATGTTGAGGGACGG + Intronic
1135957046 16:26964501-26964523 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1135979561 16:27136836-27136858 AATCCTCATGTGTTGAGGGAGGG - Intergenic
1136844809 16:33567869-33567891 AATCCCCAGGTGTTGAGAAAGGG + Intergenic
1137228154 16:46535247-46535269 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1137812745 16:51368309-51368331 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1138034902 16:53594264-53594286 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1138071517 16:53997327-53997349 AATCCCCATGTGTTGTGGGAGGG - Intronic
1138154283 16:54688079-54688101 AATTCCCATGTGTTGTGAAAGGG + Intergenic
1138683103 16:58701121-58701143 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1138697616 16:58830129-58830151 AATCCCCAAGTGTTGAGGGAAGG + Intergenic
1138771101 16:59664995-59665017 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1138776912 16:59734435-59734457 AATCCCCATGTGTGGAGGGAGGG + Intronic
1138799995 16:60015921-60015943 AATCCCCATGTGTAGATGAAGGG - Intergenic
1138800257 16:60017889-60017911 AATCCCCATGTGTTGAAGGAGGG - Intergenic
1139058761 16:63222363-63222385 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
1139083786 16:63560405-63560427 AATCCCCATGTGTTGGGGTATGG - Intergenic
1139283828 16:65792912-65792934 AATCCCCATGTGTCAAGGAAGGG - Intergenic
1140131525 16:72166183-72166205 AATCCCCATGTGTTGAGGGAGGG + Intronic
1140132371 16:72174835-72174857 AATCCCCATGTGTTGTGATAGGG - Intronic
1140511865 16:75514462-75514484 AATTCCCATGTGTTGTGCAAGGG + Intergenic
1140552750 16:75885114-75885136 AATTCCCATGTGTTGTGAGAGGG - Intergenic
1140730283 16:77850156-77850178 AATCCCCGTGTGTAGGGTACAGG + Intronic
1141492769 16:84385842-84385864 AATCCCCGCATGTTGGGGAAGGG - Intronic
1141739260 16:85879809-85879831 AATCCCCGTATGTCAAGAAAGGG - Intergenic
1141978847 16:87536872-87536894 AATCCCCAAGTGTTGAGGGAGGG + Intergenic
1203154977 16_KI270728v1_random:1868167-1868189 AATCCCCAGGTGTTGAGAAAGGG + Intergenic
1142885386 17:2909385-2909407 GATGGCCGTGTGTTGAGGAATGG + Intronic
1144016119 17:11198217-11198239 AATCCTCATGTGTTTGGAAAGGG + Intergenic
1144079153 17:11746609-11746631 AATCCCCATGTGTCGAGGGAGGG - Intronic
1144285676 17:13771499-13771521 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1144351765 17:14403465-14403487 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1144432095 17:15202153-15202175 AATCTCTGTGTTTTGTGAAAAGG - Intergenic
1144605055 17:16657723-16657745 AATCCCCATGTGTCGAGGGAGGG - Intergenic
1145188424 17:20816979-20817001 AATCCCCAGGTGTTGAGGGAAGG + Intergenic
1145354565 17:22130124-22130146 TATCCCCATGTGTTGAGGGAGGG - Intergenic
1145753786 17:27374857-27374879 AATTCCCGTGTGTTGTGGGAGGG + Intergenic
1145988679 17:29065009-29065031 AATCCCCTTGTGTTGTGGGAGGG - Intergenic
1146452569 17:32986470-32986492 AATCCCCATGTGTTGAAGTAGGG + Intronic
1147483595 17:40790629-40790651 AATCCCCATGTGTTGAGACAGGG + Intergenic
1148390399 17:47268165-47268187 AATCCCCATGTGTTGTGGGAGGG - Intronic
1149071631 17:52550532-52550554 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1149131448 17:53306408-53306430 AATTCCCATGTGTTGAGGGAGGG - Intergenic
1149369586 17:55979579-55979601 AATCCCCATGTGTGGAGGAAGGG - Intergenic
1149530604 17:57391974-57391996 AATCACCGTGTGGTGAGCACTGG + Intronic
1150011500 17:61508757-61508779 AATCTCCATGTGTTGAGGGAGGG - Intergenic
1150078484 17:62214680-62214702 AATCCCCAGGTGTTGAGGGAAGG - Intergenic
1150243472 17:63655314-63655336 AATCCCCATGTGTTGTGGCAGGG - Intronic
1150603106 17:66667572-66667594 AATCCCCATGTGTTGTGGGAGGG - Intronic
1150649314 17:66999683-66999705 AATCCCCATGTGTTGAAGGAGGG - Intronic
1150892439 17:69168685-69168707 AATTCCCATGTGTTGTGGAAGGG + Intronic
1150941710 17:69700179-69700201 AATTCCCGTGTGTTGTGGGAAGG + Intergenic
1151029626 17:70721609-70721631 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1151124132 17:71826767-71826789 AATTCCCACGTGTTGAGAGAGGG - Intergenic
1151137453 17:71960764-71960786 GATCCCCATGTGTTGTGAGAGGG - Intergenic
1151148808 17:72065958-72065980 AATTCCCATGTGTTGTGAGAGGG - Intergenic
1151245530 17:72791666-72791688 AATCCCCATGTGTTGGGGGAGGG + Intronic
1151290231 17:73144535-73144557 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1151410069 17:73919099-73919121 AATTCCCTTGTGTTGTGACAGGG + Intergenic
1151895543 17:76978111-76978133 AATTCCCATGTGTTGTGGAAGGG + Intergenic
1151935574 17:77258778-77258800 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1152268428 17:79309670-79309692 AATCCCCATGTGTTGAGGGAGGG + Intronic
1153455152 18:5272400-5272422 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1153757033 18:8294534-8294556 AATCCCCATGTGTTGTGGGAGGG - Intronic
1154092973 18:11381943-11381965 AATCCCCACGTGTGGAGGAAGGG - Intergenic
1154305501 18:13227847-13227869 AATCCCCATGTGTTGGGGGAGGG - Intronic
1154500779 18:14996848-14996870 AATCCCCATATGTTGAGGAAAGG + Intergenic
1155357676 18:24969176-24969198 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1155504229 18:26517243-26517265 AATCCCCATGTGTTGTGGGAGGG + Intronic
1155599657 18:27531000-27531022 AATTCCCATGTGTTGTGGAAGGG + Intergenic
1155752369 18:29441453-29441475 AATCTCCATGTGTTGAGGGAGGG - Intergenic
1155821326 18:30381247-30381269 AATCCCCATGTGTTGTGGGAAGG - Intergenic
1155856625 18:30842879-30842901 AATCCCCATGTGTCGAGAAAGGG + Intergenic
1156042257 18:32835772-32835794 AATCCCCATGTGTAGAGTGAGGG - Intergenic
1156078543 18:33308666-33308688 AATCCCCATGTGCTGTGAGAGGG + Intronic
1156156457 18:34308345-34308367 GATCCCCAGGTGTTGAGAGAGGG + Intergenic
1156240737 18:35251554-35251576 AATCCCCAGGTGTTGAGGGAGGG + Exonic
1156254455 18:35381786-35381808 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1156258156 18:35419029-35419051 AATCCCCATGTGTTGAGAGAGGG + Intergenic
1156340104 18:36202943-36202965 AATCCCCAGGTGTTGAGGGATGG - Intronic
1156607404 18:38681789-38681811 AATCCCCATGTGTTGTGGATGGG - Intergenic
1156958996 18:43000588-43000610 AATCCCCACGTGTTGAGAAAGGG + Intronic
1157078340 18:44493373-44493395 AATCCCCATGTGTCAAGAACGGG + Intergenic
1157341728 18:46784733-46784755 AATCCCCATGTGTTGAGTGAGGG - Intergenic
1157873174 18:51248687-51248709 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
1158037903 18:53056340-53056362 AATCCCCGTGTGTTGAGAAAGGG - Intronic
1158173238 18:54622745-54622767 AATTCCCATGTGTTGTGTAAGGG - Intergenic
1158182928 18:54738336-54738358 AATCCCCATGTATTGAGGGAGGG + Intronic
1158198375 18:54912961-54912983 AATCCCCATGTGTTGTGGGAGGG - Intronic
1158337843 18:56433164-56433186 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1158449082 18:57547365-57547387 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1158686605 18:59620568-59620590 AATTCCCATGTGTTGTGAAAGGG + Intronic
1158747518 18:60218451-60218473 AATCCCCATGTGTAGAGGGAGGG + Intergenic
1158918648 18:62164623-62164645 AATCCCCATGTGTTGAGGGAGGG - Intronic
1158945981 18:62447332-62447354 AATCCCCATGTATTGAGGGAGGG + Intergenic
1159152169 18:64534721-64534743 AATCCCCATGTGTTGTGGGAAGG + Intergenic
1159237402 18:65694321-65694343 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1159377168 18:67607036-67607058 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1159622214 18:70651463-70651485 AACCCCCATGTGTTGAGGAAGGG - Intergenic
1159635982 18:70805743-70805765 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1159652692 18:70996496-70996518 AATCCCCATGTGTTGTGAGAGGG + Intergenic
1159674158 18:71260951-71260973 AATCCCCATATGTTGAGGGAGGG + Intergenic
1159674996 18:71272438-71272460 AATCCACACGTGTTGAGAGAGGG + Intergenic
1159687758 18:71444634-71444656 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1159720624 18:71885634-71885656 AATCTCCATGTGTGGAGAGAGGG - Intergenic
1160372404 18:78384769-78384791 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1161503642 19:4632139-4632161 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1162296107 19:9814847-9814869 AATTCCCATGTGTTGTGAGAGGG - Intronic
1162604090 19:11693967-11693989 AATCCCCATATGTTGAGGGAGGG + Intergenic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1163068034 19:14813830-14813852 AATCCCCATGTGTCAAGGAAGGG - Intronic
1163770204 19:19186431-19186453 AATCCCCATGTGTTGTGAGAGGG + Intronic
1164086282 19:21905552-21905574 AATCCCCATGTGTCAAGGAAGGG - Intergenic
1164223791 19:23223588-23223610 AATTCTCTTATGTTGAGAAAGGG + Exonic
1165123993 19:33581196-33581218 AATCCCAGTGCTTTGAGAAGCGG + Intergenic
1165401886 19:35606271-35606293 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1165533886 19:36426810-36426832 AATCCCCATGTGTTGAAGGAGGG + Intergenic
1165650366 19:37482681-37482703 AATCCCCATGTGTTGAGGGAGGG + Intronic
1167761274 19:51451231-51451253 AATCCCCATGTGTTGGGGGAGGG - Exonic
1168634823 19:57988145-57988167 AAGCCCTCTTTGTTGAGAAATGG - Intronic
925151888 2:1620510-1620532 AATTCCCATGTGTTGAGGGAGGG + Intergenic
925292039 2:2754615-2754637 AATCCCCATGTGTTGTGGGAGGG + Intergenic
925454027 2:3998827-3998849 AATCCCCATGTGTTGAGGGTGGG + Intergenic
925511706 2:4634283-4634305 AATCCCCGTGTGTCAAGGGAGGG - Intergenic
925571845 2:5320954-5320976 AATTCCCATGTGTTGCGGAAGGG + Intergenic
925716510 2:6788866-6788888 AATCCCCATGTGTTGAGGAAGGG + Intergenic
925764249 2:7215420-7215442 AATGCACCTGTGTTGAAAAATGG + Intergenic
925981793 2:9183051-9183073 AATTCCCATGTGTTGTGGAAGGG + Intergenic
926240967 2:11084730-11084752 AATCCCCGCATGTTGAGGAAGGG - Intergenic
926430921 2:12785132-12785154 AATTCCCATGTGTTGTGAGAGGG - Intergenic
926456352 2:13072842-13072864 AATCCCCATGTGTTGTGGGATGG - Intergenic
926471632 2:13267146-13267168 AATCCCCCTGTATTGGGGAAGGG + Intergenic
926478559 2:13358772-13358794 AATCCCTATGTGTTGAGGGAGGG - Intergenic
926504784 2:13700022-13700044 AATCCCCATGTGTCGAGGGAGGG + Intergenic
926694546 2:15762142-15762164 AATCCCCATGTGTTGTGTGAGGG + Intergenic
926734760 2:16064582-16064604 AATCCCCATGTGTTGTGGGAGGG - Intergenic
926821706 2:16858789-16858811 AATCCCCGTATGTTGAGGGAGGG + Intergenic
926876603 2:17487202-17487224 AATCCCCATGTATTGAGGGAGGG - Intergenic
926905540 2:17801937-17801959 AATTCCCCTGTCTTGATAAATGG + Intergenic
926949391 2:18225657-18225679 TATCCCCATGTGTTGAGGGAGGG + Intronic
927095403 2:19744521-19744543 AACCTCCTTGTGTTGAGAATTGG - Intergenic
927294238 2:21435413-21435435 AATCCCCATGTGTTGTGGCAGGG + Intergenic
927548552 2:23976668-23976690 AATTCCCGTGTGTTGTGGGAGGG - Intronic
928035398 2:27817924-27817946 AATCCCCAGGTGTTGAGGGAGGG - Intronic
928453544 2:31399627-31399649 AATTCCCATGTGTTGCGAGAGGG + Intronic
928699547 2:33884676-33884698 AATCCCCAGGTGTTGAGGGAGGG + Intergenic
928848913 2:35718028-35718050 AATCCCCATGTGTGGAGGGAGGG + Intergenic
928899420 2:36301369-36301391 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
929208553 2:39326707-39326729 AATCCCCATGTGTTGAGGGAGGG + Intronic
929279744 2:40064982-40065004 AAACCCCTTGTGTTGGGAAATGG + Intergenic
929391115 2:41470332-41470354 AATTCCCATGTGTTGAGAAAGGG + Intergenic
929759110 2:44791391-44791413 AATTCCCATGTGTTGTGGAAGGG - Intergenic
930179552 2:48339285-48339307 AATCCCCAAGTGTTGAGAAGGGG + Intronic
930263039 2:49169550-49169572 AATTCCCATGTGTTGTGGAAGGG + Intergenic
930319192 2:49832573-49832595 AATCCCCCAGTGTTGAGGAAGGG - Intergenic
930324555 2:49899115-49899137 AATCCCTGTGTGTCGAGTGAGGG - Intergenic
930483916 2:51988103-51988125 AATCCCCATGTGTTGAGGGAGGG - Intergenic
930662267 2:54066142-54066164 AATCCCCATGTGTTGAGGGAGGG + Intronic
930694207 2:54394703-54394725 AATCCCCATGTGTGGAGGGAGGG - Intergenic
930755074 2:54965442-54965464 AATTCCCCTGTCTTGAGAAATGG - Intronic
930982331 2:57542379-57542401 ACTCCCCATGTGTTGAGGTAGGG - Intergenic
931025508 2:58109706-58109728 AATTCCCATGTGTTGAGGGAAGG - Intronic
931038231 2:58267020-58267042 AATCCCCATGTGTTGAAGGAGGG + Intergenic
931110000 2:59099866-59099888 AATCCCCACGTGTTAACAAAGGG - Intergenic
931153257 2:59598554-59598576 AATCCCCATGTGTTGAGGGAGGG - Intergenic
931154876 2:59616417-59616439 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
931920498 2:67009908-67009930 AATCCCCATGTGTTGAGGGAGGG - Intergenic
931965570 2:67529750-67529772 AATCCCCATGTGTTGTGGGAGGG - Intergenic
932104642 2:68931624-68931646 AAACCCCATGTGTTGAGGGAGGG - Intergenic
932440229 2:71730175-71730197 AATCCCCATGTGTTGTGAGAGGG - Intergenic
932452410 2:71820895-71820917 AATCCCCATGTGTTGTGGGAGGG - Intergenic
932727763 2:74194211-74194233 AATTCCTGTGTCTTGATAAATGG - Intergenic
932838905 2:75063166-75063188 AATTCCCACGTGTTGTGAAAAGG - Intronic
933055267 2:77655408-77655430 AATCCCCATGTGTTGTGGAAGGG + Intergenic
933060987 2:77735981-77736003 AATCACCAGGTGTTGAGCAAGGG - Intergenic
933236559 2:79870849-79870871 AATCCCCATGTGTCGAGGAAGGG - Intronic
933445849 2:82378535-82378557 AATCCCCATGTGTTGGGGGAGGG + Intergenic
933458173 2:82543669-82543691 AACCCCCATGTGTGGAGGAAAGG + Intergenic
933513979 2:83277748-83277770 AATCCCCAAGTGTTGTGAGAGGG + Intergenic
934118108 2:88814613-88814635 AATCCCCACGTGTTGAGGGAGGG + Intergenic
934319406 2:91958749-91958771 AATCCCCAAGTGTTGAGAAAGGG - Intergenic
935325053 2:101928287-101928309 AATTCCCATGTGTCGAGAAAGGG + Intergenic
935409111 2:102740266-102740288 AATCCCCATGTGTTGTGGGAGGG + Intronic
935568203 2:104631762-104631784 AATCCCCGTGTGTCAAGGGAGGG - Intergenic
935691420 2:105735682-105735704 AATTCCCGTGTGTTGGGGGAGGG - Intergenic
935724176 2:106008514-106008536 AATTCCCATGTGTTGTGAGAGGG + Intergenic
935853286 2:107246511-107246533 ACTCACTGTGTGGTGAGAAAGGG - Intergenic
936109120 2:109650602-109650624 AATCCCCGTGTGTTGTGGGAGGG + Intergenic
936119613 2:109730079-109730101 AATCCCCATGTGTTGAGGGAGGG - Intergenic
936340499 2:111627580-111627602 AATCCCCATGTATTGAGGGAGGG - Intergenic
936448446 2:112615458-112615480 AATTCCCCTGTCTTGAAAAATGG + Intergenic
936543781 2:113373179-113373201 AATTCCCGCGTGTTGTGGAAGGG - Intergenic
936678012 2:114738190-114738212 AATCCCCATGTGTTGAAAGAGGG - Intronic
936930798 2:117786855-117786877 AATCCCCATGTGTTGGGGGAAGG - Intergenic
937343417 2:121106399-121106421 AATCCCCATGTGTCGAGGGAGGG - Intergenic
937688594 2:124726268-124726290 AATCCCCGTGTGTCAAGAGAAGG + Intronic
937795879 2:126019478-126019500 AATTCCCCTGTCTTGATAAATGG + Intergenic
938061018 2:128254292-128254314 AATCCCCATGTGTTGTGGAAGGG - Intronic
938491010 2:131761210-131761232 AATCCCCATGGGTTGAAGAAGGG - Intronic
938499980 2:131827177-131827199 AATCCCCATATGTTGAGGAAAGG + Intergenic
938974465 2:136462358-136462380 AATCCCCATGTGTTGGAGAAGGG - Intergenic
938982530 2:136540150-136540172 AATCCCCATGTGTTGGAAGAGGG + Intergenic
939346889 2:140977138-140977160 AATTCCCACGTGTTGTGAAAGGG + Intronic
939668014 2:144974408-144974430 AATCCCCATGTGTCGAGGGAGGG - Intergenic
939781703 2:146458111-146458133 AATCCCCATGTGTGGAGGGAGGG - Intergenic
939826515 2:147022540-147022562 AATCCTCGTGTGTTGAGGGAGGG - Intergenic
939884099 2:147662435-147662457 AATCCTCAGGTGTTGAGAGAGGG - Intergenic
939985486 2:148825891-148825913 AATTCCCATGTGTTGTGAGAGGG + Intergenic
940016209 2:149108034-149108056 AATTCCCATGTGTTGTGAGAGGG + Intronic
940381483 2:153019336-153019358 TATCCCCATGTGTTGTGGAAGGG - Intergenic
940391296 2:153135572-153135594 AATCCTGATTTGTTGAGAAATGG + Intergenic
940598679 2:155828833-155828855 AATCCCCACGTGTTGAGGGAGGG - Intergenic
940598774 2:155829634-155829656 AATCCCCATGTGTAGAGGGAGGG - Intergenic
940598782 2:155829663-155829685 AATCCCCACGTCTTGAGAGAGGG - Intergenic
940755656 2:157679088-157679110 AATCCCCATGTGTTGAGGAAGGG + Intergenic
940785956 2:157981156-157981178 AATTCCCATGTGTTGTGAGAGGG + Intronic
941143539 2:161815215-161815237 AATCCCCATGTGTTGAGGGAGGG + Intronic
941477379 2:165966654-165966676 AATTCCCCTGTGTTGTGAGAGGG + Intergenic
941509090 2:166383854-166383876 AATCCCCACCTGTTGAGAGAGGG + Intergenic
941579776 2:167280425-167280447 AATCCCCGTGTGTCATGAGAGGG - Intergenic
941742015 2:169045041-169045063 AATTCCCACGTGTTGAGGAAGGG + Intergenic
941933953 2:170968864-170968886 AATCCCCACGTGTGGAGGAAGGG - Intergenic
941992111 2:171567646-171567668 AATCCCCATATGTTGAGGGAGGG - Intergenic
942991544 2:182208475-182208497 AATCCCCATGTTTTGAGGGAGGG - Intronic
943004630 2:182375074-182375096 AATTCCCATGTGTTGAGTCAGGG - Intronic
943033075 2:182708672-182708694 AGTCCCCATGTGTTGAGGGAGGG - Intergenic
943072348 2:183155078-183155100 AATTCCCATGTGTTGTGAGAGGG - Intronic
943118707 2:183707760-183707782 AATTCCCATGTGTTGTGAGAGGG + Intergenic
943124878 2:183783530-183783552 AATCCCCATGTATTGAGGGATGG + Intergenic
943143816 2:184017178-184017200 AATCCCCATGTGTCGAGGGAGGG + Intergenic
943144072 2:184019156-184019178 AATCCCCGTGTGTTGAGGGAGGG + Intergenic
943185838 2:184606451-184606473 AATCCCCAGGTGTTGAGGGAGGG - Intronic
943193847 2:184718284-184718306 AATTCCCATGTGTTGTGAGAGGG - Intronic
943216544 2:185044458-185044480 AATCCCCTTGGGTTGCGGAAGGG - Intergenic
943277681 2:185889061-185889083 AATCCCCATGTGTGGAGGGAGGG - Intergenic
943307894 2:186289650-186289672 AATCCCCATGTGTTGAGGGAGGG + Intergenic
943315952 2:186387238-186387260 AATCCCCATGTGTTGAGGGAGGG - Intergenic
943387675 2:187222884-187222906 AATCCCCATGTGTTGAGAGAGGG - Intergenic
943387693 2:187223125-187223147 AATCCCCACGTGTTGAGGAAGGG + Intergenic
943448383 2:188018534-188018556 AATCCCCATGTGTTGTGAGAGGG + Intergenic
943543440 2:189245096-189245118 AATTCCCATGTGTTGTGGAAAGG - Intergenic
943592480 2:189815373-189815395 AATCTCCATGTGTTGAGGGAGGG + Intronic
943592484 2:189815402-189815424 AATCCCTATGTGTTTAGAGAAGG + Intronic
943778577 2:191795256-191795278 AATCCCCGTGTGTCGCGGGAGGG - Intergenic
943804760 2:192110806-192110828 AATTCCCATGTGTTGTGGAAGGG + Intronic
943823042 2:192351871-192351893 AATCCCCATGTGTGGAGGGAGGG - Intergenic
943880819 2:193141633-193141655 AATCCCTGTGTGTTGAGGGAAGG + Intergenic
943976047 2:194479041-194479063 AATCCCCGTATGTGGTGGAAGGG - Intergenic
944369043 2:198960492-198960514 AATCCCCATGTGTGGAGGGAGGG + Intergenic
944384462 2:199149244-199149266 AATCTCCATGTGTTGTGGAAGGG + Intergenic
944458063 2:199916304-199916326 AATCCCCATGTGTTGTGAGAGGG - Intronic
944880351 2:204006984-204007006 AATCCCCACGTGTTGTGAGAGGG - Intergenic
944943239 2:204652994-204653016 AATCCCCATGTGTCGGGAGAGGG - Intronic
945140402 2:206680336-206680358 AATCCCCATGTGTTGTGGGAGGG - Intronic
945774381 2:214086434-214086456 AATCCCCATGTGTTGGGGGAGGG + Intronic
945836703 2:214842584-214842606 AATCCCCATGTGTTGGGGAAGGG + Intergenic
945885812 2:215374398-215374420 AATCCCCATGTATTGAGGAGAGG + Intronic
945895184 2:215473302-215473324 AATCCCCACGTGTTGTGGAAGGG + Intergenic
945941072 2:215950844-215950866 AATCCCCATGTGTTGAAGGAGGG + Intronic
945975639 2:216268364-216268386 AATCCCCGTGTATCAAGAAAGGG + Intronic
946120458 2:217508345-217508367 AATCCCCTTGTGTTGTGGGAGGG - Intronic
946123904 2:217542673-217542695 AATCCCAATGTGTTGAGGGAGGG - Intronic
946173108 2:217907001-217907023 CATCCCTGTGTGTTTGGAAATGG - Intronic
946436572 2:219660276-219660298 AATCCCCATGTGTCAAGAGAGGG - Intergenic
946510519 2:220350658-220350680 AATCCCCATGTGTCGAGGGAGGG + Intergenic
946510527 2:220350687-220350709 AATCCCCATGGGTCGAGAAAGGG + Intergenic
946606504 2:221411055-221411077 AATCCCCATGTGTTGAGGGAGGG - Intergenic
946732389 2:222721915-222721937 AATTCCCATGTGTTGTGAGAAGG - Intergenic
946788307 2:223272393-223272415 AATTCCCAGGTGTCGAGAAAGGG - Intergenic
947003452 2:225485091-225485113 AATCCCCATGTGTTGAGGGTGGG + Intronic
947086691 2:226460848-226460870 AATTCCCATGTGTTGAGGGAGGG - Intergenic
947091244 2:226513412-226513434 AATCCCCATGTGTTGAAGGAGGG - Intergenic
947148262 2:227088299-227088321 AATCCCCATGTGTTGAGGGAGGG + Intronic
947166351 2:227266054-227266076 AATCCCCATGTGTCATGAAAGGG - Intronic
947251124 2:228105617-228105639 AATTCCCATGTGTTGTGAGAGGG + Intronic
947261144 2:228223840-228223862 TATCCCCATGTGTTGAGAGAGGG + Intergenic
947902957 2:233738028-233738050 AATCCCCACGTGTTGAGGACAGG + Intronic
947981947 2:234418160-234418182 AATCCCCATGTGTTGTGGGAGGG + Intergenic
948120573 2:235527141-235527163 AATCCCCTGGAGATGAGAAACGG + Intronic
948251042 2:236529269-236529291 AATCCCCCAGTGTTGAGGGAGGG - Intergenic
948383624 2:237568070-237568092 CATCCCCGTGTGATTTGAAAGGG - Intergenic
948480872 2:238249677-238249699 AATACCCATGTGTTGAGGGAAGG + Intronic
948661545 2:239509628-239509650 AATCCCCACGTGTCGGGAAAGGG - Intergenic
948724693 2:239927058-239927080 AATCCCCATGTGTTGTGGGAGGG - Intronic
949039036 2:241837359-241837381 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1169052569 20:2593286-2593308 AATCCCCAGGTGTTGAGGGAGGG - Intronic
1169320972 20:4632952-4632974 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1169973650 20:11299149-11299171 AATTCCCATGTGTTGAGGGAGGG - Intergenic
1170129491 20:13003190-13003212 AGTCCCCATGTGTCGAGAGAGGG - Intergenic
1170138768 20:13104281-13104303 AATTCCCATGTGTTGTGAGAGGG + Intronic
1170475130 20:16706883-16706905 AATTCCCGTGTGTTGTGGAAGGG + Intergenic
1170495479 20:16919977-16919999 AATCCCCATGTGTTGAGGGAAGG + Intergenic
1170496328 20:16928930-16928952 AATCCCCATGTGTCAAGGAAGGG + Intergenic
1170963096 20:21042943-21042965 AATCCCTATGTGTTGAGGGAGGG + Intergenic
1170971481 20:21121072-21121094 AATACCCCTGTGTCGAGGAAAGG - Intergenic
1171325098 20:24284208-24284230 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1172078323 20:32316980-32317002 AATCCCAGTGTTTTGGGAAGCGG + Intronic
1172168625 20:32914758-32914780 AATCCCCATATGTTGAGGGAGGG - Intronic
1173177381 20:40774539-40774561 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1173348356 20:42221925-42221947 AATCCCCATGTGTCGAGGGAGGG - Intronic
1173356387 20:42295760-42295782 AATCCCCATGTGTTGGGGGAGGG + Intronic
1173767404 20:45625302-45625324 AATCCCCATGTGTGGAGTGAGGG - Intronic
1174099856 20:48119103-48119125 ACTCCTCTTGTGTTGAGGAAAGG - Intergenic
1174685728 20:52453095-52453117 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1174703134 20:52629558-52629580 AATCCCCGTGTGTAGTGGGAGGG + Intergenic
1174863200 20:54111771-54111793 AATCCCCATGTGTTGATGGAGGG - Intergenic
1174918091 20:54674282-54674304 AATCCCCATGTGTCGAGGAAAGG + Intergenic
1174974413 20:55315518-55315540 AATCCCCATATGTCAAGAAAAGG - Intergenic
1175027983 20:55923222-55923244 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1176616989 21:9033576-9033598 AATCCCCATGGGTTGAAGAAGGG + Intergenic
1176692170 21:9927796-9927818 AATCCCCATGTGTTGGGGGAGGG - Intergenic
1176921222 21:14689636-14689658 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1176968209 21:15235710-15235732 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1176977629 21:15340625-15340647 AATCCCCATGTGTCGAGGGAAGG + Intergenic
1177026209 21:15924840-15924862 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1177059285 21:16351504-16351526 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1177317043 21:19476422-19476444 AATCCCCATGTGTTGTGAGCAGG - Intergenic
1177401858 21:20614797-20614819 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1177434859 21:21038435-21038457 AACCCCCATGTGTTGTGGAAGGG + Intronic
1177498518 21:21919541-21919563 AATCCCCGTGTGTGGAGGAAGGG + Intergenic
1177688004 21:24465368-24465390 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1177766752 21:25467031-25467053 AATCCCCATGGGTTGTGAGAGGG + Intergenic
1177767456 21:25474552-25474574 AATCCCCATGTGTTGAGGCAGGG + Intergenic
1177822437 21:26046120-26046142 AATTCCCATGTGTTGTGGAAGGG - Intronic
1177864661 21:26498930-26498952 AATCCCCATGTGTTGTGGGAGGG - Intronic
1177883788 21:26724312-26724334 AATCCCCATGTGTTGAAGGAGGG + Intergenic
1177906396 21:26976591-26976613 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1177957567 21:27618804-27618826 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1177959392 21:27643762-27643784 AATCCCCATGTGTGGAGGGAGGG + Intergenic
1177977702 21:27871923-27871945 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1178028606 21:28497103-28497125 AATCCCCATGTGTTGTGGCAGGG - Intergenic
1178062958 21:28872401-28872423 ACTGCACATGTGTTGAGAAATGG + Exonic
1178148094 21:29763105-29763127 AATCTCCATGTGTTGAGGGAGGG + Intronic
1178198912 21:30380123-30380145 AATCCCCACATGTTGAGGAAGGG + Intronic
1178321801 21:31611485-31611507 AATCCCCATGTGTTGGGGGAAGG + Intergenic
1178348542 21:31852681-31852703 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1178400817 21:32283295-32283317 AATCTCCATGTGTTGAGGGAGGG - Intergenic
1178503134 21:33142086-33142108 AATTCCCGTGTGTTGTGGGAGGG + Intergenic
1178775541 21:35546969-35546991 AATCCCCATGTGTTGTAAGAGGG + Intronic
1178798600 21:35768980-35769002 AATCCCCATGTGTTGTGGGAGGG - Intronic
1178960365 21:37059415-37059437 AATCCCCACGTGTTGAGGGAGGG - Intronic
1179160346 21:38891037-38891059 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1179338357 21:40479694-40479716 AATCCCCTCGTGTTGTGAGAGGG - Intronic
1179384613 21:40930301-40930323 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1179496414 21:41774551-41774573 CATCCACCTGTGTTGAGAGAGGG - Intergenic
1179620222 21:42609598-42609620 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1180163520 21:46008562-46008584 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1180307592 22:11142394-11142416 AATCCCCAGGTGTTGAGAAAGGG - Intergenic
1180546112 22:16504617-16504639 AATCCCCAGGTGTTGAGAAAGGG - Intergenic
1181183571 22:21084930-21084952 AATCCCCATGTGTTGAGAGCGGG - Intergenic
1181392050 22:22590428-22590450 AATCCCCATATGTTGAGGGACGG - Intergenic
1181392056 22:22590457-22590479 AATCCCCATGTGTTGAAGGAGGG - Intergenic
1181749386 22:24978167-24978189 AATTCCCATGTGTTGTGAGAGGG + Intronic
1181905011 22:26187354-26187376 AATCCCCACGTGTTGGGAGAGGG - Intronic
1182213067 22:28692772-28692794 AATCCCCAGGTGTTGAGAAAGGG + Intronic
1182272342 22:29163092-29163114 AATCCCCACGTGTTGAGGGAGGG + Intronic
1183847518 22:40554360-40554382 AATCCCCATGTGTTGTGGGAGGG + Intronic
1184903046 22:47459362-47459384 AATCCCCATGTGTTGTGGGAGGG + Intergenic
949109107 3:237132-237154 AATCCCCATGTGTTGGGGGAAGG + Intronic
949292578 3:2483570-2483592 AATTCCCATGTGTTGTGGAAGGG + Intronic
949359022 3:3212293-3212315 AATTCCCGTGTGTTGTGGAAGGG - Intergenic
949997555 3:9630417-9630439 AATTTCCCTGTGTTGATAAATGG - Intergenic
950800877 3:15551046-15551068 AATCCCCATGTGTTTTGGAAGGG + Intergenic
950852153 3:16072271-16072293 AATCCCCATGTGTCGAGGGAGGG - Intergenic
951153803 3:19324489-19324511 AATCCCCACATGTTGAGGAAGGG - Intronic
951180512 3:19653856-19653878 AATCCCCATGTGTCGAGGGAGGG - Intergenic
951268943 3:20602320-20602342 AATCCCCATGTGTTGAAGGAGGG + Intergenic
951455028 3:22882095-22882117 AATCCCCAGATGTTGAGGAAGGG + Intergenic
951598790 3:24348715-24348737 AATCCCAGTGTGTTGTAAATTGG - Intronic
951755735 3:26088835-26088857 AATCCCCATGTGTCAAGGAAGGG - Intergenic
951997662 3:28749108-28749130 AATCCCCAAGTGTTGTGAGAAGG + Intergenic
952086278 3:29825436-29825458 AATCCCCATGTGTTGTGGGAGGG + Intronic
952104893 3:30057889-30057911 AATCCCTGTGTGTCGAGGAAGGG + Intergenic
952333872 3:32388452-32388474 AATCCCTCGGTGTAGAGAAAAGG + Intergenic
952458494 3:33499062-33499084 AATCCCCATGTGTTGGGGGAGGG + Intronic
952805974 3:37352455-37352477 AATCCCCATGTGTTGTGGGAAGG - Intronic
953073539 3:39547159-39547181 AATCCCCATGTGTTGAGGGAGGG + Intergenic
953606885 3:44418177-44418199 AATCCCCATGTGTTGTGGGAGGG + Intergenic
953684140 3:45062965-45062987 AATCCACATGTTGTGAGAAAGGG - Intergenic
954471915 3:50705280-50705302 AATCCCCACGTGTTGAGGGAGGG + Intronic
954471923 3:50705309-50705331 AATCCCCATGTGTTGAGGGAGGG + Intronic
954820911 3:53326865-53326887 AATCCCCGTCCATTGAAAAATGG + Intronic
955139655 3:56256678-56256700 AATCCCCATGTGTTGAGGGAAGG + Intronic
955254528 3:57316647-57316669 AATCCCTGCGTGTTGAGGGAGGG + Intronic
955441224 3:58956962-58956984 AATCCCCTTGTGTTGTGGGAGGG - Intronic
955459831 3:59169916-59169938 AATCCCCATGTGTTGAGGTAGGG + Intergenic
955833114 3:63025888-63025910 AATCCCCATGTGTAAAGAGAGGG - Intergenic
955970771 3:64436182-64436204 AATTCCCATGTGTTGTGGAAGGG + Intronic
956051702 3:65255264-65255286 AATCCCCATGTGTTGTGGGAGGG + Intergenic
956051712 3:65255300-65255322 AATCCCCATGTGTTGTGGGAGGG + Intergenic
956693060 3:71895405-71895427 AATCCCCATGTGTTGTGGGAGGG + Intergenic
956901167 3:73717447-73717469 AATCCCCATGTGTTGTGGGAGGG - Intergenic
956916045 3:73872109-73872131 AATCCCCAAGTGTTGAGGGAAGG + Intergenic
956919240 3:73908955-73908977 AATCCCCATGTGTTGGGGGAGGG + Intergenic
956984918 3:74687532-74687554 AATCCCCATGTGTTGAGGGAGGG - Intergenic
957030687 3:75236754-75236776 AATCCCCATGTGTTGAGGGAGGG + Intergenic
957257977 3:77863312-77863334 AATCCCCACGTGTCGAGAGAGGG + Intergenic
957294459 3:78319366-78319388 AATCCCCATGTGTAGGGAAAGGG + Intergenic
957476999 3:80738662-80738684 AATCCCCGTGTGTGGTGGGAGGG - Intergenic
957487934 3:80887036-80887058 AATCCCCATGTGTTGTGGGAAGG - Intergenic
957529422 3:81422042-81422064 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
957557348 3:81779706-81779728 AATCCCCATGTGTTGTGGGAGGG - Intergenic
957561408 3:81826498-81826520 AATCCCCATGTGTTGAGGAAGGG + Intergenic
957606454 3:82405839-82405861 AATCCCCATGTGTTGTGGGATGG - Intergenic
957741803 3:84280035-84280057 AATCCCCATGTGTTGTGTGAGGG - Intergenic
957777242 3:84769209-84769231 AATCCCCATGTGTTGTGGGAGGG + Intergenic
957871064 3:86091116-86091138 AATCCCCATGTGTTGAGGGAGGG + Intergenic
958005911 3:87811839-87811861 AATGCCCATGTGTGGAGAGAGGG + Intergenic
958537009 3:95417142-95417164 AATGCCACAGTGTTGAGAAATGG + Intergenic
958543552 3:95510798-95510820 AATTCCCGTGTGTTGTGGGAGGG + Intergenic
958562272 3:95761554-95761576 AATCCCCATGTGTTGTGGAAGGG + Intergenic
958566698 3:95821357-95821379 AATCCCCATGTGTTGGGGGAGGG - Intergenic
958583330 3:96053660-96053682 AATTCCCATGTGTTGTGAGAAGG - Intergenic
958583771 3:96060463-96060485 AATCCCCAGGTGTTGAGGAAGGG + Intergenic
958610520 3:96418260-96418282 AATCCCAGCGTGTTGAGGCAAGG - Intergenic
958649960 3:96926309-96926331 AATCCCCATGTGTCGAGGAAGGG - Intronic
958837051 3:99158047-99158069 AATTTCCATGTGTTGTGAAAGGG + Intergenic
958955645 3:100463442-100463464 AATCCCCACGTGTTGAGGGAGGG - Intergenic
959364881 3:105444477-105444499 AATCCCCATGTGTAGAGGGAGGG - Intronic
959416052 3:106076992-106077014 AATCCCCATGTGTCGAGGGAGGG - Intergenic
959435490 3:106310095-106310117 AATCCCCATGTGTAGAGGGAGGG - Intergenic
959515484 3:107261751-107261773 AATCCCCATGTGTTGGGGGAGGG - Intergenic
959606424 3:108245865-108245887 AATCCCCATGTGTTGTGGGAGGG + Intergenic
959695552 3:109245770-109245792 AATTCCCATGTGTTGTGAGAGGG - Intergenic
959738134 3:109684902-109684924 AATCCCCATGTGTTGAGGGAGGG + Intergenic
960009605 3:112819190-112819212 AATCCCCACGTGTTGAGGGAGGG - Intronic
960473328 3:118094095-118094117 AATCCCCATGTGTTGCGGGAGGG + Intergenic
960498799 3:118410065-118410087 AACCCCCATGTGTTGAGGGAGGG + Intergenic
960670840 3:120154317-120154339 AATCCCCATGTGTTGAGGTAGGG - Intergenic
960671121 3:120156225-120156247 AATCCCCATGTGTTGAGAGAGGG - Intergenic
962062023 3:131938754-131938776 AATCCTCATGTGTTGAGGGAGGG - Intronic
962067125 3:131992736-131992758 AATCCCCATGTGTTGTCAGAGGG + Intronic
962500273 3:135984500-135984522 AATCCCCAAGTGTTGAGGGAGGG + Intronic
962535126 3:136321654-136321676 AATCCCCATGTGTTGAGGGAGGG - Intronic
962643161 3:137409373-137409395 AATACCCATGTGTTGAGGGAGGG + Intergenic
962774117 3:138642672-138642694 AATCCCCACGTGTTGAGGGAGGG + Intergenic
963339643 3:144019371-144019393 AATTCCCATGTGTTGAGGGAGGG - Intronic
963404557 3:144845330-144845352 AATCCCCGCCTGTTGGGGAAGGG - Intergenic
963452722 3:145505173-145505195 AATACCCACGTGTTGAGAGAAGG - Intergenic
963478242 3:145833974-145833996 AATCCCCACGTGTTGAGGGAGGG - Intergenic
963522921 3:146378739-146378761 AATCCCCATGTGTTGAAGGAGGG + Intergenic
963524129 3:146394775-146394797 AATCCCTATGTGTTGAGGCAGGG + Intronic
963592867 3:147285749-147285771 AATTCCCATGTGTTGTGAGAGGG - Intergenic
963777921 3:149458386-149458408 AATCCCCATGTGTGGAGGAAGGG - Intergenic
963996461 3:151716134-151716156 AATCCCCATGTGTTCAGGGAGGG - Intergenic
964091230 3:152878724-152878746 AATCCCCATGTGTTGAAGGAGGG + Intergenic
964249216 3:154691150-154691172 AATCCCCATGTGTGGGGGAAGGG + Intergenic
964299205 3:155269632-155269654 AATCCCCGTGTGTCAAGGGAGGG + Intergenic
964427647 3:156569943-156569965 AATCCCCTTGTCTTGAGAGAGGG + Intergenic
964536832 3:157731081-157731103 AATCCCCATGTGTCAAGAAAGGG - Intergenic
964536838 3:157731110-157731132 AATCCCCATGTTTTGAGGGAAGG - Intergenic
964587194 3:158319162-158319184 AATCCCCGTGTGTCAAGGGAGGG + Intronic
964836288 3:160941423-160941445 AATTCCCATGTGTTGTGAGAGGG + Intronic
964853500 3:161119908-161119930 AATCCCCATGTGTTGAGGGAGGG + Intronic
964970465 3:162553690-162553712 AATCCTCATGTGTTGAGGGAGGG - Intergenic
964978273 3:162646521-162646543 AATCCCCACGTGTTGTGGAAGGG + Intergenic
965024982 3:163290965-163290987 AATCCCCGTGTGTCATGAGAGGG - Intergenic
965169764 3:165247701-165247723 AATCCCCATGAGTTGAGGGAGGG - Intergenic
965189057 3:165505663-165505685 AATCCCCACATGTTGAGGAAGGG - Intergenic
965197395 3:165618959-165618981 AATCCCCATGTGTTGAGGGAGGG - Intergenic
965260772 3:166482338-166482360 AATCCCCACGTGTTGTGAGAAGG + Intergenic
965349238 3:167593791-167593813 AATCCCCATGTGCTGAGGGAAGG + Intronic
965349798 3:167598423-167598445 AATCCCCATGTGTCGAGGTAGGG + Intronic
965387097 3:168057616-168057638 AATCCCCATGTGTCGAGGGAGGG - Intronic
965404749 3:168255124-168255146 CATCCCCATGTGTTGAGGGATGG - Intergenic
965405005 3:168257109-168257131 AATCCACATGTGTCGAGAGAGGG - Intergenic
965458661 3:168933481-168933503 AATTCCCATGTGTTGTGGAAGGG - Intergenic
965637433 3:170797865-170797887 AATCCCCACGTGTTGAGGGAGGG - Intronic
965869632 3:173250194-173250216 AATTCCCATGTGTTGAGGGAGGG - Intergenic
965902856 3:173665154-173665176 AATCCCCATGTGTTGGGGAAGGG + Intronic
965978242 3:174652641-174652663 AATCCCCATGTGTTGTGGGAGGG - Intronic
966088268 3:176098199-176098221 AATCCCCATGTGTTGAGGGAGGG - Intergenic
966091798 3:176146973-176146995 AATCCCCATGTGTCGTGGAAAGG - Intergenic
966217561 3:177519067-177519089 AATCCCCATGTGTCAGGAAAGGG - Intergenic
966311140 3:178595484-178595506 AATCCCCATGTGTTGTGGGAGGG + Intronic
966343103 3:178947342-178947364 AATTCCCATGTGTTGTGAGAGGG + Intergenic
966463808 3:180206240-180206262 AATCCCCATGTGTTGTGGAAGGG + Intergenic
966824508 3:183952516-183952538 AATTCCCAGGTGTTGAGGAAGGG + Intronic
966968727 3:185022029-185022051 AATCTCCATGTGTCGGGAAAGGG + Intronic
967003424 3:185359331-185359353 AATCCCCATGTGTTGTGGGAGGG - Intronic
967509315 3:190291546-190291568 AATCCCTGTGTGTTGAGGGAGGG - Intergenic
967519740 3:190415906-190415928 ATTCCCCATGTGTTGAGAATGGG - Intergenic
967519991 3:190417843-190417865 AATCCCCATGTGTTGAGGGAGGG - Intergenic
967521128 3:190434275-190434297 AATTCCCGTGTGTTGTGGGAGGG + Intronic
967615577 3:191561201-191561223 AATCCCCATGTGTTAAGGGAGGG - Intergenic
967657481 3:192068939-192068961 AATCCCCATGTGTTGTGGGAGGG + Intergenic
967754457 3:193153226-193153248 AATCCCCACGTGTTGAGGGAGGG + Intergenic
967776880 3:193394532-193394554 AATCCCCATGTGTTAAGAGTGGG - Intergenic
968014837 3:195319935-195319957 AATCCCCACATGTTGAAAAAGGG + Intronic
968244942 3:197135281-197135303 AATCCCCATGTGTTGGGGGAGGG + Intronic
968295261 3:197571453-197571475 AATTCCCATGTGTTGTGGAAGGG + Intronic
969103739 4:4789498-4789520 AATCCCCATGTGTTGAGGGAGGG + Intergenic
969128862 4:4975671-4975693 AATCCCCATGTGTTGAAGGAGGG + Intergenic
969190191 4:5512292-5512314 AATCCCCATGTGTTGTGGGAGGG - Intergenic
969245210 4:5927488-5927510 AAACCCCATGTGTTGAGGGAGGG + Intronic
969508621 4:7604211-7604233 AATCCCCACGTGTTGAGGGAGGG + Intronic
969622907 4:8287674-8287696 AATCCCCATGTGTTGGGGGACGG - Intronic
969986377 4:11215316-11215338 AATCCCCATGTGTAGAGGGAGGG - Intergenic
970047719 4:11875296-11875318 AATCCCCATGTTTTGAGGGAAGG - Intergenic
970072554 4:12177812-12177834 AATCCCCACGTGTTGAGGGAGGG - Intergenic
970119525 4:12737803-12737825 AATGCCCATGTGTTGAGGGAGGG + Intergenic
970155818 4:13140942-13140964 AATCCCCATGTGTTGAGGGAAGG + Intergenic
970155825 4:13140971-13140993 AATCCCCAGGTGTCTAGAAAGGG + Intergenic
970637971 4:18030669-18030691 AATCCCCATGTGTTGAGGGAAGG - Intergenic
970687530 4:18585579-18585601 AATCCCCATGTGTTGAGGAAGGG + Intergenic
970769244 4:19590709-19590731 AATCCCCATGTGTCAAGAGAGGG - Intergenic
970786626 4:19805030-19805052 AATCCCCACGTGTTGAGGAAAGG + Intergenic
970800482 4:19966811-19966833 AATCCCCATGTGTTGTGAGAGGG - Intergenic
970926916 4:21462495-21462517 AATTCCCGTGTGTTGTGGGAGGG - Intronic
970955418 4:21805311-21805333 AATTCCCATGTGTTGAGGGAGGG + Intronic
970991563 4:22218978-22219000 AATCCCCATGTGTTGAGGGAGGG - Intergenic
971039311 4:22733834-22733856 AATCCCCGTGTGTTGAGGGAAGG + Intergenic
971068200 4:23059116-23059138 AATCCCCATGTGTCGTGAGAGGG - Intergenic
971073983 4:23127020-23127042 AATCCCCATGTGTGGTGGAAGGG + Intergenic
971209727 4:24604113-24604135 AATCACCATGTGTCGAGAGAGGG - Intergenic
971263058 4:25074620-25074642 AATCCCCACGTGTTGAGGGAGGG - Intergenic
971674850 4:29612837-29612859 AATCCCCGCTTGTGGAGAGAGGG - Intergenic
971699248 4:29948128-29948150 AATACCCATGTGTGGAGGAAGGG + Intergenic
971795209 4:31217932-31217954 AATCCCCATATGTTGAGGGAGGG - Intergenic
971800578 4:31285315-31285337 AATCCCCATGTGTTGAGGGAAGG + Intergenic
971845891 4:31917173-31917195 AATCCCCATGTGTTGTGGGAGGG + Intergenic
971847982 4:31945345-31945367 AATCCCCATGTGTTGAGGGCTGG + Intergenic
971855091 4:32032571-32032593 AATCCCCATGTGTGGAGGGAGGG - Intergenic
971876400 4:32314468-32314490 AATCCCCATGTGTTGTGGAAGGG + Intergenic
971914570 4:32851283-32851305 AATCCCCATGTGTTGATGAACGG - Intergenic
971998153 4:33993956-33993978 AATCCCTGCGTGTTGAGGGAGGG - Intergenic
972186250 4:36531951-36531973 AATTCCCATGTGTTGTGGAAGGG - Intergenic
972192414 4:36610927-36610949 AATTCCCATGTGTTGTGAGAGGG - Intergenic
972192985 4:36617000-36617022 AATCCCCATATGTTGAGGGAAGG - Intergenic
972220755 4:36951339-36951361 AATTCCCATGTGTTGTGAGAGGG - Intergenic
972270451 4:37505748-37505770 AATTCCCATGTGTTGTGGAAGGG - Intronic
972300444 4:37780591-37780613 AATCCCCCTGTGTTGTGGGATGG - Intergenic
972849729 4:43034398-43034420 AATCCCCATGTGTTGTGGGAGGG + Intergenic
972930016 4:44060886-44060908 AATCCCCATGTGTTGGGGAAGGG - Intergenic
972970272 4:44566435-44566457 AATCCCCATGTGTTGGGATAGGG + Intergenic
972987904 4:44787382-44787404 AATTCCCATGTGTTGTGGAAGGG + Intergenic
973262341 4:48177724-48177746 AATCCCCATGTGTTGAGGGCAGG + Intronic
973736069 4:53872661-53872683 AATCCCCATGTGTCGAGGGAGGG + Intronic
973747145 4:53975019-53975041 AATCCCCATGTGTTGTGGGAGGG + Intronic
973792254 4:54389137-54389159 AATCCCCATGTGTTGTGGGAGGG - Intergenic
974106706 4:57477800-57477822 AATCCCTGTGTGTTGTGGAAGGG - Intergenic
974214663 4:58829208-58829230 AATCCCCATGTGCTGTGGAAGGG - Intergenic
974608355 4:64183155-64183177 AATCCCCATGTGTTGAAGGAGGG - Intergenic
974627918 4:64447374-64447396 AATCCCCACATGTTGAGAGAGGG - Intergenic
974777536 4:66505831-66505853 AATCCCCATGTGTTGAGGGAGGG - Intergenic
974790382 4:66680835-66680857 AATCCCCATGTGTTGGGGGAGGG - Intergenic
974799713 4:66801469-66801491 AATCGCCATGTGTTGAGGGAGGG - Intergenic
974832738 4:67209899-67209921 AATCCCCACATGTTGAGAAAAGG + Intergenic
974843245 4:67322277-67322299 AATCCCCATGTGTTGTGGGAGGG + Intergenic
974896516 4:67946560-67946582 AATCCCACTGTCCTGAGAAAAGG + Exonic
974925322 4:68291577-68291599 AATCCCCATGTGTTGTGGAAGGG - Intergenic
974949097 4:68566424-68566446 AATCCCCATGTGTCGAGGGAGGG + Intronic
975409789 4:74037271-74037293 GCTCCCCCTGTGATGAGAAAAGG + Exonic
975417853 4:74126898-74126920 AATCCCCATGTGTCGAGGAAGGG + Intronic
975438148 4:74377894-74377916 AATCCCCATGTATTGAGAGAGGG - Intronic
975489348 4:74971369-74971391 AATCCCCATGTGTCGTGAGAGGG - Intronic
975632695 4:76418748-76418770 AATTCCCGTGTGTTGCGGGAGGG - Intronic
975662977 4:76705907-76705929 AATCCCCCTGTGTTGTTCAAGGG - Intronic
975968008 4:79999210-79999232 AATCCCCACGTGTTGAGGGAGGG + Intronic
976042867 4:80907739-80907761 AATCCCCACGTGTTGTGAGAGGG - Intronic
976069941 4:81230187-81230209 AATCCCCATGAGTTGAGGGAGGG + Intergenic
976070238 4:81232182-81232204 AATCCCCAGGTGTTGAGGGAGGG + Intergenic
976197788 4:82550092-82550114 AATCCCCATGTGTTGAGGGAGGG + Intronic
976212322 4:82683665-82683687 AATCCCCATGTGTTGAGGGAAGG + Intronic
976365632 4:84229768-84229790 AATCCCCATGTGTTGTGGGAGGG - Intergenic
976442129 4:85088045-85088067 AATCCCCATGTGTTGTGGGAGGG + Intergenic
976457580 4:85265977-85265999 AATCTCCATGTGTTGAGGGAAGG - Intergenic
976555537 4:86447128-86447150 AATCCCCAGGTGTTGAGAGAGGG + Intronic
976870819 4:89791261-89791283 AACCCCCATGTGTTGAGGGAGGG - Intronic
977030272 4:91874681-91874703 AATTCCCATGTGTTGTGAGATGG + Intergenic
977072366 4:92407207-92407229 AATCCCCAGGTGTTGAGGAAGGG - Intronic
977197748 4:94083346-94083368 AATTCCCGTGTGTTGTGGGAGGG - Intergenic
977242933 4:94595188-94595210 AATCCCCACGTGTTGAGGGAGGG - Intronic
977395639 4:96468001-96468023 AATCCCCATGTGTTATGAGAGGG - Intergenic
977452686 4:97219301-97219323 AATCCCCCTGTGTTGGGTGAGGG - Intronic
977722019 4:100250404-100250426 AATCCCCATGTGTCGAGGGAGGG - Intergenic
978032154 4:103948577-103948599 AATTCCCCTGTCTTGATAAATGG - Intergenic
978048062 4:104158031-104158053 AATCCCCACATGTGGAGAAAGGG - Intergenic
978145216 4:105364764-105364786 AATCCCCATGTGTTGAGGGAGGG + Intergenic
978295550 4:107200598-107200620 AATTCCCATGTGTTGTGAGAGGG + Intronic
978515731 4:109566695-109566717 AATCTCCTTGTTTTGAGAAGGGG + Intronic
978592152 4:110335698-110335720 AATTCCTGTGTGTTGTGAGAGGG - Intergenic
978627656 4:110705416-110705438 AATCCCCAGGTGTTGAGGGAGGG + Intergenic
978686971 4:111457551-111457573 AATCCCCATGTGTTGTGGGAGGG + Intergenic
978734711 4:112072800-112072822 AATCCCCATGTGTTGAGGGAGGG - Intergenic
978809594 4:112836101-112836123 AATCCCCATGTGTTGAAGGAGGG + Intronic
978844173 4:113252285-113252307 AATTCCCTTGTGTTGCGAGAGGG - Intronic
978912402 4:114079603-114079625 AATCTCCATGTGTTGAGGGAAGG - Intergenic
978994482 4:115132689-115132711 AATTCCCATGTGTTGTGAGAAGG + Intergenic
978994974 4:115139575-115139597 AATCCCCATGTGTGGTGACAGGG + Intergenic
979188142 4:117824502-117824524 CCTCCCCATGTGATGAGAAAAGG + Intergenic
979362615 4:119782838-119782860 AATCCCCATGTGTTAAGGGAGGG - Intergenic
979500620 4:121435595-121435617 AATTCCCATGTGTTGTGAGAGGG - Intergenic
979781282 4:124653975-124653997 AATCCCCGTGTGTCAAGGGAGGG + Intergenic
979817882 4:125132962-125132984 AATCCCCATGTATTGAGGGAGGG - Intergenic
979862620 4:125713341-125713363 AATCCCCATGTGTTGGGAGTGGG + Intergenic
980084608 4:128378318-128378340 AATCCCCACATGTTGAGAAAGGG - Intergenic
980214545 4:129834817-129834839 AATTCCCATGTGTTGCGGAAGGG - Intergenic
980335408 4:131467833-131467855 AATTCCCATGTGTTGTGAGAGGG + Intergenic
980335678 4:131469766-131469788 AATTCCCATGTGTTGTGGAAGGG + Intergenic
980422883 4:132586198-132586220 AATTCCCATGTATTGAGAGAGGG + Intergenic
980425019 4:132617566-132617588 AATCCCCATGTGTTGAGGGAGGG - Intergenic
980468124 4:133212932-133212954 AATCCCCATGTGTTGGGACAGGG - Intergenic
980582443 4:134772482-134772504 AATCCCCATGTGTTGGGTGAGGG + Intergenic
980596388 4:134961230-134961252 AATCCCCGTTGGTTGAGGGAGGG + Intergenic
980606981 4:135105211-135105233 AATCCCCGTGTGTCAAGGGAGGG + Intergenic
980731765 4:136833118-136833140 AATTCCCATGTGTTGTGGAAGGG + Intergenic
980742876 4:136974582-136974604 AATCCCCATGTGTCATGAAAGGG - Intergenic
980746209 4:137020105-137020127 AATCCCCATGTGTCGAGGAAGGG + Intergenic
981281551 4:142965452-142965474 AATTCCCATGTGTTGTGAGAGGG - Intergenic
981486438 4:145291488-145291510 AATCCCCAGGTGTTGAGGGAGGG + Intergenic
981680178 4:147388683-147388705 AATCACCATGTGTTGAGGGAGGG - Intergenic
981724487 4:147833215-147833237 AATCCCTATGTGTTGAGGGAGGG + Intronic
981731048 4:147898962-147898984 AATCCCCACATGTCGAGAAAGGG - Intronic
981786271 4:148482722-148482744 ATTCCCCATGTGTTGAGGGATGG - Intergenic
981975837 4:150726776-150726798 AATCCCCACGTGTTGAGGGAGGG - Intronic
982129363 4:152213581-152213603 AATCCCCATGTGTTGTGGGAGGG - Intergenic
982495960 4:156092331-156092353 AATCCCCATGTGTTGTGGGAGGG - Intergenic
982547609 4:156754963-156754985 AATCCCCATGTGTTGGGTGAGGG + Intergenic
982660909 4:158205594-158205616 AATCCCCACCTGTTGAGAGAGGG + Intronic
982953486 4:161731348-161731370 AATCCCCATGTGTTGGGCGAGGG + Intronic
983068266 4:163236877-163236899 AATTCCCATGTGTTGTGGAAGGG - Intergenic
983171617 4:164542195-164542217 AATCCCCACATGTTGAGAGAGGG - Intergenic
983578919 4:169288271-169288293 AATCCCCATGTGTAGAGGGAGGG - Intergenic
983955422 4:173692278-173692300 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
984017480 4:174442883-174442905 AATTCCCATGTGTTGTGAGAAGG - Intergenic
984031803 4:174613246-174613268 AATTCCCTTGTGTTGTGGAAGGG - Intergenic
984108275 4:175577398-175577420 AATCCCCATGTGTTGAGGGAGGG - Intergenic
984211937 4:176860617-176860639 AATCCCCATGTGTTGAAGGAGGG - Intergenic
984355652 4:178654333-178654355 AATTCCCATGTGTTGTGAGAGGG + Intergenic
984576300 4:181452373-181452395 AATCCCCTCGTGTTGTGAAAGGG + Intergenic
984700021 4:182813164-182813186 AATCCCCATGTGTTGAGGGTGGG - Intergenic
984802434 4:183727362-183727384 AATCCCAGTGTGTCCAGAATTGG - Intergenic
985037607 4:185856996-185857018 AATCCCTATGTGTTGAGGAAGGG - Intronic
985183868 4:187295663-187295685 AATTCCCATGTGTTGTGGAAGGG - Intergenic
985427038 4:189841159-189841181 AATCCCCCAGTCTTGACAAATGG + Intergenic
985581602 5:698698-698720 AATTCCCGTGTGTTGTGGGAGGG - Intergenic
986117007 5:4785085-4785107 AATCCCCATGTGTTGGGAGAGGG - Intergenic
986348133 5:6853305-6853327 AATTCCCATGTGTTGTGGAAGGG + Intergenic
986470917 5:8073379-8073401 AATCCCCATGTGTTGAGGGTAGG - Intergenic
986545448 5:8892007-8892029 AGTCCCCATGGGTTGAGAGAGGG - Intergenic
986610493 5:9562165-9562187 AATCCCCATGGGTTGAGGGAGGG - Intergenic
986635449 5:9818005-9818027 AATCCCCATGTGTAGAGGGAGGG - Intergenic
986792791 5:11180087-11180109 AAGCCCCATGTGTTGAGGGAGGG + Intronic
986860684 5:11923220-11923242 AATCCCCATGTGTTGTGGGAGGG + Intergenic
986920782 5:12676691-12676713 AATCCCCATGTGTTGGGAGAGGG - Intergenic
987190949 5:15477880-15477902 AATTCCCATGTGTTGTGGAAGGG + Intergenic
987252129 5:16110861-16110883 AATCCCCATGTGTTGTGGGAGGG + Intronic
987372913 5:17209412-17209434 AATCCCCAGGTGTTGAGGGAGGG - Intronic
987501852 5:18721764-18721786 AATCCCCACGTGTTGAGGGAAGG + Intergenic
987505174 5:18760186-18760208 AATCCCCATCTGTTGAGGACAGG + Intergenic
987512206 5:18855166-18855188 AATTCCCATGTGTTGTGGAAGGG + Intergenic
987555029 5:19435605-19435627 AATCCTCCTGTGTTGAGGGAGGG + Intergenic
987662314 5:20893441-20893463 AATCCCCATGTGTCGAGGGAGGG + Intergenic
987672927 5:21036582-21036604 AATCCCCATGTGTTGTGGGAGGG + Intergenic
987681424 5:21140824-21140846 AATCCCCATGTGTTGTGGGAGGG + Intergenic
987802971 5:22721705-22721727 AATCCCCATGTGTTGAGGGAGGG + Intronic
987806482 5:22775827-22775849 AATTCCCGTGTGTTGTGGGAGGG + Intronic
987810104 5:22823641-22823663 AATCCCCAAGTGTTGAGAAAGGG + Intronic
987907000 5:24089951-24089973 AATCCCCATGTGTTGAACAAAGG - Intronic
987947394 5:24629576-24629598 AATCCCCAGGTGTTGAGGAAGGG + Intronic
987966888 5:24889166-24889188 AATCCCCATGTGCCGAGAGAGGG + Intergenic
987984041 5:25122917-25122939 AATCCCCATGTATTGAGAAAGGG - Intergenic
988074928 5:26339909-26339931 AATCCCCAAGTGTTGGGGAAGGG - Intergenic
988098782 5:26652637-26652659 AATTCCCGTGTGTTGTGAAAAGG + Intergenic
988119480 5:26942304-26942326 AATCCCCATGTGTTGTGGGAGGG - Intronic
988136395 5:27176421-27176443 AATCCCCGTATGTTGAGGGAGGG - Intergenic
988166473 5:27596377-27596399 AATCCCCATGTTTCGAGAGAGGG - Intergenic
988316731 5:29640785-29640807 AATCTCCATGTGTTGAGAGAGGG - Intergenic
988319252 5:29670709-29670731 AATCCCCATGTGTTATGGAAAGG + Intergenic
988396432 5:30701922-30701944 AATCCCCATGTGTTGGGGAAGGG + Intergenic
988618844 5:32801945-32801967 AATCCCCATGTGTTGTGGGAGGG - Intergenic
988691857 5:33580464-33580486 AATCCCCATGTGTTGAGGGAGGG - Intronic
988738657 5:34047839-34047861 AATCAGAGTGTGTTCAGAAAGGG + Intronic
988858687 5:35254090-35254112 AATCTCCATGTGTTGTGAAAGGG - Intergenic
988864304 5:35317801-35317823 AATCCCCATGTGTTGAGGGAGGG + Intergenic
988876779 5:35455812-35455834 AATCCCCATGTGTTGTGGGAGGG - Intergenic
988942809 5:36163049-36163071 AATCCCCATGTGTTGCGGGAGGG - Intronic
989046838 5:37282154-37282176 AATTCCCATGTGTTGTGAGAGGG - Intergenic
989245510 5:39249902-39249924 AACCCCCATGTGTTGAGGAAAGG + Intronic
989304723 5:39940222-39940244 AATCCCCATGTGTTGTGGGAGGG - Intergenic
989746954 5:44840192-44840214 AATCCTCATGTGTTGAGGGAAGG + Intergenic
989810592 5:45668257-45668279 AATCCCCGTGTGTGGAAGGAGGG + Intronic
990031938 5:51271959-51271981 AATCCCCATGTGTCAAGAATGGG - Intergenic
990064612 5:51697433-51697455 AATCCCCATGTGTGGAGGAAGGG - Intergenic
990067416 5:51735624-51735646 AATTCCCATGTGTTGTGGAAGGG - Intergenic
990105419 5:52252444-52252466 AATCCCCATGTGTTGAAGGAGGG - Intergenic
990144603 5:52744965-52744987 AATCCCCATGTGTTGTGGAAGGG - Intergenic
990558775 5:56963241-56963263 AATCCCCATGTGTCGAGAGAGGG + Intronic
990706288 5:58533330-58533352 AATCCCTATGTGTTGAGGGAGGG + Intergenic
990756866 5:59081859-59081881 AATCCCCATGTGTTGCGGGAGGG + Intronic
990787428 5:59438096-59438118 AATCCCCATGTGTTGTGGGAGGG - Intronic
990931777 5:61099878-61099900 AATCCCCATTTGTTGGGAAGTGG + Intronic
990939583 5:61188344-61188366 AATCCCCACGTGTTGAGGGAGGG + Intergenic
991010103 5:61873328-61873350 AATTCCCATGTGTTGTGAGAGGG - Intergenic
991122655 5:63033494-63033516 AATCCCCACGTGTTGAGGGAGGG + Intergenic
991208948 5:64082885-64082907 AATCCCCATGTGTTGTGGGAGGG + Intergenic
991278634 5:64883230-64883252 AATCCCCATGTGTTGTGGGAGGG - Intronic
991296943 5:65091668-65091690 AATCCCCATGTGTTGAGGAAGGG + Intergenic
991431188 5:66549205-66549227 AATCTCCATGTGTCGAGGAACGG + Intergenic
991586408 5:68206553-68206575 AATCCCCGAATGTTGAGAAAGGG + Intergenic
992009473 5:72512361-72512383 AATTCCCCTGTCTTGATAAATGG - Intergenic
992122734 5:73611195-73611217 AATTCCCATGTGTTGTGAGAGGG - Intergenic
992191945 5:74301308-74301330 AATCCCCATGTGTTGAGGGAGGG - Intergenic
992310786 5:75497535-75497557 AATCCCCATGTGCTGTGGAAAGG + Intronic
992311074 5:75499374-75499396 AATCCCCATGTGTTGTGGGAGGG + Intronic
992478508 5:77127236-77127258 AATCCCCATGTGTTGAGGGAGGG + Intergenic
992591473 5:78300372-78300394 AATCCCCATGTGTTGTGGGAGGG - Intergenic
992591644 5:78301682-78301704 AATCTCCATGTGTCGAGAGAGGG + Intergenic
992658241 5:78931780-78931802 AATCCCCAGGTGTTGAAGAAGGG + Intronic
992771214 5:80050196-80050218 AATTCCCCTGTCTTGATAAATGG - Intronic
992922610 5:81542692-81542714 AATCCCCATGTGTCGAGGGAAGG + Intronic
993019511 5:82574899-82574921 AATCCCCATGTGTTGTGGGAGGG + Intergenic
993098437 5:83506987-83507009 AATTCCCATGTGTTGTGGAAGGG - Intronic
993107628 5:83617508-83617530 AATCCCCATGTGTTGAGGGAGGG + Intergenic
993133903 5:83932921-83932943 AATCCCCATGTGTTGTGGGAGGG + Intergenic
993167381 5:84374656-84374678 AATCCCCATGTGTTGAGGGAGGG + Intronic
993225772 5:85166074-85166096 AATTCCCATGTGTTGAGGGAGGG + Intergenic
993238555 5:85348105-85348127 AATTCCCACGTGTTGAGAGAAGG + Intergenic
993262831 5:85682125-85682147 AATCCCCATGTGTTGAAGGAGGG - Intergenic
993266807 5:85736988-85737010 AATCCCCAAGTGTTGAGGGAAGG - Intergenic
993278144 5:85888560-85888582 AATCCCCATGTGTTGAAGGAGGG - Intergenic
993285378 5:85989968-85989990 AATCCCCATGTGTTGTGGGAGGG + Intergenic
993322772 5:86494556-86494578 AATCTACCTGTGTTGATAAAGGG - Intergenic
993631649 5:90293405-90293427 AATCCCCATGTGTTGTGGGAGGG + Intergenic
993713638 5:91252846-91252868 AATCCCCACGTGTTGAGGGAGGG + Intergenic
993797403 5:92284367-92284389 AATCCCCATGTTTTGAGAGAGGG - Intergenic
993808563 5:92443363-92443385 AATCCCCATGTGTTGAGGGAGGG - Intergenic
993828287 5:92720961-92720983 AATCCCCACATGTTGAGAAAGGG - Intergenic
993944101 5:94097427-94097449 AATTCCCATGTGTTGTGGAAGGG + Intronic
994167332 5:96621651-96621673 AATCCCCATGTGTGGAGGGAGGG - Intronic
994178405 5:96737110-96737132 AATCCCCACGTGTCGAGGAAGGG - Intronic
994253796 5:97569440-97569462 AATCCCCCTGTGTTGAGAGAGGG - Intergenic
994453378 5:99972895-99972917 AATCCCCAAGGGTTAAGAAAAGG - Intergenic
994694574 5:103057994-103058016 AATTCTCGTGTGTTGTGGAAGGG - Intergenic
994809714 5:104499518-104499540 AATTCCCATGTGTTGTGAGAGGG - Intergenic
995392283 5:111652669-111652691 AATTCCCGTGTGTTGTGGGAGGG - Intergenic
995608298 5:113881713-113881735 AATCCCCATGTGTTGAGGGAGGG + Intergenic
995620023 5:114015258-114015280 AATCCCCATGTGTTGTCAGAGGG + Intergenic
995997747 5:118321960-118321982 AATCCCCAAGTGTAGAGGAAGGG - Intergenic
995998057 5:118324254-118324276 AACCCCAGTGTGTTGAAAGAGGG - Intergenic
996046898 5:118883758-118883780 AATCCCCATATGTTGAGGGAGGG - Intronic
996222662 5:120952652-120952674 AATCCCCATGTGTTGTGGGAGGG + Intergenic
996236777 5:121140791-121140813 AATTCCCATGTGTTGTGAGAGGG - Intergenic
996362249 5:122662523-122662545 AATCCCCATGTGTTGGGAGAGGG - Intergenic
996365626 5:122697436-122697458 AATTCCCATGTGTTGTGAAAGGG - Intergenic
996498777 5:124192637-124192659 AATCCCCATGTGTTGAGGGAGGG - Intergenic
996515934 5:124369282-124369304 AATCCCCATGTGTCGAGGGAGGG - Intergenic
996929270 5:128866726-128866748 AATTCCCATGTGTTGTGAGAGGG + Intronic
996973202 5:129397654-129397676 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
997079739 5:130724203-130724225 GATCCCCATGTGTTGAGGGAGGG - Intergenic
997181293 5:131831927-131831949 AATTCCCATGTGTTGTGGAAGGG - Intronic
997329431 5:133048492-133048514 AATCCCAGTGTGTCCAGAATTGG - Intergenic
997602104 5:135147631-135147653 AATCCCCACGTGTTGTGAGAGGG - Intronic
997616844 5:135252363-135252385 AATCCCCATGTGTTAAGGGAGGG + Intronic
997651232 5:135522932-135522954 AATCCCCATGTGTTGGGGACAGG - Intergenic
998450831 5:142233339-142233361 AATCCCCACGTGTTGAGAGAGGG + Intergenic
998631816 5:143906895-143906917 AATCCCCAGGTGTTGAGAGAGGG - Intergenic
998774374 5:145582483-145582505 AATCCCCATGTGTTGGGGGAGGG - Intronic
998980670 5:147698524-147698546 AATCCCCATGTGTTGTGGGACGG + Intronic
998983282 5:147727602-147727624 AATCCCCATGTGTTGAGTGAGGG - Intronic
999040849 5:148410229-148410251 AATTCCCATGTGTTGTGAGAGGG + Intronic
999051565 5:148529329-148529351 AATTCCCGTGTGTTGTGGGAGGG + Intronic
999299640 5:150483316-150483338 AACCTCCTTGTGTTGAGGAAAGG - Intergenic
999517598 5:152316612-152316634 AATCCCCATGTGTTGGAGAAGGG - Intergenic
999985151 5:156996504-156996526 AATTCCCGTTTTTAGAGAAAGGG + Intergenic
1000046693 5:157527614-157527636 AATCCCCATGTTTTGAGGGAGGG - Intronic
1000083538 5:157869311-157869333 AATCCCCATGTGTTGTGAGAGGG + Intergenic
1000225735 5:159260265-159260287 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1000270762 5:159680998-159681020 AATCCCCATGTGTTGTGAGAAGG + Intergenic
1000496495 5:161990848-161990870 AATTCCCATGTGTTGTGACAGGG - Intergenic
1000522346 5:162311355-162311377 AATCCCAGAGTGTTGGGAGATGG - Intergenic
1000577107 5:162988162-162988184 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1000767287 5:165307991-165308013 AATCCCCATGTGTCGAGGGAGGG - Intergenic
1001054551 5:168438256-168438278 AATCCCCATGTGTTGTGGGAGGG + Intronic
1001077551 5:168641826-168641848 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1001215449 5:169851893-169851915 AATCCCCATGTGTTGAGGGAGGG - Intronic
1002356378 5:178632657-178632679 AATCCCCACGTGTTGAGAGAGGG - Intergenic
1003591397 6:7440104-7440126 AATCCCCGTGTGACGGGAAAAGG - Intergenic
1003690051 6:8345272-8345294 TATCCCCATGTGTTGTGAGAGGG + Intergenic
1003809754 6:9766820-9766842 AATCCCCATGTGTTGTGGGAGGG - Intronic
1003986487 6:11441204-11441226 AATTCCCGCGTGTTGTGGAAGGG + Intergenic
1004847934 6:19666274-19666296 CATCCTCCTGTTTTGAGAAACGG - Intergenic
1004883847 6:20033453-20033475 AATCCCAGTGTATTCAGAATTGG - Intergenic
1005107109 6:22235641-22235663 AATTCCCATGTGTTGTGAGAGGG + Intergenic
1005153457 6:22778292-22778314 AATTCCCGTGTGTTGTGGGAGGG + Intergenic
1005248357 6:23914730-23914752 AATCCCCATATGTTGTGAGAGGG - Intergenic
1005507991 6:26486587-26486609 AATCCCCATGTGTTGAAGAAGGG - Intergenic
1005790336 6:29294220-29294242 AATCCCCATATGTTGAGGGAGGG + Intergenic
1006348633 6:33504012-33504034 AATCCCAGTGTGTCCAGAATTGG - Intergenic
1006917007 6:37601248-37601270 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1007003232 6:38334941-38334963 AATCCCCACGTGTTGAGGGAGGG + Intronic
1008257816 6:49325906-49325928 AATCCCCAAGTGTTGAGGGAGGG - Intergenic
1008287760 6:49674785-49674807 AATTCCCATGTGTCGAGGAAGGG + Intergenic
1008347142 6:50441777-50441799 AATCCCCACATGTTGAGGAAGGG + Intergenic
1008424230 6:51338180-51338202 AATCCCCTGGTGTAGAGCAAAGG - Intergenic
1008661647 6:53674265-53674287 AGTCCTCCTGTGTTTAGAAATGG - Intergenic
1008766211 6:54918666-54918688 AATCCCCATGTGTTGTGGGAGGG - Intronic
1008847467 6:55985043-55985065 AATCCCCATGTGTTCAGGGAAGG - Intergenic
1008871093 6:56272638-56272660 AATCCCCATGTGTTGAGGGAGGG + Intronic
1009194419 6:60666857-60666879 AATCCCCGTGTATTGAGGGTGGG - Intergenic
1009316955 6:62231500-62231522 AATCCCCGTGTGTCAAGGAAAGG - Intronic
1009348325 6:62645147-62645169 AATTCCCATGTGTTGAGGGAGGG + Intergenic
1009370360 6:62893271-62893293 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1009447753 6:63763487-63763509 AATCCCCATGTGTTGTGGGAGGG + Intronic
1009545908 6:65020035-65020057 AATCCCCATGTGTTGTGAGAGGG - Intronic
1009661621 6:66619816-66619838 AATCCCCATGTGTACAGAAAGGG - Intergenic
1009757168 6:67955245-67955267 AATTCTCATGTGTTGGGAAAGGG + Intergenic
1009884573 6:69610566-69610588 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1009889746 6:69666389-69666411 AATCCCCATGTGTTGAAGGAGGG + Intergenic
1010046985 6:71456529-71456551 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1010399315 6:75430029-75430051 AATCCCCAAGTGTTGAGAGAGGG + Intronic
1010494309 6:76514350-76514372 AATCCCCAGGTGTTGTGGAAGGG - Intergenic
1010525503 6:76895508-76895530 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1010674159 6:78721500-78721522 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1010674177 6:78721594-78721616 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1010704565 6:79092098-79092120 AATCCCCATGTGTTTGGAGAGGG - Intergenic
1011074663 6:83425632-83425654 AATCCCCATGTGTTGTGGGAGGG - Intronic
1011078292 6:83461720-83461742 AATGCCAGTGTTTTCAGAAATGG - Intergenic
1011129885 6:84042033-84042055 AATCCCCATGTGTTGTGGGAGGG + Intronic
1011218771 6:85032767-85032789 AATCCCCAAGTGTCGAGGAAGGG - Intergenic
1011870310 6:91885131-91885153 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1011879560 6:92007663-92007685 AATCCCCATGTGTGGAGGGAGGG - Intergenic
1012074830 6:94670573-94670595 AATCTCCATGTGTTGTGAGAGGG + Intergenic
1012153343 6:95783685-95783707 AATCCCCATATGTTGAGGGAGGG - Intergenic
1012281212 6:97329696-97329718 AATCCCCATGTGTTGTAGAAGGG + Intergenic
1012485768 6:99721450-99721472 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1012706419 6:102537822-102537844 AATCCCCACGTGTTGTGAGAGGG + Intergenic
1012741337 6:103019682-103019704 AATTCCCATGTGTTGTGAAAGGG + Intergenic
1012966953 6:105685667-105685689 AATCCCCATGTGTCGTGGAAGGG + Intergenic
1012968608 6:105702791-105702813 AATTCCCATGTGTTGTGGAAGGG + Intergenic
1013019965 6:106204564-106204586 AATCCCCATGTGTCGAGGGAGGG + Intronic
1013425802 6:110011657-110011679 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1013794004 6:113864695-113864717 AATCCTCATCTTTTGAGAAAAGG - Intergenic
1013970709 6:116015161-116015183 AATCCCCATGTGTTGGGGAAGGG + Intronic
1014525832 6:122501012-122501034 AATCCCCACGTGTTGGGAGAGGG - Intronic
1014586226 6:123201670-123201692 AATTCCCATGTGTTGTGAAAGGG - Intergenic
1014594104 6:123311336-123311358 AATCCTCATGTGTTGAGGGATGG - Intronic
1014620782 6:123664518-123664540 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1015035671 6:128651428-128651450 AATCCCCAGGTGTTGAGGGAGGG + Intergenic
1015055844 6:128902182-128902204 AATCCCCATGTGTTGGGGGAGGG - Intronic
1015067318 6:129046547-129046569 AATCCCCATGTGTTGTGGGAGGG - Intronic
1015127482 6:129770736-129770758 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1015178469 6:130337132-130337154 AATCCTCATGTGTTGAGGGAGGG + Intronic
1015214859 6:130737808-130737830 AATCCCCACATTTTGAGAAAGGG - Intergenic
1015312894 6:131784216-131784238 AACCCCCATGTGTTGTGGAAGGG - Intergenic
1015319063 6:131851163-131851185 AATTCAGGTGTGGTGAGAAAAGG + Exonic
1015446189 6:133307893-133307915 AATCCCCGTGTGTTGTGGGAGGG + Intronic
1015474079 6:133639372-133639394 AATCCCCATGTGTTGAAGGAGGG + Intergenic
1015483323 6:133740363-133740385 AATCACCACTTGTTGAGAAAGGG - Intergenic
1015494604 6:133866723-133866745 AATCCCCATGTGTGGGGAGAGGG - Intergenic
1015555042 6:134452201-134452223 AATCCCCACGTGTTGAGGGAAGG + Intergenic
1015585154 6:134768885-134768907 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1015775445 6:136809427-136809449 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1015831618 6:137376268-137376290 AATTCCCTTGTGTTGTGGAAGGG + Intergenic
1015853139 6:137594812-137594834 AATCCCCATGTGTTATGGAAGGG - Intergenic
1015899365 6:138048527-138048549 AATTCCCATGTGTTGTGCAAGGG - Intergenic
1015972816 6:138759846-138759868 AATCCCCGTGTGTTGAGGGAGGG - Intronic
1015981955 6:138848140-138848162 AATCCCTGTGTGTCGAGGGAGGG - Intronic
1016033188 6:139358655-139358677 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1016079517 6:139838794-139838816 AATTCCCATGTGTTGTGAGAGGG + Intergenic
1016085025 6:139902830-139902852 AATCCCTATGTGTAGAGAGAGGG + Intergenic
1016127273 6:140419944-140419966 AATCCCCATGTGTTGGGGGAGGG - Intergenic
1016134669 6:140524991-140525013 AATTCCCATGTGTTGTGGAAGGG + Intergenic
1016139324 6:140588063-140588085 AATCCCTATGTATTGAGGAAGGG - Intergenic
1016150270 6:140732640-140732662 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1016285167 6:142464188-142464210 AATCCCCATGTGTTGAGAGAGGG - Intergenic
1016346642 6:143120629-143120651 AATCCCCGCGTGTTATGACAGGG - Intronic
1016374911 6:143410301-143410323 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1016517719 6:144914050-144914072 AATTCCCATGTGTTGTGGAAGGG + Intergenic
1016613595 6:146022928-146022950 AATCCCCAGGTGTTGAGGGAGGG + Intergenic
1016613866 6:146024852-146024874 AATCCCTAGGTGTTGAGGAAGGG + Intergenic
1016635491 6:146284552-146284574 AATCCCCATGTGTTGAGGGAGGG + Intronic
1016788076 6:148035357-148035379 AATTCCCTCGTGTTGTGAAAGGG - Intergenic
1017133380 6:151127467-151127489 AATCCCCATATGTTGAGGAAAGG + Intergenic
1017186124 6:151602525-151602547 AATCCCCATGTATTGAGGGAGGG + Intronic
1017593936 6:156008448-156008470 AATCCCCATGTGTTGTAGAAGGG + Intergenic
1017983134 6:159420248-159420270 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
1018048891 6:159990278-159990300 AATCCCCATGTGTTGTGGGAGGG + Intronic
1018086166 6:160303006-160303028 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1018145119 6:160878788-160878810 AATCCCCATATGTTGAGGGAAGG + Intergenic
1018227048 6:161638633-161638655 AATCCCCATGTGTTGTGGGAGGG + Intronic
1018407820 6:163505924-163505946 AATTCCCATGTGTTGAGGGAGGG + Intronic
1018507255 6:164484582-164484604 AATTCCCATGTGTTGTGGAACGG - Intergenic
1018510109 6:164516051-164516073 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1018527583 6:164729708-164729730 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1018570439 6:165204144-165204166 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1018721704 6:166577876-166577898 AATTCCCTTGTGTTGGGAGAGGG + Intronic
1018985531 6:168633847-168633869 AATCCCCATGTGTCGTGAGAGGG + Intronic
1019011344 6:168845961-168845983 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1019141222 6:169945045-169945067 AATCCCCATGTGTCAAGAGAGGG - Intergenic
1019615935 7:1961725-1961747 AATCCCCATGTGTTGCGGGAGGG + Intronic
1019816064 7:3201813-3201835 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1019962060 7:4468760-4468782 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
1019969645 7:4529872-4529894 AATCCTCATGTGTTGTGGAAGGG - Intergenic
1019981053 7:4622532-4622554 AATCCCCAGGTGTTGAGGGAGGG + Intergenic
1020493951 7:8823370-8823392 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1020605699 7:10334049-10334071 AATCCCCATATGTTGTGAAAGGG + Intergenic
1020869172 7:13606457-13606479 AATCCCCATGTGTTATGGAAGGG + Intergenic
1020988124 7:15161981-15162003 AATCCCCACATGTTGAGAAAGGG + Intergenic
1021199830 7:17716245-17716267 AATCCCCGTACTTTGAAAAAAGG - Intergenic
1021202783 7:17744102-17744124 AATCCCAATGTGTTGAGGGAGGG + Intergenic
1021291531 7:18851252-18851274 AATCCCCATGTGTCGAGGGAGGG + Intronic
1021324942 7:19255275-19255297 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1021549117 7:21851121-21851143 AATCCCCGTATGTTGTGGCAGGG + Intronic
1021753874 7:23832606-23832628 AATCCCCACGTGTTGTGAGAGGG + Intergenic
1022202259 7:28127945-28127967 AATCCCCATGTGTTGTGGGAAGG - Intronic
1022297968 7:29074587-29074609 AATCCTTATGTGTTGAGGAAGGG + Intronic
1022607711 7:31833024-31833046 AATTCCCATGTGTTGTGGAAGGG + Intronic
1022705874 7:32801734-32801756 AATCCCCATGTGTCAAGGAAGGG - Intergenic
1022706146 7:32803699-32803721 AATCCCCATGTGTTAAGGGAGGG - Intergenic
1022768721 7:33445696-33445718 AATCCCCATGTGTTGAGGGAGGG + Intronic
1022824730 7:33997357-33997379 AATCCCCATGTGTTGAGGGAGGG + Intronic
1022843159 7:34183802-34183824 AATCTCCGGGTGTTGAGGTAGGG + Intergenic
1022947460 7:35301831-35301853 AATCCCCATGTGTAGAGGGAGGG + Intergenic
1022982586 7:35618396-35618418 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1023158235 7:37273260-37273282 AATCCCCATGTGTTAACAGAGGG + Intronic
1023281500 7:38575440-38575462 AATCCCCATGTGTTGGGGGAGGG + Intronic
1023651285 7:42371689-42371711 AATTCCCATGTGTTGAGGGAGGG - Intergenic
1023695530 7:42841905-42841927 AATTCCCATGTGTTGTGAGAGGG - Intergenic
1023903720 7:44505741-44505763 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1024169106 7:46765867-46765889 AATCCCCATGTGTTGTGGGAAGG - Intergenic
1024254952 7:47533666-47533688 AATTCCCATGTGTTGTGAGAGGG + Intronic
1024311411 7:47972942-47972964 AATCCCCAAGTGCTGAGAAGGGG + Intronic
1024666495 7:51551991-51552013 AATCCCCATGTGTGGAGGGAGGG + Intergenic
1024792896 7:52986282-52986304 AATTCCCATGTGTTGTGGAAGGG + Intergenic
1024850477 7:53709635-53709657 AATTCCCATGTGTTGTGGAATGG + Intergenic
1024865713 7:53903556-53903578 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
1025084252 7:56009717-56009739 AATTCCCCTGTATTGAGAAATGG + Intergenic
1026230813 7:68482311-68482333 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1026302492 7:69109988-69110010 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1026302738 7:69111990-69112012 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1026424400 7:70275640-70275662 AATCCCCATGTGTTGTGGGAGGG + Intronic
1026490503 7:70859157-70859179 AATCCCCCTGTTATTAGAAAGGG + Intergenic
1026532306 7:71210262-71210284 AATTCCCACGTGTTGTGAAACGG - Intronic
1027463231 7:78481453-78481475 AATCCCCATGTGTCGAGGGAAGG - Intronic
1027503921 7:78990992-78991014 AATCCCCATGTGTCGAGGGAGGG + Intronic
1027558288 7:79693974-79693996 AATACCCATGTTTTGAGGAAGGG + Intergenic
1027592819 7:80135857-80135879 ATTCCCCCTGCGCTGAGAAAAGG + Intronic
1027604374 7:80282930-80282952 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1027771975 7:82418285-82418307 AATCCCCATGTGTTGTGGTAGGG - Intronic
1027977740 7:85180139-85180161 AATCCCTATGTGTTGGGAGAGGG + Intronic
1028271911 7:88801970-88801992 AATCTCCATGTGTTGAGGGAGGG + Intronic
1028314606 7:89384480-89384502 AATCCCCATGTGTTGTGGGATGG + Intergenic
1028351276 7:89852799-89852821 AATCCCCGTGTGTTGAAAGTAGG + Intergenic
1028385537 7:90249116-90249138 AATCCCCAGGTGTTGAGGGAGGG + Intronic
1028651961 7:93160141-93160163 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1028902219 7:96114244-96114266 AATCCCCGTGGGTTGTGGGAGGG + Intergenic
1029846672 7:103418944-103418966 AATTCCCATGTGTTGTGAGAGGG + Intronic
1029944377 7:104516328-104516350 AATCCCCACGTGTTGTGAGAGGG - Intronic
1029960713 7:104687016-104687038 AATCCCCATGTGTTGGGGGAGGG - Intronic
1030187368 7:106777224-106777246 AATCCCCATGTGTTGTGGGACGG - Intergenic
1030357625 7:108559884-108559906 AATCCCCAGGTGTTGAGGGAGGG - Intronic
1030458908 7:109806934-109806956 AATTCCCATATGTTGTGAAAGGG + Intergenic
1030532606 7:110729482-110729504 AATCTCCATGTGTTGAGGGAGGG - Intronic
1030551304 7:110963930-110963952 AATCCCCATGTGTAGAGGGAGGG + Intronic
1030584700 7:111403129-111403151 AATCCCCACATGTTGAGGAAGGG + Intronic
1030677119 7:112395559-112395581 AATCCCCATGTGTCAAGGAAGGG + Intergenic
1030755973 7:113288595-113288617 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1030906983 7:115197741-115197763 AATTCCCATGTGTTGTGAGAGGG - Intergenic
1030990852 7:116298287-116298309 AATTCCCTTGTGTTGTGGAAGGG + Intronic
1031114647 7:117654492-117654514 AATCTCCATGTGTTGAGGGAGGG + Intronic
1031242812 7:119267561-119267583 AATCCCCATGTGTTGAGAAAGGG - Intergenic
1031250442 7:119373360-119373382 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1031269542 7:119630411-119630433 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1031279685 7:119782485-119782507 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1031315570 7:120254316-120254338 AATCCCCATGTGTTGAGGGATGG + Intergenic
1031406403 7:121392494-121392516 AATCCCTGTGTGTCGAGGGAGGG - Intronic
1031419987 7:121539846-121539868 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1031426167 7:121608260-121608282 AATCCCCATATGTTGAGGAAGGG + Intergenic
1031614046 7:123860012-123860034 AATCCCCATGTGTGGAGGGAGGG + Intronic
1031652191 7:124304342-124304364 AATCCCCACATGTTGAGAGAGGG + Intergenic
1031656508 7:124362624-124362646 AATCCCCAAGTGTTGTGGAAGGG + Intergenic
1031669031 7:124519849-124519871 AATCCGCATGTGTCCAGAAAGGG + Intergenic
1031671205 7:124548688-124548710 AATCCCCATGTGTTGGGGGAGGG - Intergenic
1031787850 7:126057726-126057748 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1031981461 7:128129272-128129294 AATCCCCAGGTGTTGAGGAAGGG + Intergenic
1032486765 7:132293483-132293505 AATTCCCATGTGTTGTGGAAGGG - Intronic
1032726638 7:134595656-134595678 AATCCCCATGTGTCGAGGGAGGG - Intergenic
1032792428 7:135252401-135252423 AATCCCCATGTGTTGAAGGAGGG - Intronic
1032865198 7:135917808-135917830 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1032924064 7:136581733-136581755 AATTCCCGTGTGTTGAGTGAGGG + Intergenic
1032925966 7:136604703-136604725 AATCCCTGTGTGTTGTGGGAGGG + Intergenic
1033000481 7:137499082-137499104 AATCCCCCTGTGTAAAGAAAAGG - Intronic
1033052034 7:138014412-138014434 AGTCCCCATGTGTCGAGAAAGGG - Intronic
1033052039 7:138014441-138014463 AATTCCCATGTGCTGAGGAAGGG - Intronic
1033071844 7:138209990-138210012 AATCCCCATGTGTCGAGGGAGGG - Intergenic
1033252822 7:139775950-139775972 ACTCCCGGTGAGTTGAGAGAAGG - Intronic
1033427729 7:141260442-141260464 TATCACCGTTTGTTGGGAAAAGG + Intronic
1033837630 7:145335062-145335084 AATCCCCATGTGTTGGGGGAGGG - Intergenic
1033976884 7:147113669-147113691 AATCCCCATGTGTTGGGGGAGGG - Intronic
1033980943 7:147165124-147165146 AATCCCACTGTTTTGATAAAAGG - Intronic
1034007575 7:147491029-147491051 AATCCCCACGTGTTGAGGGAGGG - Intronic
1034029275 7:147742157-147742179 AATTCCCATGTGTTGTGAGAGGG - Intronic
1034040618 7:147873572-147873594 AATCCCCATGTGTTGTGGGAGGG - Intronic
1034040894 7:147875468-147875490 AATCCCCATGTGTTGTGGGAGGG - Intronic
1034119779 7:148616895-148616917 AATTCCCGTGTGTTGAGGGAGGG - Intergenic
1034119785 7:148616924-148616946 AATTCCCGTGTGTTGAGGGAGGG - Intergenic
1034119791 7:148616953-148616975 AATTCCCGTGTGTTGAGGGAGGG - Intergenic
1034119797 7:148616982-148617004 AATTCCCGTGTGTTGAGGGAGGG - Intergenic
1034119803 7:148617011-148617033 AATTCCCGTGTGCTGAGGGAGGG - Intergenic
1034119815 7:148617069-148617091 AATTCCCGTGTGCTGAGGGAGGG - Intergenic
1034119821 7:148617098-148617120 AATTCCCGTGTGCTGAGGGAGGG - Intergenic
1035426318 7:158777404-158777426 AATCTCCATGTGTTGAGGGAGGG + Intronic
1035549203 8:507219-507241 AATCCCCATGTGTTGAGGGAAGG - Intronic
1035573969 8:692960-692982 ACTCCTCGTGTGATGATAAAGGG - Intronic
1035748452 8:1978526-1978548 ACTCCCTGTGTGTTGAGTCAGGG + Intronic
1035845120 8:2855088-2855110 AACCCCTGTGTGTTGAGGGAGGG + Intergenic
1035952424 8:4037566-4037588 AATCCCTGTCAGTTGAAAAACGG - Intronic
1036026091 8:4910874-4910896 AATTCCCATGTGTTGTGAAAGGG + Intronic
1036092809 8:5687091-5687113 AATCCCCATGTGTTGGGGGAGGG + Intergenic
1036132465 8:6128607-6128629 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1036530055 8:9576683-9576705 AATCCCCATGTGTTGAAGGAGGG - Intronic
1036986191 8:13533740-13533762 AATCCCCATGTGTGGAGGGAGGG + Intergenic
1037061057 8:14509978-14510000 AATCCCTATGTGTTGAGGTAGGG - Intronic
1037068358 8:14612204-14612226 AATCCCCATGTGTTGAGGGAGGG + Intronic
1037624762 8:20597102-20597124 AATCCCCATGTGTTGAAGGAGGG + Intergenic
1038094550 8:24293254-24293276 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1038733255 8:30146427-30146449 AATCCCCATGTATTGAGGAAGGG - Intronic
1038742837 8:30230946-30230968 AATCCCCGCGTGTCGATAGAGGG - Intergenic
1038746447 8:30259145-30259167 AATTCCCATGTGTTGTGGAAGGG + Intergenic
1038752740 8:30312316-30312338 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1038804027 8:30774349-30774371 AATCCCTGTGTGTGGAGGGAGGG - Intergenic
1038936583 8:32258755-32258777 AATCCCCATGTGTGGAGAGAGGG - Intronic
1039037863 8:33378946-33378968 AATCCCCGTGTGTCAAGGGAGGG + Intronic
1039578112 8:38641878-38641900 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1039852986 8:41387460-41387482 AATCCCCACGTGTTGAGGAAGGG + Intergenic
1039855338 8:41407159-41407181 AATTCCCATGTGTTGTGAGAGGG - Intergenic
1040655850 8:49506648-49506670 AATCCTCATGTGTTGAGGGAGGG - Intergenic
1041338695 8:56817939-56817961 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1041662050 8:60410414-60410436 AATCCCCGTGTGTCGGGGGAGGG - Intergenic
1042165005 8:65936505-65936527 AATCCCCATGTGTTGGGGGAAGG + Intergenic
1042383497 8:68147362-68147384 AATTCCCGTGTGTTGTGGGAGGG + Intronic
1042422026 8:68602572-68602594 AATCCCCATGTGTTGTGGGAGGG - Intronic
1042424479 8:68631647-68631669 AATCCCCATGTGTGGAGGGAAGG + Intronic
1042432676 8:68726861-68726883 AATTCCCGTGTGTTGTGGGAGGG - Intronic
1042650388 8:71034174-71034196 AATACCCATCTGTTGAAAAAGGG + Intergenic
1042684497 8:71422844-71422866 AATCCCCATGTGTTGTGGGAGGG - Intronic
1042714602 8:71759016-71759038 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1042728230 8:71902350-71902372 AATTCCCATGTGTTGTGAAAGGG - Intronic
1042807288 8:72784709-72784731 AATCCCCATGTGTTGGGAGTGGG - Intronic
1042868096 8:73373086-73373108 AATCCCCATGTGTCGTGGAAGGG + Intergenic
1042971211 8:74410958-74410980 AATCCCCAGGTGTTGAGGGAGGG + Intronic
1043144789 8:76639512-76639534 AATCCCCACGTGTTGGGAGAGGG + Intergenic
1043357144 8:79426760-79426782 AATTCCCATGTGTTGGGGAAGGG - Intergenic
1043425961 8:80149160-80149182 AATTCCCGTGTGTTGTGGGAGGG + Intronic
1043492644 8:80764485-80764507 AATCCCCATGTGTCGAGGGAGGG - Intronic
1043694874 8:83205354-83205376 AATTCCCATGTGTTGTGGAAGGG + Intergenic
1043754749 8:83989052-83989074 AATCCCCATGTGTTCAGGGAGGG + Intergenic
1043779321 8:84312251-84312273 AATCCCCATGTGTTCAGGAAAGG - Intronic
1043807710 8:84693484-84693506 AATCCCCATGTGTTGTGGGAGGG - Intronic
1043836311 8:85051126-85051148 AATCCTCATGTGTTGAGGGAGGG - Intergenic
1043975480 8:86580244-86580266 AATCCCCATGTTTTGAGGGAAGG - Intronic
1044127154 8:88472698-88472720 AATCCCCATGTGTTGGGGAAGGG - Intergenic
1044152791 8:88801636-88801658 AATCCCCATGTATTGAGGGAGGG + Intergenic
1044155173 8:88837402-88837424 AATTCCCATGTGTTGTGAGAGGG - Intergenic
1044205437 8:89487670-89487692 AATCCCCACGTGTCGAGAGAGGG - Intergenic
1044373393 8:91441244-91441266 AATCCCCATGTGTGGTGGAAAGG + Intergenic
1044489748 8:92799415-92799437 AATCCCCATGTGTTGTGAGAGGG + Intergenic
1044851560 8:96433432-96433454 AATCCCCATGTATTGAGGGAGGG + Intergenic
1044942491 8:97357404-97357426 AATCCCCATGTGTCGAGGGAGGG - Intergenic
1045352108 8:101351225-101351247 AATCCCCATGTGTGGAGGAAGGG - Intergenic
1045525145 8:102934945-102934967 AATCTCCACGTGTCGAGAAAGGG - Intronic
1045884292 8:107078071-107078093 AATCCCCACGTGTTGTGAAAGGG - Intergenic
1045888413 8:107126603-107126625 AATCCCCATGTGTTGTGAGAAGG - Intergenic
1045940258 8:107729877-107729899 AATTCCCATGTGTTGAGGGAGGG - Intergenic
1045995532 8:108358100-108358122 AATTCCCATGTGTTGTGGAAAGG - Intronic
1046032684 8:108802750-108802772 AATCCCCATGCGTTGAGGGAAGG + Intergenic
1046161904 8:110376966-110376988 AATTCCCATGTGTTGTGGAAGGG + Intergenic
1046230636 8:111350989-111351011 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1046251774 8:111642255-111642277 AATTCCCGTGTGTTGTGGGAGGG - Intergenic
1046303395 8:112328647-112328669 AAGCCCCATGTGTTGAGAGAGGG + Intronic
1046404390 8:113754005-113754027 AATCCCCATGTGTTGGGGGAGGG + Intergenic
1046647724 8:116804279-116804301 AATCCCCACGTGTTGAGGGAGGG + Intronic
1046702104 8:117413010-117413032 AATCCCCATGTGTTGAGAGAGGG - Intergenic
1046858031 8:119057099-119057121 AATCCCCACGTGTTGAGGGAGGG + Intronic
1046880092 8:119298427-119298449 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1047028751 8:120853045-120853067 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1047309420 8:123679268-123679290 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1047425643 8:124743020-124743042 AATCCCCATGTGTCGTGGAAGGG - Intergenic
1047447115 8:124929345-124929367 AATTCTCATGTGTTGAGAGAGGG + Intergenic
1047939436 8:129815010-129815032 AATCCCCACGTGTTGTGAGAGGG + Intergenic
1048092805 8:131259601-131259623 AATCCCCATATGTTGGGGAAGGG - Intergenic
1048226682 8:132594570-132594592 AATCCCCCTGTGTGGAGGGAGGG + Intronic
1048502061 8:134987323-134987345 AATCCCCGTGTGTCGAAGGAGGG + Intergenic
1048537599 8:135312119-135312141 AATCCCCATGTGTCGAGGGAGGG - Intergenic
1048677233 8:136797120-136797142 AATCCCCATGTGTTGAGGGCAGG + Intergenic
1048719260 8:137304387-137304409 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1048719763 8:137310426-137310448 AATCCACACGTGTTGAGGAAGGG - Intergenic
1048772647 8:137912215-137912237 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1048772915 8:137914132-137914154 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1048840504 8:138561873-138561895 AATCCCCATATGTTGAGGGAGGG - Intergenic
1048899664 8:139025265-139025287 AATCCCCGTTTCTTGAGGGAGGG + Intergenic
1049014660 8:139911094-139911116 AATTCCCGTGTGTTGTGGGAGGG + Intronic
1049946721 9:604323-604345 AATCCCCACGTGTTGAGGGAGGG + Intronic
1050383546 9:5058494-5058516 AATCCCCATGTGTCGAGGGAGGG - Intronic
1050422317 9:5478450-5478472 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1050691854 9:8236372-8236394 AATTCCCATGTGTTGTGGAAGGG + Intergenic
1050809636 9:9727965-9727987 AATTCCCATGTGTTGTGAGAGGG + Intronic
1050894649 9:10871924-10871946 AATCCCCACATGTTGAGAGAGGG - Intergenic
1050928913 9:11300398-11300420 AATTCCCATGTGCTGTGAAAGGG - Intergenic
1050953411 9:11626175-11626197 AATCCCCATGTGTTGAAGGAGGG + Intergenic
1050959006 9:11703545-11703567 AATCCCCATGTGTTGAGGGAAGG + Intergenic
1050968365 9:11837353-11837375 AACCCCCATGTGTTGGGGAAGGG - Intergenic
1050974081 9:11914340-11914362 AATCCTAATGTGTTGTGAAAGGG - Intergenic
1051012233 9:12431395-12431417 AATCCCCACATGTCGAGAAAGGG + Intergenic
1051156159 9:14148570-14148592 AATCCCCTTGTTTTTACAAATGG + Intronic
1051994767 9:23201626-23201648 AATCCCCACGTGTTGAGGGAAGG - Intergenic
1052174105 9:25435450-25435472 AATCCCCATGTGTTGGGGGAGGG - Intergenic
1052187936 9:25621255-25621277 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1052316573 9:27122088-27122110 AATGCCCGTCAGTAGAGAAATGG + Intronic
1052472586 9:28918336-28918358 AATTCCCATGTGTTGTGGAAGGG - Intergenic
1052577506 9:30308646-30308668 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1052721528 9:32176420-32176442 AATTCCCATGTGTTGTGAGAGGG - Intergenic
1053115742 9:35500401-35500423 AATTCCCATGTGTTGTGAGAGGG - Intronic
1053451121 9:38194989-38195011 AATTTCCCTGTCTTGAGAAATGG + Intergenic
1053629111 9:39913896-39913918 AATCCCCATGTGTTGGGGGAGGG - Intergenic
1053776655 9:41549675-41549697 AATCCCCATGTGTTGGGGGAGGG + Intergenic
1053873279 9:42516659-42516681 AATCCCCATGTGTTGTGGGAAGG - Intergenic
1053902740 9:42811202-42811224 AATCCCCATGTGTGGAGGGAGGG - Intergenic
1054214776 9:62336806-62336828 AATCCCCATGTGTTGGGGGAGGG + Intergenic
1054238407 9:62584992-62585014 AATCCCCATGTGTTGTGGGAAGG + Intergenic
1054262184 9:62878326-62878348 AATCCCCATGTGTTGTGGGAAGG - Intergenic
1054269049 9:62950093-62950115 AATCCCCATGTGTTGTGGGAAGG + Intergenic
1054326128 9:63713482-63713504 AATCCCCATGGGTTGAAGAATGG - Intergenic
1054365073 9:64328810-64328832 AATCCCCATGTGTTGGGGGAGGG - Intergenic
1054552535 9:66619512-66619534 AATCCCCATGTGTTGTGGGAAGG + Intergenic
1054672705 9:67818543-67818565 AATCCCCATGTGTTGGGGGAGGG - Intergenic
1054758993 9:68987889-68987911 AATTCCCATGTGTTGGGAGAAGG - Intronic
1054802223 9:69361772-69361794 AATCCCCAGATGTTCAGAAATGG - Intronic
1055006241 9:71510626-71510648 AATCCCCATGTGCTGAGGGAGGG - Intergenic
1055172222 9:73272717-73272739 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1055180642 9:73381694-73381716 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1055233795 9:74094192-74094214 AATCCCCATGTGTTGAGGGCGGG + Intergenic
1055263983 9:74474756-74474778 AATTCCCATGTGTTGGGGAAGGG + Intergenic
1055519986 9:77071010-77071032 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1055616994 9:78083350-78083372 AATCCCTGCATGTTGAGGAAGGG + Intergenic
1055622382 9:78139789-78139811 AATCCCCATGTGTCGAGGGAGGG - Intergenic
1055665511 9:78549117-78549139 AATCCCCAGGTGTTGAGGGAAGG + Intergenic
1055698493 9:78916060-78916082 AATCCCCATGTGTCCAGGAAAGG + Intergenic
1055701408 9:78948962-78948984 AATCCCCATGTGTTGAGAGTGGG + Intergenic
1055701660 9:78950827-78950849 AATCCCCATGTGTTGGGGGAGGG + Intergenic
1055774594 9:79753731-79753753 AATCCCCATGTGTTGAGGGCAGG - Intergenic
1055806713 9:80104157-80104179 AATCCCCATGTGTTGGGGGAGGG + Intergenic
1055862356 9:80767778-80767800 AATCCCCACGTGTTGTGGAAGGG - Intergenic
1055914147 9:81382979-81383001 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1056118433 9:83463578-83463600 AATCCCCATGTGTTGTGGGAGGG - Intronic
1056238633 9:84621167-84621189 AATTCCCGCGTGTTGTGGAAAGG + Intergenic
1056367024 9:85915842-85915864 AATTCCTGTGTGTTGTGAGAGGG + Intergenic
1056595012 9:88000855-88000877 AATTCCCATGTGTTGTGAAAGGG + Intergenic
1056914956 9:90738348-90738370 AATCCCCATGTGTTGGGGGAGGG + Intergenic
1057084015 9:92192177-92192199 AGTCCCCATGTGTTGAGGGAGGG + Intergenic
1057285224 9:93748318-93748340 AATCCCCATGTGTTGGAAAAGGG - Intergenic
1057400356 9:94717920-94717942 AATCCCCATGTGTGGAGGGAGGG - Intergenic
1058047939 9:100377060-100377082 AATCCCCATGTGTCGAGGGAGGG + Intergenic
1058337886 9:103855519-103855541 AATCCCCATGTGTTGTGGGAAGG + Intergenic
1058823339 9:108753054-108753076 AACCCCCACGTGTTGAGAGAGGG - Intergenic
1058873914 9:109225593-109225615 AATCCCCAAGTGTTGTGGAAAGG - Intronic
1058924391 9:109647988-109648010 AGTCCCCATGTGTTCAGGAAGGG + Intronic
1059023198 9:110598144-110598166 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
1059048560 9:110897182-110897204 AATTCCCATGTGTTGCGGAAGGG + Intronic
1059104020 9:111496173-111496195 AATCCCCACGTGTAGAGAGAGGG + Intergenic
1059408040 9:114114102-114114124 AATCCCCATGTGTCAAGAGAGGG + Intergenic
1059556160 9:115282459-115282481 AATCCCCATGTGATGAGGGAGGG - Intronic
1059563460 9:115358394-115358416 AATCTCCATGTGTTGAGGGAGGG + Intronic
1059563466 9:115358423-115358445 AATCCTCATGTGTTGAGGGAGGG + Intronic
1059674760 9:116527701-116527723 AATCCCCATGTGTTGGGGAGGGG + Intronic
1059716944 9:116921868-116921890 AATCCCCATGTGTCAAGAGAGGG - Intronic
1060007879 9:120016417-120016439 AATCCCTATGTGTTGAGGGAGGG - Intergenic
1060084390 9:120683377-120683399 AATCTCCATGTGTTGAGGGAGGG + Intronic
1060312088 9:122471192-122471214 AATTCCCATGTGTTGTGAGAGGG + Intergenic
1062182935 9:135200599-135200621 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1062511082 9:136906542-136906564 AATCCCCATGTGTTGTGGGAGGG - Intronic
1062632769 9:137473183-137473205 AATCCCCATGTGTTGTGGGAGGG - Intronic
1185926909 X:4157375-4157397 AATCCCCATGTGTCAAGAGAGGG + Intergenic
1185938709 X:4288835-4288857 AATTCCCACGTGTTGAAAAAGGG + Intergenic
1185974971 X:4710208-4710230 AATTCCCTTGTCTTGATAAATGG + Intergenic
1186140172 X:6563533-6563555 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1186143001 X:6596692-6596714 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1186152136 X:6686706-6686728 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1186173948 X:6905628-6905650 AATCCTCATGTGTTGAGGGAGGG - Intergenic
1186372760 X:8964582-8964604 AATCCCCGTGTGTCAAGGGATGG - Intergenic
1186679180 X:11854247-11854269 AATCCCCTTGTGTTGAGGGAGGG - Intergenic
1186831653 X:13396397-13396419 AATTCCCATGTGTTGTGAGAGGG - Intergenic
1186951747 X:14633890-14633912 AATCCCCATGTGTTGGGTGATGG - Intronic
1187133478 X:16525293-16525315 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1187312280 X:18156647-18156669 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1187480487 X:19650527-19650549 AATCCCCATGTGTTGGGGGAGGG - Intronic
1187779578 X:22803973-22803995 AATACCCGTGTGTTGGGGGAGGG - Intergenic
1187927733 X:24265254-24265276 AATCCTCGTGTGTCAAGAGAGGG - Intergenic
1188030301 X:25256148-25256170 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1188041831 X:25377304-25377326 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1188069365 X:25700259-25700281 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1188095438 X:26015696-26015718 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1188106680 X:26155620-26155642 AATTCCTGTGTGTTGAGGGAAGG - Intergenic
1188129589 X:26414801-26414823 AATCCCTATGTGTTGAGGGAGGG - Intergenic
1188259584 X:28007463-28007485 AATCCCCGCATGTCGAGAGAGGG - Intergenic
1188259865 X:28009453-28009475 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1188500701 X:30822603-30822625 AATCCCCATGTGTTGAAGGAGGG - Intergenic
1188510552 X:30931590-30931612 AATCCCCACATGTTGAGGAAGGG - Intronic
1188651665 X:32637837-32637859 AATCCCCATGTGTTGTGGGAGGG - Intronic
1188813299 X:34680038-34680060 AATCCCCGTGTGTCAAGGGAGGG - Intergenic
1188834123 X:34935185-34935207 AATCCCCACGTGTTGGGGAAGGG - Intergenic
1189212357 X:39294578-39294600 AAACCCCGTGTCTTGAAGAAAGG + Intergenic
1189394090 X:40604527-40604549 AATCCCCACGTGTCGAGAGAGGG - Intronic
1189411705 X:40778642-40778664 AATCCCCACGTATTGAGGAAGGG + Intergenic
1189650992 X:43189259-43189281 AATCCCCATGTGTCAAGAGAGGG - Intergenic
1189788568 X:44582230-44582252 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1189956993 X:46286269-46286291 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1190169550 X:48101041-48101063 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1190387727 X:49898836-49898858 AATCCCCATGTGTGGAGGGAAGG + Intergenic
1190750064 X:53354264-53354286 AATCCCCAGGTGTTGAGGGAGGG + Intergenic
1190925483 X:54899814-54899836 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
1190950791 X:55140815-55140837 AATCCCCATGTGTTGAGAGAGGG + Intronic
1191020982 X:55859721-55859743 AATTCCCACGTGTTGAGAGAGGG - Intergenic
1191661168 X:63652780-63652802 AATCCCCATGTGTTGGGGGAGGG + Intronic
1191676333 X:63795718-63795740 AATCCCCATGTGTCAAGAGAGGG - Intergenic
1191680571 X:63835895-63835917 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1192132888 X:68569336-68569358 AATCCCCATGTGTCAAGGAAGGG - Intergenic
1192335784 X:70218081-70218103 AATCCCCATGTGTCGTGGAAGGG + Intergenic
1192856686 X:75019379-75019401 AATTCCCATGTGTTGTGAGATGG - Intergenic
1193079163 X:77388995-77389017 AATTCCCGTGTGTTGTGGGAGGG + Intergenic
1193236506 X:79113800-79113822 AATCCCCACTTGTTGAGGAAGGG - Intergenic
1193285975 X:79714844-79714866 AATCCCCAGGTCTTGAGGAAAGG + Intergenic
1193625367 X:83813789-83813811 AATTCCCATGTGTTGTGAGAGGG + Intergenic
1193814650 X:86090308-86090330 AATCCCCAGATGTTGAGCAAGGG - Intergenic
1193840566 X:86404083-86404105 AATCCCAACGTGTTGTGAAAGGG - Intronic
1193929891 X:87541078-87541100 AATCCCCATGTGTTGAGGGAGGG + Intronic
1194332335 X:92599360-92599382 AATCCCCATGTGTTGTGGGAGGG + Intronic
1194497583 X:94636126-94636148 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1194662238 X:96639957-96639979 AATTCCCATGTGTTGAGAGAAGG + Intergenic
1194843457 X:98774907-98774929 AATCCCCACGTGTTGTGGAAGGG + Intergenic
1194850076 X:98858744-98858766 AATTCCCATGTGTTGTGAGAGGG + Intergenic
1194851304 X:98873002-98873024 AATCCCCATGTGTTGTGAGAAGG + Intergenic
1194905806 X:99575332-99575354 AATCCCCATGTGTTGTGAGAGGG + Intergenic
1194932088 X:99901046-99901068 AATTCCCCTGTCTTGATAAATGG - Intergenic
1194969861 X:100331591-100331613 AATCCCCATGTGTTGAGGGAGGG + Intronic
1195149974 X:102057454-102057476 AATCCCCATGTGTCAAGAGAGGG + Intergenic
1195207060 X:102611606-102611628 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1195529652 X:105939046-105939068 AATCCCCATGTGTTGAGTGAGGG - Intronic
1195863563 X:109406667-109406689 AATCCCCATGTGTTGTGGGAGGG + Intronic
1196012763 X:110905929-110905951 AATCCCCATGTGTTGGGGGAGGG - Intergenic
1196129368 X:112137648-112137670 AATCCCCACGTGTGGAGGAAGGG - Intergenic
1196207456 X:112957069-112957091 AATCCCCATGTGTCAAGAGAAGG + Intergenic
1196223436 X:113138603-113138625 AATCCCCATGTGTTGAGGAAGGG - Intergenic
1196309910 X:114151669-114151691 AACCCCCATGTGTTGAGGGAAGG + Intergenic
1196483482 X:116178738-116178760 AATTCCCTTGTGTTGTGGAAGGG + Intergenic
1196558787 X:117122188-117122210 AATCCCCACGTGTTGTGAGAGGG - Intergenic
1196605535 X:117653708-117653730 AATCCCCATGTGTTGGGGGAGGG - Intergenic
1196930582 X:120677298-120677320 AATCCCCATGTGTTGTGGAAGGG - Intergenic
1196974079 X:121139395-121139417 AATCCCCATGTGTTTTGAGAGGG - Intergenic
1197054157 X:122097096-122097118 AATTCCCATGTGTTGTGGAAGGG + Intergenic
1197057324 X:122136221-122136243 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1197059917 X:122165470-122165492 AATCCCCATGTGTTGAGGGAGGG + Intergenic
1197061242 X:122184242-122184264 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1197392532 X:125884591-125884613 AATCTTCAGGTGTTGAGAAAGGG + Intergenic
1197401920 X:126003298-126003320 AATCCCCAGGTGTTGAGGTAGGG - Intergenic
1197547214 X:127839514-127839536 AATCCCCATGTGTTGTGGGAGGG - Intergenic
1197569370 X:128130541-128130563 AATCCTCATGTGTAGAGGAAGGG + Intergenic
1197569625 X:128132548-128132570 AATCCCCATATGTTGAGGGAGGG + Intergenic
1197649758 X:129051852-129051874 AATCCCCACGTGTTGAGGGAGGG - Intergenic
1197950203 X:131886668-131886690 AATCCCCACGTGTCGAGAGAGGG - Intergenic
1198297399 X:135301236-135301258 AATCCCCATATGTTGAGTGAGGG - Intronic
1198304533 X:135367757-135367779 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1198304812 X:135369731-135369753 AATCCCCATGTGTTGAGGGAGGG - Intergenic
1198457953 X:136835974-136835996 AATCCCCACGTGTTGAGGGAGGG + Intergenic
1198565863 X:137905347-137905369 AATCCCCACGTGTTGGGGAAGGG + Intergenic
1198630245 X:138629413-138629435 AATCCCAATGTGTTGAGGGAGGG + Intergenic
1198803818 X:140474316-140474338 AATCCCCAGGTGTTGAGGGAGGG + Intergenic
1198818943 X:140624707-140624729 AATCCCCATGTGTTGGGGGAGGG - Intergenic
1198991534 X:142520416-142520438 AATCCCCCCGTGTGGAGACAGGG - Intergenic
1199054563 X:143278048-143278070 AATCCCTGTGTGTGGAGGGAGGG + Intergenic
1199062465 X:143375614-143375636 AATCCCCATGTGTCTAGGAAGGG - Intergenic
1199068770 X:143451655-143451677 AATCCCTGTGTGTTAAGTTAGGG - Intergenic
1199137574 X:144271068-144271090 AATCCCCACGTGTTGGGGAAGGG - Intergenic
1199149647 X:144415112-144415134 AATCCCCAGGTGTTGAGGGAGGG - Intergenic
1199309440 X:146306289-146306311 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1199434053 X:147793309-147793331 AATCCTCATGTGTTGAGGGAGGG - Intergenic
1200268696 X:154661141-154661163 AATCCCCATGTGTTAAGGGAGGG + Intergenic
1200304761 X:155013240-155013262 AATCCCCATGTGCTGTGAGAGGG + Intronic
1200319767 X:155175523-155175545 AATTCCCATGTGTTGTGAGAGGG + Intergenic
1200641042 Y:5718411-5718433 AATCCCCATGTGTTGTGGGAGGG + Intronic
1200814955 Y:7521901-7521923 GATCCCCATGTGTAGAGAGAGGG + Intergenic
1201142791 Y:11042489-11042511 AATCCCCATGTATTGAGGGAGGG - Intergenic
1201150388 Y:11092427-11092449 AATCCCCATGGGTTGAAGAAGGG + Intergenic
1201186933 Y:11413861-11413883 AATCCCCAGGTGTTGAGAAAGGG - Intergenic
1201482771 Y:14457863-14457885 AATCCCCATGTGTTGTGGGAGGG + Intergenic
1201504373 Y:14681440-14681462 AATCCCCATGTGTTGGGGGAGGG - Intronic
1201538943 Y:15085246-15085268 AATTCCCAGGTGTTGAGAGAGGG + Intergenic
1201567920 Y:15385804-15385826 AATCCCCATGTGTGGAGGGAGGG + Intergenic
1201646129 Y:16234216-16234238 AATCCCCATATGTTGAGGAAAGG - Intergenic
1201656684 Y:16351097-16351119 AATCCCCATATGTTGAGGAAAGG + Intergenic
1202030723 Y:20571821-20571843 AATCCCCACGTTTTGAGGAAGGG - Intergenic
1202030972 Y:20573681-20573703 AATCCCCATGTGTTAAGGGAGGG - Intergenic