ID: 1158038857

View in Genome Browser
Species Human (GRCh38)
Location 18:53068883-53068905
Sequence AAACCTGCCCCCAGTGTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158038857 Original CRISPR AAACCTGCCCCCAGTGTCTG AGG Intronic
900335936 1:2163462-2163484 GAACCTTCTCCCAGTGGCTGGGG - Intronic
900388083 1:2419684-2419706 AAAGCTGGCCCCCGGGTCTGTGG - Intergenic
900617977 1:3573822-3573844 AATGCTGCCCACTGTGTCTGAGG - Intronic
900887903 1:5428550-5428572 AAACAAGCCCGAAGTGTCTGAGG - Intergenic
901468336 1:9438100-9438122 GAACCTGCAGTCAGTGTCTGTGG + Intergenic
901474743 1:9481744-9481766 AAACCTGCCCCCAAAGTCCAAGG + Intergenic
901765181 1:11495492-11495514 AAAACTGCCCCCAGAATCTGGGG + Intronic
902292185 1:15442594-15442616 CACACTGCCCCCAGTGGCTGTGG - Intronic
902598686 1:17526295-17526317 AAACCTGCCCCTAGTCTGTGTGG + Intergenic
904279207 1:29406950-29406972 AAATCTACGCCCAGTGCCTGAGG + Intergenic
905234862 1:36539078-36539100 AAGCATGCCCACAGTGTCTGAGG - Intergenic
906513397 1:46424129-46424151 CCACCTGCTCCCTGTGTCTGCGG - Intergenic
910536511 1:88304251-88304273 AAAACTACCCCCAATGTCTTTGG + Intergenic
912754659 1:112314164-112314186 CAACCTCCCCTCAGGGTCTGGGG + Intergenic
913362132 1:117993111-117993133 AAGCATGCCTCCAGAGTCTGAGG + Intronic
914455874 1:147835799-147835821 AAACCTGTCCCCAGAGTCTGAGG + Intergenic
915280190 1:154817154-154817176 AAACCTACCCCCAAAGGCTGAGG + Intronic
915791953 1:158681697-158681719 TTCCCTGCTCCCAGTGTCTGTGG - Intronic
917529926 1:175825616-175825638 AAGCCAGCCCCCATGGTCTGAGG - Intergenic
919806433 1:201383442-201383464 AGGCCTGCCCCCAGGGCCTGAGG + Intronic
922481428 1:225942052-225942074 CAATCTGCCCCCAGTACCTGTGG - Intergenic
922481640 1:225943431-225943453 CAATCTGCCCCCAGTACCTGTGG + Intergenic
923106371 1:230856987-230857009 GCATTTGCCCCCAGTGTCTGAGG - Intronic
923263897 1:232294004-232294026 ATAGTTGCCCCCAGTATCTGTGG + Intergenic
1064303671 10:14145805-14145827 GAACATGCCCCCAGTGTTTTTGG - Intronic
1065884707 10:30066768-30066790 ACACCTGCCTCAAGTGACTGAGG + Intronic
1069584010 10:69585020-69585042 AAACCTACCCCCAAAGGCTGAGG - Intergenic
1069639781 10:69947191-69947213 AAACCTGTCTCCAGTGAGTGAGG + Intronic
1070530318 10:77331225-77331247 AGACCTGCTGCCAGTGTCAGAGG - Intronic
1071002685 10:80848207-80848229 AAGCCTACCCCCAAAGTCTGAGG - Intergenic
1071560917 10:86646323-86646345 AGACCTGCCGCCAGATTCTGTGG - Intergenic
1072234916 10:93445604-93445626 CAACCCGCTCCCAGTGCCTGAGG + Intronic
1073875584 10:107918144-107918166 AAACCATCCCCCACTGTCCGAGG - Intergenic
1076510979 10:131013323-131013345 ATACCTGCCCCCGGTGCCTGGGG + Intergenic
1077479304 11:2806092-2806114 AAACATGGTCCCAGTTTCTGGGG + Intronic
1080677818 11:34444036-34444058 AAACCTACCCCCAAAGTCTGAGG + Intronic
1081994210 11:47353051-47353073 CACCCTGGCCCCAGGGTCTGTGG - Intergenic
1083263723 11:61536651-61536673 AGACCTGACCCCACTCTCTGGGG + Intronic
1083326456 11:61875607-61875629 AAACCTACCCCCAAAGGCTGAGG - Intronic
1083349514 11:62017406-62017428 AAACCTATCCCCAGAGTCTAAGG + Intergenic
1083742173 11:64716800-64716822 GAAGCTGCCCCAAGGGTCTGTGG - Intronic
1083998259 11:66282818-66282840 AGCGCTGCCCCCACTGTCTGTGG + Intronic
1085055264 11:73399454-73399476 AAACCCACCCCCAGTGTCCGAGG - Intergenic
1085411786 11:76295681-76295703 AAACCTGTCCCCAGTGTCCGAGG - Intergenic
1087403324 11:97696131-97696153 ATACCTGCCCCCAATTTCTTTGG + Intergenic
1088706855 11:112471584-112471606 AACCTTGCCCTAAGTGTCTGTGG - Intergenic
1088975758 11:114815052-114815074 AAACCTGCCCCTATTTTCAGAGG + Intergenic
1089911348 11:122103937-122103959 ACACCTGACCCCAATTTCTGTGG + Intergenic
1090154183 11:124420136-124420158 AAACCTGCCCTCAATGTGAGTGG - Intergenic
1090258005 11:125299279-125299301 AAATGTGACCCCAGTGTCGGAGG - Intronic
1090590236 11:128259497-128259519 AAAGCTGGCCTCAGTGTGTGTGG + Intergenic
1092455588 12:8639741-8639763 AAACCTACCCCCAAAGGCTGAGG - Intronic
1095492360 12:42747978-42748000 AAACCTACCCACAAAGTCTGAGG - Intergenic
1095776153 12:46012231-46012253 AAAGCTGCCCCCACTGCCTTTGG + Intergenic
1096429016 12:51527992-51528014 AAACCTGCCCCTGGATTCTGGGG + Intergenic
1096662389 12:53134437-53134459 AATCCTGCCAGCAGTGTATGAGG + Intergenic
1097852752 12:64429299-64429321 AGACCTGCCCTCAGTGTTGGCGG - Intronic
1100351540 12:93788453-93788475 ACACCTGACCACAGTGTGTGTGG + Intronic
1102083726 12:110119041-110119063 AAACCTACCCCCAAGGTCTGAGG - Intergenic
1103900511 12:124301416-124301438 AAAGCTGCCCCCAGTCTGTCTGG - Intronic
1103933403 12:124462571-124462593 AAAACTGCCCCCAGGGTCCAGGG - Intronic
1104537532 12:129632247-129632269 AATCCTGCCCTCGGTGGCTGAGG + Intronic
1104919098 12:132281309-132281331 AGCCCTGCCCACAGTCTCTGAGG - Intronic
1107073205 13:36294376-36294398 GAGCCTGCCCCCAGAGACTGAGG + Intronic
1107994158 13:45844296-45844318 AAAGCTGCCCTCAGTGTTGGTGG + Intronic
1108258475 13:48633117-48633139 AAACCTCCCTCCCATGTCTGAGG + Intergenic
1112128137 13:96492542-96492564 AAATGTAGCCCCAGTGTCTGCGG + Intronic
1113675735 13:112206066-112206088 AATCATGTCCCCCGTGTCTGTGG + Intergenic
1117289543 14:54319335-54319357 AAACCTGACTCCAATATCTGTGG - Intergenic
1118368549 14:65116156-65116178 AAACCTACCCCCAAAGACTGAGG - Intergenic
1118716931 14:68566668-68566690 AAGCATGCCCCCAGTCACTGAGG - Intronic
1119416706 14:74475500-74475522 AAACCTCCCCACAGATTCTGGGG + Intergenic
1119864798 14:77964656-77964678 ACACCTGTCTACAGTGTCTGTGG + Intergenic
1121773551 14:96574488-96574510 ACGCCTTCCCCCAGTTTCTGAGG + Intergenic
1121819426 14:96954282-96954304 GAACCATCACCCAGTGTCTGTGG + Intergenic
1121991935 14:98566604-98566626 AAAAATGCCTCCAGTGCCTGTGG + Intergenic
1122370680 14:101227407-101227429 AAACCTGCCCAGATTGTCCGGGG - Intergenic
1123767683 15:23497745-23497767 AAACCTACCCTCAGAGGCTGAGG + Intergenic
1125763413 15:42115300-42115322 AAAACTGGCCACAGGGTCTGTGG - Intergenic
1126179556 15:45771641-45771663 AAACCTGCCCTCAGTGCCTCTGG + Intergenic
1126544658 15:49860221-49860243 AAAGCTGCTCACGGTGTCTGTGG + Exonic
1128861392 15:71076975-71076997 AAACCTGCCCGCAAAGGCTGAGG + Intergenic
1129253414 15:74320730-74320752 AACCCTGCCCTCTGTGTCTCAGG + Intronic
1129680643 15:77656710-77656732 GAAGCTGCCCCCAGTGTGTTAGG + Intronic
1130137127 15:81190660-81190682 AAACCTACCCCCAAAGGCTGAGG + Intronic
1131059047 15:89393161-89393183 AGACCTGCCACCAGGCTCTGGGG + Intergenic
1131878660 15:96838803-96838825 CAACCTGCCCTCAGTGTCCTTGG + Intergenic
1131962979 15:97808539-97808561 AAACTAGCCCCCACTGTGTGTGG - Intergenic
1132674087 16:1114540-1114562 ACCCCTGCCCCCAGTGGCTCAGG - Intergenic
1134106552 16:11489534-11489556 AACCCTCCCCCCATTGTCTCAGG + Intronic
1134399274 16:13893796-13893818 AAACCCGCCCCCAAAGTCTGAGG - Intergenic
1135743777 16:24998467-24998489 CCACCTTTCCCCAGTGTCTGAGG - Intronic
1135752583 16:25068832-25068854 CCACCTTTCCCCAGTGTCTGAGG + Intergenic
1136506955 16:30710558-30710580 AATCCTGGCCCCACTGCCTGGGG - Intronic
1137498914 16:48995598-48995620 CAGGCTGCCCACAGTGTCTGGGG + Intergenic
1138134246 16:54507845-54507867 ACACCTGCCCCAAGAGCCTGTGG - Intergenic
1138541215 16:57688912-57688934 AAACAAACCCCCAGTGCCTGAGG - Exonic
1139691876 16:68646358-68646380 CACCCCGCCCCCAGCGTCTGGGG + Intronic
1141900826 16:86989118-86989140 AGACCTGCCCCCAGTGCCGGGGG - Intergenic
1144483500 17:15646311-15646333 AACCCTGAAGCCAGTGTCTGAGG - Intronic
1144915187 17:18718716-18718738 AACCCTGAAGCCAGTGTCTGAGG + Intronic
1145189108 17:20822891-20822913 ACACCCGGCCCCAGTTTCTGGGG + Intergenic
1147696794 17:42361159-42361181 AAACCTGGTCCCACTGTCAGAGG - Intronic
1147704559 17:42417001-42417023 AGACCTGCTCCAAGTGCCTGGGG - Intronic
1148547995 17:48531392-48531414 AAACCTTCCCCCTAAGTCTGTGG + Intergenic
1152455091 17:80410517-80410539 AAGCCTGGCCCCCGTGTCTAAGG + Intergenic
1153884265 18:9448946-9448968 AAACCTGCTCCCAAAGACTGAGG + Intergenic
1156899414 18:42284031-42284053 ATACCTGCTCCCAATGTTTGCGG + Intergenic
1157260909 18:46174623-46174645 CAACCCGGCCCCAGCGTCTGGGG - Intronic
1158038857 18:53068883-53068905 AAACCTGCCCCCAGTGTCTGAGG + Intronic
1159235973 18:65673241-65673263 CAACTAGGCCCCAGTGTCTGTGG - Intergenic
1159518360 18:69487426-69487448 AAATCTGCCCCCAGTGTGTGAGG + Intronic
1160002400 18:75038312-75038334 AAACTTCCCCATAGTGTCTGAGG + Intronic
1160210573 18:76874783-76874805 AAACCTGCCTGGTGTGTCTGAGG + Intronic
1162736517 19:12750045-12750067 AAGCCTGCCCCCAGCCCCTGCGG + Intergenic
1163354048 19:16798110-16798132 AAATCTGCCCCCAAGGTTTGAGG - Intronic
925627503 2:5855841-5855863 GACCCTGCCCACCGTGTCTGAGG - Intergenic
926139550 2:10360059-10360081 AAAGCTCTCCCCAGGGTCTGAGG - Intronic
926197491 2:10772683-10772705 AAACATGCCCCGAGGGTGTGAGG + Intronic
927005094 2:18840230-18840252 AAACACTCCCCCAGTCTCTGAGG - Intergenic
927242770 2:20933021-20933043 AAATCTGGCCAAAGTGTCTGTGG - Intergenic
927284440 2:21341880-21341902 AAAACAGTCCCCAGTGTGTGAGG - Intergenic
930025919 2:47029096-47029118 CTCCCTGCCCCCAGTGCCTGGGG + Intronic
930725453 2:54677245-54677267 AAACCTGTCCACAGAGGCTGTGG - Intergenic
931798651 2:65736804-65736826 AAATCTTCCCCCAGTGTGAGTGG + Intergenic
933222752 2:79709665-79709687 AAACATGCCCACAGTTTCTGAGG - Intronic
933261766 2:80139141-80139163 AAATCTTCCTCCAGAGTCTGTGG - Intronic
934156976 2:89211943-89211965 AAACTTGACCCCAATGCCTGAGG + Intergenic
934210341 2:89970803-89970825 AAACTTGACCCCAATGCCTGAGG - Intergenic
935782506 2:106520423-106520445 CCACCTACCCCCAGTGTCTCTGG - Intergenic
938728306 2:134126042-134126064 AGACATTCCCGCAGTGTCTGCGG + Intronic
938940000 2:136161702-136161724 AAACCTACCCCTAAAGTCTGAGG + Intergenic
939743132 2:145935209-145935231 TAACCTGCTCCCAGGATCTGGGG - Intergenic
940504785 2:154539297-154539319 AAACCTACCCCCAAAGTCTGAGG - Intergenic
941818480 2:169822303-169822325 AAAACTGTGCCCAGTCTCTGAGG + Intronic
942211368 2:173674471-173674493 AAACCTACCCCCAAGGTCTGAGG + Intergenic
942326665 2:174781921-174781943 AAAGCTGCAGCCAGGGTCTGGGG + Intergenic
943603463 2:189949152-189949174 AAGCCGGCCCTCAGTATCTGCGG + Intronic
947268326 2:228306116-228306138 AGACCTGCCCCCAGAGGCAGAGG - Intergenic
947365875 2:229394458-229394480 AAACCTGCCCCCAAAGTCTGAGG - Intronic
947366184 2:229396977-229396999 AAACCCACCCCCAAAGTCTGAGG - Intronic
948382662 2:237561595-237561617 AAAGCTGCCCCCAGGTCCTGGGG + Intergenic
948569152 2:238906711-238906733 CATCCTCCCCCCAGTGCCTGGGG + Intronic
1168893092 20:1307030-1307052 AAACTTGCCCCGAGTTTCTCTGG + Exonic
1170093854 20:12622786-12622808 AAACCTACCCCCAAAGGCTGAGG + Intergenic
1172441119 20:34967449-34967471 AAACCTACCCAGAGGGTCTGAGG - Intergenic
1172772562 20:37389983-37390005 AAAGCTGCCTCCGGTGGCTGCGG - Intronic
1173141843 20:40491617-40491639 AATCCTGCCACCAGTGAGTGGGG - Intergenic
1173730421 20:45324678-45324700 CAACCTGCCCCTAGTGTGTCTGG - Intergenic
1175089594 20:56491003-56491025 AAGGGTGCCCCAAGTGTCTGCGG - Intronic
1175976115 20:62711236-62711258 CTGCCTGCCACCAGTGTCTGTGG - Intronic
1176171597 20:63698839-63698861 ACCTCTGCCCCCAGTGGCTGTGG + Exonic
1176218401 20:63958814-63958836 TAACCTGCCCCCATTGTTTCTGG - Exonic
1178973286 21:37200226-37200248 GAACTTGCACCCAGTGCCTGTGG - Exonic
1179109907 21:38437569-38437591 GTTCCTGTCCCCAGTGTCTGGGG + Intronic
1179372514 21:40819362-40819384 TAGACTGCCCCCACTGTCTGGGG - Intronic
1179475220 21:41638824-41638846 AAACCTACCTCCAAAGTCTGAGG + Intergenic
1180205773 21:46259135-46259157 AAGCAAGCCCTCAGTGTCTGTGG - Intronic
1180787498 22:18554990-18555012 GGGCCTGCCCTCAGTGTCTGGGG - Intergenic
1181234241 22:21440315-21440337 GGGCCTGCCCTCAGTGTCTGGGG + Intronic
1181244406 22:21494516-21494538 GGGCCTGCCCTCAGTGTCTGGGG - Intergenic
1181396513 22:22626871-22626893 AAACCTGCACCCCATGTGTGGGG + Intergenic
1181627722 22:24133018-24133040 GAGCCTGCCTCCAGGGTCTGAGG + Intronic
1183335483 22:37243818-37243840 AGACCTGCCCCCAGCTTTTGGGG + Intronic
1184168652 22:42745504-42745526 AAACCTGCCCCAAAAGTCTAAGG - Intergenic
1184246900 22:43240440-43240462 ACACCTTCCCTCCGTGTCTGGGG - Intronic
1184325192 22:43777626-43777648 CCTCCTGCCCCCAGTGTCAGAGG + Intronic
1184864926 22:47197086-47197108 AAACCTCACTCCAGTTTCTGGGG + Intergenic
950188326 3:10958961-10958983 AAACCTGGCTCCAGAGCCTGAGG - Intergenic
953395156 3:42563296-42563318 CACCCTGCCCCCAGGCTCTGTGG + Intronic
954601050 3:51869654-51869676 AAACCTGTCCCCAAAGTCTGAGG - Intergenic
955475182 3:59329085-59329107 AAGTCTGGCCCCAGAGTCTGTGG - Intergenic
956701933 3:71966408-71966430 AATGCTGCCCCCAGTGAATGTGG + Intergenic
956886914 3:73569606-73569628 AAACCTCAGCCCTGTGTCTGGGG + Intronic
958960309 3:100503474-100503496 AAACTTGCCCCAAGTGGATGAGG - Intronic
963659496 3:148106096-148106118 AAACCTGACCTCACTGTTTGGGG - Intergenic
964641164 3:158911950-158911972 AAACCTGACACCAGTGTTGGTGG + Intergenic
965820824 3:172682574-172682596 AAACCTACCCCCAAAGTCCGTGG - Intronic
969008048 4:4037566-4037588 AAAGCTGTCCCCAGTGTTAGAGG + Intergenic
969543710 4:7810430-7810452 AAAGCAGCCCCAAGTGTCTGAGG + Intronic
972681583 4:41311500-41311522 AAACCTGCCCCCAAAGTCCAAGG - Intergenic
978958612 4:114646876-114646898 AAGCCTGTCCCCAGTGATTGTGG - Intronic
980434568 4:132752236-132752258 AAACCTGCCCAAAGTTTCTCAGG + Intergenic
980870512 4:138606467-138606489 AAACCTGCCCCTAATGGTTGAGG - Intergenic
981531893 4:145761684-145761706 ACACCACCCCCCAGTGTCTGAGG + Intronic
982898238 4:160961929-160961951 AAGTCTGCCCTCCGTGTCTGTGG + Intergenic
983410166 4:167386084-167386106 AGACTTGCCCTCACTGTCTGGGG - Intergenic
984869042 4:184310774-184310796 AAGCCTGCCACCAGTCTCTCTGG - Intergenic
984941741 4:184938806-184938828 AAACCATCCCCCATTGTCTGTGG - Intergenic
985632579 5:1021763-1021785 GAACCTGCCACCGGCGTCTGCGG - Intronic
985889439 5:2704351-2704373 AAACCTTCCCCCAAACTCTGAGG - Intergenic
988792431 5:34620839-34620861 AAATCTTCCCACAGTGTCTCTGG - Intergenic
990992814 5:61701821-61701843 AAATCTGCCCCCAGCATCCGAGG + Intronic
991948129 5:71920814-71920836 AAACCTGCCCCCAAAGTCCATGG - Intergenic
993922115 5:93818226-93818248 AATCCTGCCAGCAGTGTATGAGG - Intronic
994604394 5:101948925-101948947 AAACCTGACCCCAAAGTCTGAGG + Intergenic
995790939 5:115885593-115885615 AAACCTGCCCTCAATGTGGGTGG - Intronic
998434392 5:142095215-142095237 AAAACTTCCCCGAGTTTCTGTGG + Intergenic
998667862 5:144318702-144318724 AAGCCTGCCCTCTGTGACTGCGG + Intronic
998667960 5:144320351-144320373 AAGCCTGCCCTCTGTGACTGCGG + Intronic
998891566 5:146751766-146751788 AGACCTGCCCCCACCCTCTGGGG - Intronic
999324853 5:150637589-150637611 AAACCTGCCCCCAACCCCTGCGG - Intronic
999421912 5:151451822-151451844 AAAGCTGGCCCCAGAGCCTGGGG - Intronic
1001308153 5:170590739-170590761 CAAACAGCCCCAAGTGTCTGTGG + Intronic
1002791156 6:438792-438814 ACACCTGCCCTCTGTGGCTGGGG + Intergenic
1002863468 6:1100577-1100599 AAACGTGACCCCGGTGTCTCAGG + Intergenic
1003383377 6:5645469-5645491 AAACCTGGCCCGACTGTGTGTGG - Intronic
1005880140 6:30050850-30050872 ATTCCTGCCAGCAGTGTCTGAGG - Intergenic
1006006085 6:31002714-31002736 AAACCTTCCCCCAAAGACTGAGG - Intergenic
1006109152 6:31734471-31734493 CCACCTGTCCTCAGTGTCTGGGG - Intronic
1006400062 6:33812582-33812604 AAATGTGTCCCCAGTCTCTGGGG - Intergenic
1015555773 6:134459869-134459891 AAACCTGGGGCCAGTGTGTGTGG - Intergenic
1016744743 6:147566633-147566655 AAACCTTCTCTCTGTGTCTGTGG + Exonic
1016850090 6:148610196-148610218 AAACCCAGCCACAGTGTCTGTGG - Intergenic
1018392711 6:163352609-163352631 AAACCATCCTCCAGGGTCTGCGG - Intergenic
1018582700 6:165321180-165321202 AAACCTGGCCCAAGTGACCGTGG - Intergenic
1019099330 6:169615390-169615412 CAAGCAGACCCCAGTGTCTGTGG + Intronic
1019130681 6:169871277-169871299 ATGCCCGCCCACAGTGTCTGAGG + Intergenic
1019305891 7:335603-335625 AAACCTGCAGCCAGGGCCTGGGG - Intergenic
1019967488 7:4511784-4511806 AAACCTGGCCACACTCTCTGTGG + Intergenic
1020051804 7:5086697-5086719 AGACCTGCCCCCAGGATCTTAGG + Intergenic
1020328569 7:6995697-6995719 AAAGCTGTCCCCAGTGTTAGAGG + Intergenic
1023642824 7:42277876-42277898 ATTCCAGCCCCCAGTGCCTGTGG - Intergenic
1024369326 7:48562005-48562027 TAAGCAGCCCCCAGTGTTTGAGG + Intronic
1024571068 7:50723244-50723266 ACACCTGACCCCTCTGTCTGTGG - Intronic
1025973494 7:66350356-66350378 AAGCCAGCCCCCATTGACTGGGG + Intronic
1029658270 7:101941901-101941923 AAACCTTTCCCTTGTGTCTGTGG - Intronic
1029702432 7:102256186-102256208 AGACCCTTCCCCAGTGTCTGAGG + Exonic
1031532639 7:122894952-122894974 ATCCCTGCCCCCACCGTCTGTGG - Intergenic
1032261504 7:130341035-130341057 AAACCTGCCCCCAAAGTCTTAGG - Intergenic
1034900476 7:154905257-154905279 ACTCCTGACCCCAGAGTCTGGGG - Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1036128061 8:6082054-6082076 AGACCTGCCCTCAGTGTGGGTGG + Intergenic
1036249394 8:7148613-7148635 AAAGCTGTCCCCAGTGTTAGAGG + Intergenic
1036368055 8:8138432-8138454 AAAGCTGTCCCCAGTGTTAGAGG - Intergenic
1036882829 8:12527215-12527237 AAAGCTGTCCCCAGTGTTAGAGG + Intergenic
1037699682 8:21263182-21263204 ATACCAGCCCCCAGCTTCTGTGG - Intergenic
1039417673 8:37409540-37409562 AGACCTGCCCTCAGTGTGGGGGG + Intergenic
1041914838 8:63128284-63128306 AATCTTGCGCCCAGTGCCTGAGG - Intergenic
1044739290 8:95309310-95309332 AAACCTGCCAACAGCCTCTGAGG - Intergenic
1046646893 8:116794996-116795018 AAAACAGGCCCCAGTGTATGTGG + Intronic
1046891534 8:119427224-119427246 ATACTTGGCCTCAGTGTCTGTGG - Intergenic
1048136018 8:131747113-131747135 CAAGCAGTCCCCAGTGTCTGTGG - Intergenic
1048535610 8:135291510-135291532 AAACCTGCCCTTAGTGTAGGTGG + Intergenic
1049042411 8:140122720-140122742 AAAGCTGCCTCAGGTGTCTGAGG + Intronic
1049049865 8:140185925-140185947 ATTCCTACCCTCAGTGTCTGGGG - Intronic
1049634019 8:143676444-143676466 AAGCCTGGCCCCCGTGTCTAAGG + Intergenic
1049966296 9:783392-783414 AAACCTACCCTCAAAGTCTGAGG + Intergenic
1050577298 9:7010592-7010614 AAAGCTGCACCCAGTGTCTAGGG - Intronic
1052283015 9:26754369-26754391 AAACCTACCCCCAAAGTCTGAGG - Intergenic
1057126330 9:92618865-92618887 AACCCTGCACCCAGTATTTGCGG - Exonic
1057215518 9:93226118-93226140 CCACCTGCGCCCAGTGTCTCTGG + Intronic
1060859571 9:126943641-126943663 AAACCTGCACCCAGTTTCTAAGG - Intronic
1060915791 9:127389565-127389587 AGACCTGCCCCCACTGTCTAGGG - Intronic
1061590576 9:131595053-131595075 AAACCTGCCCCGCATGTCAGCGG - Intronic
1061857340 9:133449519-133449541 ACCCCTGCCCCCACTGTCTCTGG + Intronic
1062029258 9:134354766-134354788 AAACCTGCCTCCGCTGTCTTTGG + Intronic
1185929392 X:4185486-4185508 AATCCCGCCACCACTGTCTGTGG - Intergenic
1186510932 X:10129318-10129340 AAATCTGCCCTCTGTGTCTATGG + Intronic
1186730854 X:12407974-12407996 AAACCTACCCCCAAAGTTTGAGG + Intronic
1189466917 X:41284408-41284430 AAACCTTCCAGCACTGTCTGTGG - Intergenic
1189948438 X:46203948-46203970 AGCTCTGCCCCCAGTCTCTGGGG + Intergenic
1194894944 X:99429253-99429275 ACACCTGCTGTCAGTGTCTGTGG - Intergenic
1199883862 X:151999516-151999538 AAACCATTCCCCACTGTCTGTGG - Intergenic