ID: 1158046900

View in Genome Browser
Species Human (GRCh38)
Location 18:53167139-53167161
Sequence AGCAACAAATGCTGCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158046900_1158046902 15 Left 1158046900 18:53167139-53167161 CCCTCAAGGCAGCATTTGTTGCT No data
Right 1158046902 18:53167177-53167199 AACTAAATGTTAACACTCTGAGG No data
1158046900_1158046903 23 Left 1158046900 18:53167139-53167161 CCCTCAAGGCAGCATTTGTTGCT No data
Right 1158046903 18:53167185-53167207 GTTAACACTCTGAGGCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158046900 Original CRISPR AGCAACAAATGCTGCCTTGA GGG (reversed) Intronic