ID: 1158046326

View in Genome Browser
Species Human (GRCh38)
Location 18:53159640-53159662
Sequence ATATAGATACAGATAGATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 403}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158046326_1158046330 30 Left 1158046326 18:53159640-53159662 CCCCAATCTATCTGTATCTATAT 0: 1
1: 0
2: 7
3: 52
4: 403
Right 1158046330 18:53159693-53159715 GTGGTTTCTATAATCTATAATGG 0: 1
1: 0
2: 0
3: 13
4: 180
1158046326_1158046329 11 Left 1158046326 18:53159640-53159662 CCCCAATCTATCTGTATCTATAT 0: 1
1: 0
2: 7
3: 52
4: 403
Right 1158046329 18:53159674-53159696 TATGCATATATGTAAAAGTGTGG 0: 1
1: 0
2: 5
3: 47
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158046326 Original CRISPR ATATAGATACAGATAGATTG GGG (reversed) Intronic
901249754 1:7768530-7768552 AGGTAGATACAAAAAGATTGTGG + Exonic
902665913 1:17938034-17938056 AAACAGACACAGAGAGATTGTGG + Intergenic
904147336 1:28403768-28403790 CTATAGAGACAGAAAGTTTGCGG - Intronic
905465590 1:38150860-38150882 ATATAGATATAGATATATAAAGG - Intergenic
907371451 1:54006199-54006221 ATATACATAAATAAAGATTGTGG + Intergenic
907908389 1:58805916-58805938 ATATAGATACATATCGATTACGG + Intergenic
908070792 1:60457170-60457192 ATATTTATACATATAGATAGAGG + Intergenic
908589519 1:65614735-65614757 ATATAGATATAGCTAGATTCTGG + Intronic
909322866 1:74312178-74312200 ATACAAATACAGAGAAATTGTGG + Intronic
910946627 1:92599521-92599543 ATATAAATATAGATATATAGAGG - Intronic
911300007 1:96160688-96160710 ATATATATACATATATATTAAGG + Intergenic
911809996 1:102264084-102264106 ATATATATGTACATAGATTGAGG - Intergenic
912167000 1:107053812-107053834 ATCCAGATATAGATAGAATGTGG - Intergenic
912890322 1:113523278-113523300 AAATTGATACTGGTAGATTGGGG + Intronic
913399573 1:118414911-118414933 ATATTGATACAGTTAGGTTCAGG - Intergenic
913479939 1:119278327-119278349 ATATAGAGACAGACAGATGATGG - Intergenic
915800888 1:158792079-158792101 AGTTAGATACAGATATATTTAGG + Intergenic
916590693 1:166187199-166187221 ATATAGATAAATATAGATAGTGG - Intergenic
916637398 1:166687724-166687746 ATAAAGTTGAAGATAGATTGTGG - Intergenic
917982710 1:180281483-180281505 AAATACATGCAGATACATTGAGG - Intronic
919153368 1:193728761-193728783 ATATATATACATATATATTTAGG + Intergenic
919224956 1:194685644-194685666 AGAAAGATACAGATAAATAGTGG - Intergenic
919300733 1:195761785-195761807 ACATAGATAGTGATAGTTTGAGG - Intergenic
919406959 1:197197333-197197355 ATATAGATATAGATACACTAAGG + Intronic
919574436 1:199289859-199289881 ATATAGATACATCTTGATTGGGG - Intergenic
919842131 1:201617193-201617215 AGAGAGAGACAGAGAGATTGGGG - Intergenic
921050478 1:211507715-211507737 ATATATATAGAAATAGAGTGTGG + Intergenic
921605347 1:217145716-217145738 ATATGGCTACACATAGTTTGGGG - Intergenic
923410408 1:233702510-233702532 ATTTTGATCCAGATAGAATGAGG + Intergenic
923734305 1:236588720-236588742 ATATAGATAGGGATATATTCAGG - Intronic
923822796 1:237464582-237464604 AGATAGAAACAGAGAGCTTGAGG - Intronic
1063178952 10:3578960-3578982 AGATAGATATAGATACATAGTGG + Intergenic
1063835674 10:10008862-10008884 AAATAGATACTGATAGAATAGGG - Intergenic
1066286117 10:33967889-33967911 ACATAGATAAAGTTAGATTCTGG - Intergenic
1066532164 10:36352755-36352777 AGATAGATATAGATAGATATAGG - Intergenic
1068395024 10:56449006-56449028 ATAGAGATAGAGATAGCTAGAGG - Intergenic
1068733176 10:60382790-60382812 ATATATATATATATAGATTTAGG - Intronic
1069207408 10:65708407-65708429 ATAAAGAAAGAGAGAGATTGAGG - Intergenic
1070510282 10:77154640-77154662 ATAGAGATACAGATATATAGAGG + Intronic
1070939332 10:80329536-80329558 ATATAGAGACAGACATTTTGAGG - Intergenic
1070985509 10:80686582-80686604 ATATAGGGACAGATAGAAGGAGG + Intergenic
1071036173 10:81248561-81248583 ATATAGATACAGATATATGCAGG - Intergenic
1071171894 10:82876345-82876367 ATATAGTGATAGATAGATTTGGG + Intronic
1071267519 10:83977376-83977398 ATATAGATATAGATAGATAAAGG + Intergenic
1071409209 10:85371396-85371418 ATATAGTTACTGATAAAATGAGG - Intergenic
1072977463 10:100071467-100071489 ATAGAGATGCAGACAGACTGGGG - Intronic
1073739267 10:106387525-106387547 ATATTGATCAAGATAGACTGGGG - Intergenic
1074798602 10:116975784-116975806 GTATATATACATATAGATTCTGG - Intronic
1075012209 10:118883511-118883533 ACAAAAATACAGATAGATGGAGG + Intergenic
1075995447 10:126873117-126873139 AAATGGATACAGAGAGAATGAGG + Intergenic
1076017470 10:127039721-127039743 ATAGGGATGCTGATAGATTGTGG + Intronic
1076308505 10:129483900-129483922 ATATAGATATAGATACCTTGGGG + Intronic
1076367434 10:129931051-129931073 ATATAGATACAGATATATGGGGG - Intronic
1077821537 11:5747503-5747525 ATATATATACACATACATTGTGG - Intronic
1078827481 11:14943145-14943167 ATATAGATCCAGAAGGATTCTGG - Intronic
1078958094 11:16226666-16226688 ACATAGATACAGATGGGTTATGG + Intronic
1079173422 11:18117437-18117459 ATATATATACAGATATATAGTGG - Intronic
1079850885 11:25532756-25532778 ATATAGATACAAATATAATTAGG - Intergenic
1081073501 11:38640640-38640662 AGATAGAGAGAGAAAGATTGAGG - Intergenic
1081192667 11:40122876-40122898 ATATATATATAGATAGATATAGG + Intronic
1086171888 11:83845497-83845519 ATACAGATACACAAAGATAGAGG + Intronic
1086218580 11:84413214-84413236 ATATAGATAAGGAGAGATAGAGG - Intronic
1087206157 11:95397064-95397086 ATATATATAGAGAGAGATAGAGG + Intergenic
1087377439 11:97362531-97362553 AAGTAGCTACAGGTAGATTGTGG - Intergenic
1088826922 11:113503675-113503697 ATATATATATATATATATTGAGG - Intergenic
1090133092 11:124166279-124166301 ATATATATATATATATATTGCGG + Intergenic
1090759552 11:129824348-129824370 AAACAGATACAGACATATTGTGG - Intronic
1091882006 12:3986878-3986900 ATATAGATAGATATAGATGTAGG + Intergenic
1093787616 12:23210821-23210843 ACATAGATACTGAAAGAGTGTGG - Intergenic
1094101032 12:26762783-26762805 ATATAAATATATATAAATTGTGG + Intronic
1094181924 12:27600884-27600906 ATTTGGATACATATATATTGTGG + Intronic
1095199836 12:39370795-39370817 ATATATATACATATATATTGTGG - Intronic
1096942990 12:55369124-55369146 AGATAGATAAAGAGAGATAGAGG + Intergenic
1097212330 12:57381776-57381798 ATATACATACATATAGAGAGAGG + Intronic
1097283346 12:57859504-57859526 ATATTGAAACAGAAAGATTCTGG - Intergenic
1098602472 12:72348132-72348154 ATATATATACACACACATTGTGG + Intronic
1098792284 12:74838592-74838614 ATATAGGTACAAATAGATTAGGG + Intergenic
1099266840 12:80457956-80457978 ATATAGATACATATTAATGGGGG - Intronic
1100512524 12:95290852-95290874 ATATATCTACATATATATTGTGG + Intronic
1102014947 12:109642079-109642101 ATATATATATATATAGACTGAGG - Intergenic
1102291468 12:111703898-111703920 ATATATATATATATAAATTGTGG - Intronic
1102671957 12:114627454-114627476 ATATAGATAGATATAGATCTAGG - Intergenic
1103189849 12:118992035-118992057 AAATAAATACACATATATTGGGG + Intronic
1103831926 12:123787097-123787119 ATATAGATACAGATATAGACAGG - Intronic
1106047318 13:26155290-26155312 ATGTAGATGCAGATAGATTTAGG - Intronic
1107367950 13:39706283-39706305 ATATATATAGAGAGAGAATGAGG + Intronic
1107784518 13:43941708-43941730 ATAGAGAGATAGATAGATAGAGG - Intergenic
1107866481 13:44708084-44708106 ATAAATATACAGATAGATCAGGG - Intergenic
1108994776 13:56714569-56714591 ATATAGATACTAATTTATTGTGG - Intergenic
1109139563 13:58697325-58697347 ATATAGATACAGATAACATTTGG - Intergenic
1110528989 13:76574732-76574754 ACATAGATAGAGATAGCTTAAGG + Intergenic
1110537004 13:76662650-76662672 ATACAGAAATAGATAGATTGTGG + Intergenic
1110909177 13:80933745-80933767 ATATAGATATCAATAAATTGTGG - Intergenic
1111025400 13:82514503-82514525 ATATAGATAAATATATATTTTGG - Intergenic
1111276102 13:85949449-85949471 GTATATATACAGAGAGAGTGAGG + Intergenic
1111378103 13:87407667-87407689 ATACAGATGCAGATATATTTAGG + Intergenic
1111570907 13:90084770-90084792 ATATAGATGTAGGTAGATAGAGG - Intergenic
1113172608 13:107522466-107522488 ACATATATACAGATAAATTCTGG - Intronic
1114275262 14:21137380-21137402 ATATATATACAGAGAGACAGCGG - Intergenic
1114506756 14:23221269-23221291 ATACAGATACACATAGATAAAGG + Intronic
1115124772 14:29978538-29978560 ATATGGATAAAGATATATTAAGG + Intronic
1115197580 14:30818012-30818034 AAATAGACACAAATATATTGTGG + Intergenic
1115781081 14:36768954-36768976 ATATAGATATAGATAGATATAGG - Intronic
1116134676 14:40907091-40907113 ATATATATATATATAGATTATGG - Intergenic
1117091419 14:52254618-52254640 ATATAGAGACAGATGTTTTGAGG - Intergenic
1118066522 14:62198172-62198194 ATATATAATCAGATATATTGTGG + Intergenic
1118233383 14:63975804-63975826 ATAAAGATACAGAAAGCTTCTGG - Intronic
1118504061 14:66391506-66391528 ATACAGATGCAGCTAGATTATGG + Intergenic
1118946744 14:70395600-70395622 ATATAGATAAAGACAGACAGGGG - Intronic
1119918124 14:78421505-78421527 AGATAAATACAGATAGATTTAGG + Intronic
1120413239 14:84185020-84185042 ATAGAGATACAGATAGAGTTGGG - Intergenic
1120458433 14:84761971-84761993 ACATACAGACAGATAGACTGAGG - Intergenic
1120660475 14:87243292-87243314 ATATATATATATATAAATTGAGG + Intergenic
1121169265 14:91839410-91839432 ATAGAGATACAGATGGATTGTGG - Intronic
1122284078 14:100640535-100640557 ATGTAGATACAAACAGACTGTGG + Intergenic
1123847335 15:24316033-24316055 ATACATATATAGATAGATGGGGG + Intergenic
1123866331 15:24523103-24523125 ATACATATATAGATAGATGGGGG + Intergenic
1124224734 15:27883292-27883314 AAATATAAACAGGTAGATTGTGG - Intronic
1126861976 15:52893783-52893805 ATACACATACACACAGATTGAGG - Intergenic
1126999814 15:54489474-54489496 ATATATACACACATACATTGAGG - Intronic
1127184337 15:56462458-56462480 ATAAAGACACAATTAGATTGCGG - Intronic
1127406171 15:58649062-58649084 ATATAATTACAGATATTTTGGGG + Intronic
1128080111 15:64852051-64852073 AGATAGATACACAGAGAATGGGG + Intronic
1129916377 15:79276573-79276595 AGATAGATAGATATAGATAGGGG + Intergenic
1130081604 15:80738686-80738708 TGATAGAAACAGAAAGATTGGGG + Intronic
1130607811 15:85333405-85333427 ATTTAGATCCAGATAGATGTGGG - Intergenic
1130773913 15:86956289-86956311 ATATAGATAGATATAGATATAGG + Intronic
1131480519 15:92776864-92776886 ATATATATATATATATATTGAGG + Intronic
1131610126 15:93951782-93951804 AAATAGATATAGATAGATATAGG - Intergenic
1131610149 15:93952048-93952070 ATATGGATACAGATATATATAGG - Intergenic
1131775327 15:95789926-95789948 AAATAGATTCAAGTAGATTGGGG - Intergenic
1132976548 16:2713966-2713988 ATATAGCAACAGGAAGATTGTGG + Intronic
1133609987 16:7424258-7424280 ATATATATACATATATATGGGGG + Intronic
1134804913 16:17115898-17115920 ATAGGGGAACAGATAGATTGTGG + Intronic
1134880835 16:17744309-17744331 ATAGAGATACAGAGAGACAGAGG + Intergenic
1135012643 16:18895716-18895738 ATATAGATATATATAGAGAGGGG - Intronic
1137489251 16:48917341-48917363 ATATAGATATAGATATATGGGGG + Intergenic
1137842759 16:51654976-51654998 ATATATATACATATAGAGAGAGG - Intergenic
1138101911 16:54258701-54258723 ACATAGCTACAGGGAGATTGGGG - Intronic
1138165448 16:54797240-54797262 ATATAGAAAGAGATTTATTGTGG + Intergenic
1140966300 16:79969309-79969331 ATAGATAGACAGATAGATGGAGG - Intergenic
1143808289 17:9448610-9448632 AGATAGGTATAGATAGATAGTGG - Intronic
1144111055 17:12033476-12033498 ATTTATATACAGTTACATTGTGG - Intronic
1144497163 17:15755675-15755697 ATAAAGATATAGATAGATAGGGG + Intergenic
1144606728 17:16672935-16672957 ATAGAGATATAGATAGATAGGGG + Intergenic
1144607439 17:16679267-16679289 ATATAGATATGGATAGGTAGGGG + Intergenic
1144904466 17:18629230-18629252 ATAAAGATATAGATAGATAGGGG - Intergenic
1145197391 17:20906841-20906863 ATATAGATATGGATAGGTAGGGG - Intergenic
1146543216 17:33715867-33715889 ATGTAGATACAGAGAGAAAGTGG + Intronic
1148971719 17:51489550-51489572 ATATATATATATATACATTGTGG - Intergenic
1149030632 17:52078912-52078934 ATATGGAAACAGATAGTGTGGGG - Intronic
1149743349 17:59069721-59069743 CTATAGATACAGTCACATTGGGG - Intronic
1149941457 17:60872408-60872430 ATATACATACAGATATATATGGG - Intronic
1149941460 17:60872463-60872485 ATATACATACAGATATATATGGG - Intronic
1149941467 17:60872562-60872584 ATATACATACAGATATATATGGG - Intronic
1149941475 17:60872645-60872667 ATATACATACAGATAGATATCGG - Intronic
1150098005 17:62395785-62395807 ATAATGATAAAAATAGATTGAGG - Intronic
1150936436 17:69640848-69640870 CTATAGATATAGATAGATACAGG - Intergenic
1151288986 17:73134905-73134927 ACATACATACAGATATATTTAGG - Intergenic
1153160400 18:2198286-2198308 ATATACAAAGAGATAGGTTGGGG + Intergenic
1153294578 18:3533530-3533552 CCATAGATACAGGTACATTGGGG - Intronic
1153491388 18:5652200-5652222 ACTTAAATACAGAGAGATTGAGG + Intergenic
1154190119 18:12223702-12223724 ATATATATACACATAGATACAGG - Intergenic
1154944456 18:21148027-21148049 AGATAGATAGAGATAGAGAGAGG - Intergenic
1155559212 18:27057668-27057690 ATATCGATACAGATAGATCTGGG + Intronic
1156893691 18:42218458-42218480 AAATAGATTGAGATAAATTGAGG - Intergenic
1157245310 18:46048682-46048704 ATAAAGACACAGAGAGACTGAGG + Intronic
1158046326 18:53159640-53159662 ATATAGATACAGATAGATTGGGG - Intronic
1158272835 18:55734991-55735013 ATATACAGAAAGATAGAATGGGG - Intergenic
1158794919 18:60833582-60833604 AAATACATACAGATATATAGGGG - Intergenic
1159006444 18:63017048-63017070 ATACAAATACATATATATTGTGG + Intergenic
1159179402 18:64881980-64882002 AGATAGATATAGAGAGATAGGGG - Intergenic
1160333914 18:78019726-78019748 ATATATATACATATATATTATGG + Intergenic
1162271492 19:9619836-9619858 AGATAGATATAGATAGATAGAGG - Intronic
1162881525 19:13663281-13663303 ACATAGATACAGAAATACTGTGG - Intergenic
1164455940 19:28406714-28406736 ATACAGATACAGATAGTTTTAGG - Intergenic
1164687761 19:30179673-30179695 ATATAGATATAGATATATGAGGG + Intergenic
1164915487 19:32048452-32048474 ACATAGATATAGATATATTTAGG + Intergenic
1168190339 19:54733823-54733845 ATGGAGATACAGATAGATCATGG + Intronic
1168204395 19:54838755-54838777 GGATAGATACAGATAGATGATGG + Intronic
926611173 2:14949675-14949697 ATATAGATATAGATATATAATGG + Intergenic
927303575 2:21543850-21543872 ATATAAATACAGATCTATTAAGG + Intergenic
928497986 2:31854323-31854345 ATAGAGATAAAGATAGATGATGG - Intergenic
929016132 2:37497613-37497635 ATATAACTATAGATAGAATGAGG - Intergenic
929093871 2:38245827-38245849 ATAGAGCTAGAGATAGATAGAGG - Intergenic
929715544 2:44305789-44305811 GTAGAGATACAGAGAGATGGAGG - Intronic
930661910 2:54063316-54063338 ATATAGATACATATAGAGTTAGG + Intronic
930843501 2:55875025-55875047 ATATTGACACAGGTAGCTTGAGG + Exonic
930969168 2:57373506-57373528 CTATAGCTGAAGATAGATTGTGG + Intergenic
931470020 2:62530206-62530228 AGATAGATACAGATAGACAATGG - Intergenic
932223447 2:70019975-70019997 ATATATATACACACACATTGTGG - Intergenic
933207956 2:79531222-79531244 ATATATATATATATAGCTTGAGG + Intronic
933443604 2:82348411-82348433 CTAAATATTCAGATAGATTGAGG - Intergenic
933548395 2:83742740-83742762 ATATAGATACAGGGAGAGTGAGG + Intergenic
934591613 2:95556576-95556598 CTGTAGATATACATAGATTGGGG - Intergenic
935282531 2:101531476-101531498 ATATAGACACACATATAATGTGG - Intergenic
935633842 2:105234607-105234629 CTACAGATTCAGATAGATTATGG - Intergenic
936379374 2:111970548-111970570 ATATAGACACAATTAGATAGTGG - Intronic
938162537 2:128998800-128998822 ATTTAGATCCAGATATATAGAGG - Intergenic
940319337 2:152359178-152359200 ATATAGATTCGGATTGTTTGTGG + Intronic
940771826 2:157846997-157847019 ATATACATACATATCGATTCTGG - Intronic
941225678 2:162844358-162844380 AAATAGATACATATAGATATAGG + Intergenic
942588859 2:177518684-177518706 ATATACAGACAGATAGATAGTGG - Intronic
943266128 2:185735433-185735455 ATAAAGATACAGATACACTAAGG - Intergenic
943463149 2:188194607-188194629 ATATAGATACAGATTAAATATGG + Intergenic
943521537 2:188957411-188957433 AGAGTGATACAGATAGAGTGGGG - Intergenic
944324930 2:198393082-198393104 ATATGGAGACATATAGAATGAGG + Intronic
945112218 2:206370813-206370835 ATAGAAACACAGATAGGTTGGGG - Intergenic
945997208 2:216447685-216447707 AAAAAGATAAAGGTAGATTGAGG + Intronic
946650153 2:221884595-221884617 ATAGACAGACAGATAGATAGCGG + Intergenic
946753626 2:222919842-222919864 ATTTAGATGCAGATATATTGTGG + Intronic
946915763 2:224519290-224519312 ATATACATAATGAGAGATTGTGG - Intronic
947283912 2:228488759-228488781 ATATACATACTGATCCATTGTGG - Intergenic
947345267 2:229183861-229183883 ATATAGAAAGAGAGAGAGTGAGG - Intronic
1169599791 20:7244778-7244800 ATAAAGGTAAAGATAAATTGTGG + Intergenic
1170056934 20:12215930-12215952 ATTTACATGCAGATAAATTGTGG + Intergenic
1170203019 20:13765243-13765265 ATAAAGATAAAGATAATTTGAGG + Intronic
1171318124 20:24213863-24213885 ATATAGATATAGATAGAGAATGG + Intergenic
1172675964 20:36672456-36672478 ATATAGTTCCAGAAAGACTGAGG + Intronic
1173132392 20:40406723-40406745 AGATAGATAGAGATTGATTCTGG - Intergenic
1174357263 20:50006757-50006779 ATAGATAGATAGATAGATTGTGG - Intergenic
1174751727 20:53117876-53117898 ATGGAGAGACAGGTAGATTGAGG - Intronic
1175528594 20:59656394-59656416 ATATAGATATAGAGAGATGATGG - Intronic
1177046360 21:16174648-16174670 ATCTCTATACAGATAGATAGAGG - Intergenic
1177230429 21:18313330-18313352 ATAGAGAGAGAGAGAGATTGAGG - Intronic
1177441126 21:21125711-21125733 ATATAGAGAGAGAGAGATTGAGG + Intronic
1177625726 21:23656895-23656917 ATTTAGATATAGATATACTGTGG - Intergenic
1177944154 21:27446324-27446346 ATAGACAGACAGATAGATAGAGG + Intergenic
1178430068 21:32511044-32511066 ATATAGATAGAGAGAGAGAGAGG - Intronic
1178536669 21:33415543-33415565 ATATAAATACATATAGAAAGAGG + Intronic
1180592158 22:16949558-16949580 ATACAGGTACAGATAGCTTAGGG + Intergenic
1181411512 22:22724751-22724773 ATATAGATATAGATAGATAGGGG + Intergenic
1181418451 22:22778425-22778447 ATATAGATATAGATAGATAGGGG + Intronic
1183258713 22:36780174-36780196 ATATTGAGACTGACAGATTGGGG - Intergenic
1183646436 22:39129777-39129799 AAAGAGAAACAGATAGACTGGGG - Intronic
1183805084 22:40202390-40202412 TTATAATTACAAATAGATTGTGG + Intronic
1184669332 22:46004547-46004569 AAATAGATCCAGATAGAGGGAGG - Intergenic
1184972287 22:48033267-48033289 ATATAAAAATAGAAAGATTGAGG - Intergenic
949652108 3:6171608-6171630 AGAGAGAGACAGAAAGATTGAGG - Intergenic
949737053 3:7185484-7185506 ATATAGATAGAGCTACATAGTGG - Intronic
953087845 3:39689682-39689704 ATAGAGATATAGACATATTGAGG - Intergenic
953573234 3:44089754-44089776 ATATAGATACAGCTATATGTAGG + Intergenic
955452244 3:59081666-59081688 ATATATATATAGATAGATTCAGG - Intergenic
957003661 3:74917645-74917667 ATATAGATACAGGTTGCTTAAGG - Intergenic
957290767 3:78275591-78275613 ATATAGAAAAAGAAAGATTTGGG - Intergenic
957764916 3:84611123-84611145 ATACATAGACAGATAGATAGAGG + Intergenic
957807816 3:85173187-85173209 ATATAAATATAGATAGATATGGG + Intronic
958533284 3:95363700-95363722 ATAAAGATACAGATAAAGTAAGG - Intergenic
958705760 3:97653032-97653054 ATAAACATACAGTTAGTTTGGGG + Intronic
958794128 3:98688072-98688094 ATATACATACACATATATAGCGG - Intergenic
959203038 3:103272398-103272420 ATATTGGTACCGGTAGATTGGGG - Intergenic
959917582 3:111835197-111835219 ATATAGAAACTGATGGATTGGGG + Intronic
960267072 3:115632296-115632318 ATGTAGATACAGTTTGGTTGGGG + Intronic
960544422 3:118896450-118896472 ACATTGATACAAATAGACTGGGG + Intergenic
960921668 3:122753233-122753255 ATTTAGACACAGAAAGAATGAGG + Intronic
962143345 3:132813779-132813801 ATGTAGCTAGAGATAGAATGTGG - Intergenic
962275977 3:134013774-134013796 ATTTGGAAACACATAGATTGTGG + Intronic
963143975 3:141973080-141973102 ATATATATACACATAGCTTTGGG - Intronic
963598026 3:147353283-147353305 ATATAGAAACAGAGAAAATGAGG - Intergenic
963688919 3:148473749-148473771 ATACAGTTACAGAAAAATTGAGG + Intergenic
964271665 3:154963113-154963135 ACAGAGATACAGAGAGATTGTGG - Intergenic
964929942 3:162005945-162005967 AAATATATACAGTTAAATTGTGG + Intergenic
965120919 3:164555304-164555326 ATAAAGAAATAAATAGATTGGGG - Intergenic
965197516 3:165620923-165620945 ATATATATATATATATATTGGGG - Intergenic
965441184 3:168716944-168716966 TTTTAGATAAAGACAGATTGAGG + Intergenic
965936569 3:174120949-174120971 CTGCAGATACAGATATATTGAGG - Intronic
966062309 3:175772954-175772976 AAATAGATACAGAGAAATCGAGG + Intronic
967002261 3:185347325-185347347 ATACAGATACAGATATATCAAGG + Intronic
967060168 3:185865194-185865216 ATATAGATATATATAGAGAGAGG + Intergenic
970103374 4:12552092-12552114 ATACAGATATAGATAGATACAGG - Intergenic
970196251 4:13553101-13553123 AGAGAGAAACAGATAGATGGGGG - Intergenic
970844521 4:20520567-20520589 ATATATATACATGAAGATTGTGG - Intronic
971465615 4:26956557-26956579 ATATAGAGAGAGATAGGCTGAGG - Intronic
971579846 4:28322263-28322285 ATATAGAAACAGATGGATATTGG + Intergenic
972000524 4:34026395-34026417 ATATACATACATATGGATTTAGG + Intergenic
974572535 4:63671855-63671877 ATATAGATAGACATAGATACAGG + Intergenic
976773556 4:88681706-88681728 AAATAGATACACATATTTTGGGG + Intronic
977241633 4:94577467-94577489 ATATATATATATATATATTGAGG + Intronic
977336599 4:95707461-95707483 ATATAGAAAAAGTTATATTGGGG - Intergenic
978149706 4:105418597-105418619 ATATTGATATAGATACATTGTGG - Intronic
978272151 4:106903856-106903878 ATAAAGCTTCAGATATATTGAGG - Intergenic
978769436 4:112438983-112439005 AGTTAGATAAAGATAGATTTGGG - Intronic
979478097 4:121181863-121181885 ATGTAGAGACAGATTCATTGTGG - Intronic
979782249 4:124667599-124667621 ATATAGATAAAGATATATAGAGG - Intronic
979826258 4:125236702-125236724 ATATAGTTACAGATACTTTTAGG - Intergenic
980417849 4:132516013-132516035 ATATTGATCTAGATAGATTAAGG + Intergenic
980509404 4:133764903-133764925 AAATATATATAGATAGATAGTGG - Intergenic
980808557 4:137845212-137845234 ATATAGATATCTATATATTGAGG - Intergenic
981703642 4:147635627-147635649 ATATATATAGAGAGAGATAGTGG + Exonic
982704228 4:158689620-158689642 ATATATATATATATATATTGTGG + Intronic
982754055 4:159197844-159197866 ATGCAGATACAGATAAATTAGGG - Intronic
983023005 4:162701746-162701768 GTATAGTTTCAGATAGCTTGGGG - Intergenic
983121135 4:163886357-163886379 AGATAGATATAGACAGATAGAGG + Intronic
983462505 4:168046078-168046100 GTATAAATGCAGATAGCTTGAGG - Intergenic
983484049 4:168312699-168312721 ATATAGATAGATATAGATGATGG + Intronic
986299529 5:6467142-6467164 AGAGAGAGACAGAGAGATTGTGG - Intronic
986592829 5:9389182-9389204 AAATAAATACAGAGAGATTGGGG - Intronic
986832380 5:11594346-11594368 ATATACATACAGAAAAATTTTGG - Intronic
986908137 5:12520103-12520125 ATATTGGTACAGGTAGAGTGGGG - Intergenic
987605453 5:20129254-20129276 ATAAAGATATAGATATATTTTGG - Intronic
987963556 5:24842449-24842471 AAAGAAACACAGATAGATTGAGG + Intergenic
987999742 5:25332180-25332202 ATATAGATATAGATAAATAGAGG - Intergenic
988040657 5:25885327-25885349 ACAGAGAGACAGAAAGATTGAGG - Intergenic
988273534 5:29049778-29049800 ATATAGATATAGATATATGTGGG - Intergenic
988293361 5:29320042-29320064 ATATAGATACAGATATCTTTGGG + Intergenic
988296275 5:29366790-29366812 ATATTGATACTGATTGATTCTGG + Intergenic
988604982 5:32671341-32671363 ATATTGAGACAGAAAGATTTGGG - Intergenic
988622693 5:32839882-32839904 GTATATATATAAATAGATTGTGG - Intergenic
989986647 5:50707601-50707623 AGAGAGATAGAGATAGATAGGGG + Intronic
989986846 5:50710879-50710901 AGATAGAAACAGATACACTGTGG - Intronic
991705514 5:69354343-69354365 ATATAGAAAAAGTTAAATTGGGG - Intronic
992664340 5:78991743-78991765 ATATAGATATATATAGAGAGAGG + Intergenic
994928592 5:106151502-106151524 ATATATATACAGTTACATTGGGG - Intergenic
994979824 5:106859824-106859846 ATAAATGTATAGATAGATTGGGG - Intergenic
995069687 5:107905061-107905083 ATATATATATATATGGATTGTGG + Intronic
995286067 5:110389370-110389392 AGATATGAACAGATAGATTGGGG + Intronic
996073658 5:119163239-119163261 TTTTACATACAGAGAGATTGAGG + Intronic
996074929 5:119181235-119181257 ATATAGATGCAGATAATTTTAGG - Intronic
997037298 5:130208028-130208050 ATATATATATAGATAGGTGGGGG + Intergenic
998535944 5:142930730-142930752 ATGTAAATACAGACAGGTTGAGG - Intronic
999698989 5:154210942-154210964 TTGTAGATACAGGTAGATGGGGG + Intronic
999990645 5:157046997-157047019 ATACATATATAGATAGATAGAGG + Intronic
1000130636 5:158294457-158294479 ATATAAATACATATAGATTGGGG - Intergenic
1000452015 5:161400996-161401018 TTTTAGATACAGAGAGATTGAGG - Intronic
1000803186 5:165754413-165754435 ATCTAAATACAGTTAGAATGTGG + Intergenic
1000953730 5:167517385-167517407 AAATAGATACAATTATATTGAGG - Intronic
1000966471 5:167663114-167663136 ATAGAGAGACAGAGAGAATGGGG + Intronic
1002782316 6:376737-376759 ATATATATACACACACATTGTGG - Intergenic
1003254567 6:4463573-4463595 ATGTAGATACAGAGAGGCTGTGG + Intergenic
1003306704 6:4935675-4935697 CTACAGATACAGAGATATTGTGG + Exonic
1003518225 6:6835286-6835308 CTATAGATACAGATAGAGTGGGG - Intergenic
1004014748 6:11722027-11722049 ATATAGAGAGAGAGAGATTTGGG + Intronic
1004739954 6:18449699-18449721 ATATATATATATATACATTGTGG + Intronic
1007330654 6:41104915-41104937 ATGTAGGTGCAGATAGATTTGGG + Intergenic
1007355788 6:41315455-41315477 ATATAGATATAGATATATATAGG + Intergenic
1009593368 6:65703191-65703213 ATATAGAGAGAGAGAGATAGAGG - Intronic
1010130564 6:72487992-72488014 ATATATATATATATAGTTTGAGG - Intergenic
1010362574 6:75011988-75012010 ATAGAGATCGAGATAGACTGAGG - Intergenic
1010465009 6:76157490-76157512 ATATAGATATAGATATATGATGG - Intergenic
1010694725 6:78956715-78956737 GTGTAGATACTGATAGATTCTGG - Intronic
1010725704 6:79329979-79330001 ATATAGATATAGATATATTGGGG + Intergenic
1010900447 6:81421950-81421972 AAATAGTTACCGATAGAGTGGGG + Intergenic
1011080811 6:83488831-83488853 CTACAAATACAGTTAGATTGTGG + Intergenic
1011176884 6:84573090-84573112 TTATAGATACAGTTAAATTAAGG + Intergenic
1011336191 6:86262630-86262652 ATATAGATACACTTAAATTTTGG - Intergenic
1011585513 6:88920527-88920549 ACATACATACACATATATTGAGG + Intronic
1011805568 6:91069171-91069193 AAATAGATACAGATATTTTAGGG + Intergenic
1013406027 6:109844586-109844608 ATATAGATATATATATTTTGTGG + Intergenic
1013422815 6:109981386-109981408 ATATAGATATAGATATACTATGG - Intergenic
1013841632 6:114402849-114402871 AGAAAGATACAGATAGACAGTGG - Intergenic
1014154629 6:118096243-118096265 ATATGGACACAGATATATTTAGG + Intronic
1014333452 6:120100540-120100562 ATATAGGTATAGATAGATATAGG + Intergenic
1014454201 6:121618446-121618468 ATATAGATATAGACAGATTCTGG + Intergenic
1014720147 6:124906929-124906951 AAATAAATACATATAGAGTGAGG - Intergenic
1015067331 6:129046650-129046672 CTATAGATACAGATACATATAGG - Intronic
1015067685 6:129051170-129051192 ATATATATACAGAGAGAGAGAGG - Intronic
1015100248 6:129469710-129469732 AAATAGATATACATAAATTGTGG + Intronic
1015110825 6:129589685-129589707 ATATTGGTACCGATAGAGTGGGG - Intronic
1016960990 6:149672643-149672665 ATATAGAAATAGATGGATTTTGG + Intronic
1017631787 6:156403093-156403115 ATATAGTAACAGACATATTGAGG - Intergenic
1020720750 7:11741784-11741806 TTATGGATACAAATAGTTTGTGG - Intronic
1021055784 7:16044323-16044345 ATATAGATATAGATAGATAAAGG - Intergenic
1021244363 7:18243847-18243869 AGATAGATACAGCAAGATTAGGG + Intronic
1021667647 7:23002168-23002190 ATATATATACATATAGTTTGCGG + Intronic
1022397762 7:30006088-30006110 ATATATATACATATATATTTAGG + Intergenic
1024604268 7:51011705-51011727 ATATAGATGCAGAGACCTTGAGG - Intergenic
1024935137 7:54704260-54704282 ATGTAGAAACAGATAGTTTTAGG + Intergenic
1025021974 7:55487406-55487428 AGATACATAGAGAGAGATTGCGG - Intronic
1026194578 7:68162103-68162125 GTATAGATACAGGAAGATTTGGG + Intergenic
1026396254 7:69957561-69957583 TTATAGTTACATATATATTGGGG + Intronic
1026399377 7:69993772-69993794 ATATATATACAGAGAGAGAGAGG - Intronic
1027411758 7:77927240-77927262 ATAAAGAGAGAGATTGATTGTGG + Intronic
1027976567 7:85164321-85164343 ATACAGATAGAGATAGGTTTGGG - Intronic
1028046618 7:86128566-86128588 ATTGAGGTACAGATACATTGTGG + Intergenic
1028339792 7:89704611-89704633 ATGTAAAAACACATAGATTGAGG - Intergenic
1029042826 7:97595838-97595860 ATATAGAAAAAGATAAATTTTGG + Intergenic
1029183086 7:98718942-98718964 ATATATATACAGCCAGCTTGGGG + Intergenic
1030469769 7:109948966-109948988 CTATATTTTCAGATAGATTGTGG - Intergenic
1030789983 7:113712656-113712678 ATATAGCTAGATATAGATAGAGG + Intergenic
1030882895 7:114903442-114903464 ATATATATATAGATAGATATAGG - Intergenic
1031858581 7:126951858-126951880 ATATAGATAAAGAAATATAGAGG + Intronic
1032614288 7:133449609-133449631 ATCTAGATACAGATAGAATAAGG - Intronic
1032668121 7:134057861-134057883 AAATAGATCCAGATAGCTGGTGG + Intronic
1032671951 7:134091975-134091997 ATATATAAAGAGATATATTGGGG - Intergenic
1033809032 7:144988672-144988694 ATAAAGATTCAGATAAATTAAGG + Intergenic
1034930672 7:155160226-155160248 TTATAGATATAGATATATAGAGG - Intergenic
1035777238 8:2197695-2197717 ATATAGATACAGATACAGATAGG - Intergenic
1036018740 8:4817106-4817128 ATTTATATACAGATACATGGAGG - Intronic
1036563712 8:9920045-9920067 ATATAAATATACATACATTGGGG - Intergenic
1037051484 8:14379728-14379750 ATATATATACATATATATTTTGG + Intronic
1037184175 8:16041480-16041502 ATAGAGTTATAGATACATTGGGG - Intergenic
1037405076 8:18533587-18533609 ATATACATAGATATAGACTGTGG + Exonic
1038273907 8:26103235-26103257 ATAGATATACAGATAGATAGAGG + Intergenic
1038368650 8:26964510-26964532 ATATGGAGACAGATATATAGAGG - Intergenic
1038580659 8:28746639-28746661 ATATATTTACAAATATATTGGGG + Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040394181 8:46979849-46979871 ATAGAGGGACAGATAAATTGTGG - Intergenic
1041123761 8:54613585-54613607 ATATTTATACAGATAGATAAGGG + Intergenic
1041749568 8:61245582-61245604 ATATAATTACAGATATACTGGGG + Intronic
1041854134 8:62430345-62430367 AGATACATACATATATATTGTGG + Intronic
1042190474 8:66180660-66180682 AGACAAATACAGATAAATTGTGG - Intergenic
1042238452 8:66638978-66639000 ATATATATACATATATTTTGTGG + Intronic
1042628319 8:70785815-70785837 ATATAGATAAATATAAATTTAGG - Intronic
1043173235 8:76991993-76992015 ATTTTGATACAGGTTGATTGAGG - Intronic
1043781190 8:84337459-84337481 ATGTAGATACAATTATATTGTGG + Intronic
1043813752 8:84775644-84775666 ATATAGACACTGACAAATTGGGG - Intronic
1043956765 8:86369474-86369496 ATAAAGAGAAAAATAGATTGGGG + Intronic
1044183725 8:89226519-89226541 ATAAAAATACAGGTAGATTATGG - Intergenic
1044497029 8:92898859-92898881 ATATATATATATATAGATGGGGG + Intronic
1045738535 8:105324296-105324318 ATATGGATACATATAGATATAGG - Intronic
1046350518 8:113004224-113004246 ATTTAGATTCAGATTGATTTTGG + Intronic
1047098560 8:121650851-121650873 ATATAAATACAGAGAAACTGAGG - Intergenic
1047965744 8:130045443-130045465 ATATAAATACATATAAATTGGGG - Intergenic
1048599433 8:135903832-135903854 ATATATATACAGATTAATTCTGG - Intergenic
1049045258 8:140145544-140145566 ATATAGTAGCAGATTGATTGAGG - Intronic
1050216293 9:3328834-3328856 ATAGAGATAGAAATAAATTGGGG - Intronic
1050229574 9:3506710-3506732 ATATATATAAATATAGAATGAGG + Intronic
1050975975 9:11938423-11938445 ATAGAGATACAGATAGATACAGG + Intergenic
1051865142 9:21671759-21671781 AGATAGATAGATATAGATTTGGG - Intergenic
1051900536 9:22034079-22034101 GAATAGATACAGATACAATGTGG + Intergenic
1051949747 9:22617214-22617236 ATCTCTATACAGATAGAGTGAGG + Intergenic
1052294007 9:26877251-26877273 ATATACATACTGATATCTTGGGG - Intronic
1056622760 9:88227834-88227856 ATATATATAGAGAGAGAATGAGG + Intergenic
1056841183 9:89999194-89999216 ATATATATACATATATATTGAGG - Intergenic
1057056003 9:91961477-91961499 ATACTGACACAGATAGATTCAGG + Intergenic
1057240836 9:93407143-93407165 ATATAGATATAGATAGATATAGG + Intergenic
1059603898 9:115812236-115812258 ACATATATACAGACATATTGTGG - Intergenic
1060501490 9:124160465-124160487 ATATTGATACAGTTAGACTTGGG + Intergenic
1060519432 9:124285952-124285974 AAATAAATACAGATAAACTGAGG + Intronic
1060715376 9:125922481-125922503 ATATAAATACAGATATACTGTGG - Intronic
1203492206 Un_GL000224v1:117694-117716 ATATATATATAGATAGACTATGG - Intergenic
1203504829 Un_KI270741v1:59566-59588 ATATATATATAGATAGACTATGG - Intergenic
1185633083 X:1530833-1530855 ACATAGATATAGATAGATAATGG - Intronic
1185921619 X:4099267-4099289 AGATAGATACAGATTTATTATGG - Intergenic
1186157563 X:6741512-6741534 AGATAGATATAGATATATAGAGG + Intergenic
1186732111 X:12420871-12420893 AAATAGGTACGGAGAGATTGTGG - Intronic
1186985035 X:15003467-15003489 ATACAAATACAAATTGATTGAGG + Intergenic
1187191169 X:17036815-17036837 GTAGAGATAAAGATAGATAGAGG + Intronic
1187959740 X:24557364-24557386 AGCTAGACACAGATAGATGGGGG - Intergenic
1188324197 X:28779664-28779686 ATATATATATATATAGAATGTGG + Intronic
1188338090 X:28963391-28963413 AAATTGATATAGATATATTGGGG - Intronic
1188408906 X:29846745-29846767 ATATATATATATATAGACTGTGG - Intronic
1188830979 X:34896279-34896301 ATATGGATACACAAAGAATGAGG - Intergenic
1189073745 X:37893262-37893284 ATATATACATATATAGATTGTGG - Intronic
1189155936 X:38756889-38756911 ATAAAGATCCAGAGATATTGAGG + Intergenic
1189552690 X:42110014-42110036 ATACATATACATATAGCTTGAGG - Intergenic
1189918971 X:45884918-45884940 ATATAAATATAGAGAGATAGAGG - Intergenic
1189929365 X:45991727-45991749 GTATAGAAAAAGAAAGATTGAGG - Intergenic
1190142079 X:47856328-47856350 ATATAGATATTGATAGACTTTGG + Intronic
1190960169 X:55238955-55238977 ATATATTTTCAGATAGATAGAGG + Intronic
1191651894 X:63548110-63548132 ATATAGATTCATATATATTAAGG + Intergenic
1192611720 X:72573307-72573329 ATATAAACACAGATAGAACGTGG + Intergenic
1194856425 X:98934716-98934738 ATATAGATATGGATAGATATAGG + Intergenic
1194907871 X:99601099-99601121 ATATAGACATAGATAGATGATGG - Intergenic
1195178854 X:102337778-102337800 AGATAGATACACACAGATTGTGG + Intergenic
1195180010 X:102349305-102349327 AGATAGATACACACAGATTGTGG - Intergenic
1195734636 X:108000024-108000046 ATATATAAATAGATAGATAGAGG + Intergenic
1197888585 X:131243709-131243731 ATATAGATACATGTAGTTTCTGG + Intergenic
1198210712 X:134513091-134513113 ATATACATACATATACATCGGGG - Intronic
1199196583 X:145038267-145038289 ATATATATACACACACATTGTGG - Intergenic
1199360540 X:146912671-146912693 ATAGATATATAGATAAATTGTGG - Intergenic
1201365398 Y:13200376-13200398 ATACAGAGAAAGATATATTGAGG + Intergenic
1201629157 Y:16050320-16050342 ATTTTGGTACAGATAGATTTGGG + Intergenic