ID: 1158047878

View in Genome Browser
Species Human (GRCh38)
Location 18:53178093-53178115
Sequence CTGATTGAACTGAGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 378}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158047878_1158047879 0 Left 1158047878 18:53178093-53178115 CCTTCTTCACTCAGTTCAATCAG 0: 1
1: 0
2: 0
3: 31
4: 378
Right 1158047879 18:53178116-53178138 CTATATGTTAAGTTCCAATGAGG 0: 1
1: 0
2: 0
3: 6
4: 116
1158047878_1158047881 21 Left 1158047878 18:53178093-53178115 CCTTCTTCACTCAGTTCAATCAG 0: 1
1: 0
2: 0
3: 31
4: 378
Right 1158047881 18:53178137-53178159 GGATATCTAGAATGTTCAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158047878 Original CRISPR CTGATTGAACTGAGTGAAGA AGG (reversed) Intronic
900760981 1:4470166-4470188 CATTTTGAGCTGAGTGAAGATGG + Intergenic
901949427 1:12730268-12730290 ATGATTAAACTTAGTGAGGAAGG - Intergenic
902648180 1:17818644-17818666 CTGAATGAAGTGAGGGAATAAGG - Intronic
902693537 1:18125504-18125526 CTGAATGAACTGATTAAAGCTGG + Intronic
904033778 1:27548591-27548613 CTGATTGAACTGGGTGCTGTCGG + Exonic
904316445 1:29669197-29669219 CTGTTAGAGCTGAGTGAAGTTGG - Intergenic
904375000 1:30075217-30075239 CTGATTGATCAGGTTGAAGATGG - Intergenic
904761223 1:32805625-32805647 ATGATTAAGCTTAGTGAAGAAGG - Intronic
905256062 1:36685849-36685871 CTGATTGACATCAGGGAAGATGG + Intergenic
908091663 1:60692282-60692304 GTGATTAAACTTAGTGAGGAAGG + Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909088450 1:71195604-71195626 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
909779452 1:79524491-79524513 CAGATTGAAGTGAGTGGAAATGG + Intergenic
909984145 1:82140011-82140033 CTTATAGAACTGTGGGAAGAGGG + Intergenic
911331961 1:96535030-96535052 CTGTTTGAACTGCTTGAAGATGG + Intergenic
911503115 1:98713590-98713612 ATGATTAAACTTAGTGAGGAAGG - Intronic
911649627 1:100373107-100373129 ATGATTAAGCTTAGTGAAGAAGG - Intronic
911820179 1:102409026-102409048 ATTATTAAACTTAGTGAAGAAGG + Intergenic
912177967 1:107184016-107184038 TCGATTGTACTGACTGAAGATGG - Intronic
912421573 1:109545658-109545680 CTGATTCAATTGAGGGAAGTAGG - Exonic
912874002 1:113337254-113337276 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
913127018 1:115800927-115800949 ATGATTAAACTTAGTGAAGAAGG - Intergenic
913167263 1:116199774-116199796 CTGCTTGTACTGAGAGAAGCAGG - Intergenic
916277800 1:163013957-163013979 CTGAGAGACCTGAATGAAGATGG - Intergenic
917192322 1:172431171-172431193 ATGATTAAGCTTAGTGAAGAAGG + Intronic
917228855 1:172814253-172814275 CTGATGGAGCTGTGAGAAGAAGG - Intergenic
917298905 1:173551877-173551899 ATGATTGAATTCAGTGAGGAAGG + Intronic
918411582 1:184263983-184264005 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
918569919 1:185977927-185977949 CTGATGGAACTAACTGAAAAAGG - Exonic
919932764 1:202232163-202232185 CTGGTTAAAGTGAGTGAAGAGGG + Intronic
922065582 1:222136307-222136329 ATGATTAAACTTAGTGAGGAAGG - Intergenic
922467266 1:225852932-225852954 CTGGGTGCACTGAGTGAAGCAGG - Intronic
923262455 1:232280324-232280346 GTTATTGAACTGTATGAAGATGG + Intergenic
923851131 1:237796611-237796633 AAGATTGAAGTGAATGAAGAAGG - Intronic
923851132 1:237796647-237796669 AAGATTGAAGTGAATGAAGAAGG - Intronic
923859418 1:237878053-237878075 CTGAATATTCTGAGTGAAGATGG + Exonic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1063175660 10:3548781-3548803 TTGGTTGACCTGAGTGAAAATGG + Intergenic
1063369593 10:5512476-5512498 CCGAGAGAACTCAGTGAAGAAGG - Intergenic
1063584163 10:7336071-7336093 CTGTTGGAACTGAGTTAAGATGG - Intronic
1064481308 10:15743536-15743558 CTAAAAGAACTGAGTGCAGATGG - Intergenic
1065434886 10:25695598-25695620 GTGATTGGAGAGAGTGAAGATGG + Intergenic
1066484776 10:35832900-35832922 CTGAATGAACTGAATGAAGGAGG + Intergenic
1066696551 10:38084240-38084262 GTGAGTGACCTGAGTGAACAAGG + Intergenic
1067305377 10:45059443-45059465 CTGAATGAACTGACTGAAGGAGG + Intergenic
1068597044 10:58913552-58913574 CTTATTGAACTGAGAAAAGATGG + Intergenic
1069597710 10:69683154-69683176 CTGATAGAACTGGGTGTTGAAGG + Intergenic
1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG + Intronic
1071158994 10:82724623-82724645 CTGATTTAATTAAGCGAAGAAGG - Intronic
1071683324 10:87729671-87729693 ATGATTGAGCTTAGTGAGGAAGG + Intronic
1072601024 10:96929724-96929746 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1073696305 10:105872918-105872940 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1075826110 10:125358290-125358312 CTGGTGGAACTGTGAGAAGAAGG - Intergenic
1076337991 10:129722456-129722478 GTGACTGAACTGAATGCAGAGGG - Intronic
1076549509 10:131269068-131269090 ATAATTAAGCTGAGTGAAGAAGG - Intronic
1077524298 11:3055079-3055101 CTGAGTCAACTTAGGGAAGATGG + Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1079713718 11:23718327-23718349 CTAGTGGAACTGAGAGAAGAGGG + Intergenic
1079722389 11:23834330-23834352 ATGATTAAATTTAGTGAAGAAGG - Intergenic
1079997615 11:27311603-27311625 CTGATGGAACTGAAAGCAGAAGG - Intergenic
1081233346 11:40614643-40614665 ATGATTAAGCTCAGTGAAGAAGG - Intronic
1082200019 11:49355223-49355245 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1082923062 11:58516864-58516886 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1083166979 11:60895679-60895701 ATGATTGAGCTTAGTGAAGAAGG - Intronic
1085313160 11:75527900-75527922 CTGATGGAGCTGAGAGAAGTTGG - Intergenic
1086273353 11:85094879-85094901 ATGATTAAACTTAGTGAGGAAGG - Intronic
1086323553 11:85675261-85675283 ATGATTAAACTTAGTGAGGATGG - Intronic
1086646959 11:89234512-89234534 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1087399803 11:97651419-97651441 CTGATTGGACTGAGTGATTATGG - Intergenic
1091236958 11:134028622-134028644 CTGCTTGGACTGAGCCAAGAGGG - Intergenic
1091343546 11:134837977-134837999 CTGATTGGACCCACTGAAGAGGG - Intergenic
1091494881 12:963946-963968 CTGAATGAAATGAGTGAGAAGGG + Intronic
1091989320 12:4941845-4941867 CTGATTTTAGTGAGTCAAGAGGG - Intergenic
1093123608 12:15302023-15302045 CTGATAAAACTAATTGAAGAGGG + Intronic
1093691149 12:22110586-22110608 ACGATTAAACTTAGTGAAGAAGG - Intronic
1094435331 12:30414867-30414889 GTGTTTGAGATGAGTGAAGAAGG - Intergenic
1094632655 12:32192012-32192034 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1095936801 12:47692777-47692799 ATGATTAAACTTAGTGAGGACGG - Intronic
1096201670 12:49688024-49688046 CTGAGTGGATTCAGTGAAGAGGG - Intronic
1096440344 12:51637345-51637367 ATGATTAAACTTAGTGAGGAAGG + Intronic
1097322279 12:58239393-58239415 GTGGTTGCACTGGGTGAAGAAGG + Intergenic
1097806695 12:63972469-63972491 CTGATTGCAGGGAGTGGAGAAGG + Intronic
1100468287 12:94868270-94868292 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1100747928 12:97666017-97666039 CTGATTTCACTGAGTGAGAAAGG + Intergenic
1102151218 12:110689834-110689856 CTGATTCGACTGTGTGAACAGGG - Intronic
1105780077 13:23697912-23697934 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1106579190 13:31003139-31003161 CGGGGTGAACTGAGTGAAGCAGG - Intergenic
1107814779 13:44234511-44234533 CTCATTGTACTGAGAGAAAACGG - Intergenic
1107879166 13:44817917-44817939 CTGAGTGAAGTGAGTGGAGAGGG + Intergenic
1108232400 13:48361302-48361324 ATTATTGAACTGACTGAATATGG + Intronic
1109131283 13:58589389-58589411 ATGATTAATCTTAGTGAAGAAGG + Intergenic
1109953297 13:69531109-69531131 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1111144166 13:84158299-84158321 CTGAGGGACCTGAGTGAAGGAGG - Intergenic
1111571714 13:90096586-90096608 ATGATTAAACTTAGTGAGGATGG - Intergenic
1111986321 13:95070296-95070318 ATGCTTGAACTGACTGAAAAGGG + Intronic
1114798106 14:25739864-25739886 CTGATAGAGCTGTGAGAAGAGGG - Intergenic
1114943317 14:27644327-27644349 ATGATTGAGCTTAGTGAGGAAGG - Intergenic
1115545818 14:34463913-34463935 GTGCTTGAACTGAGTGTTGAAGG + Intergenic
1116293536 14:43074181-43074203 CTGATAGAGCTGTGAGAAGAGGG + Intergenic
1116320789 14:43459937-43459959 ATGCTTGAGCTGAGTTAAGAAGG + Intergenic
1116387940 14:44355775-44355797 GTGATTAATCTTAGTGAAGAAGG - Intergenic
1116562157 14:46394136-46394158 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1117263415 14:54060620-54060642 ATGATTCAACTTAGTGAGGAAGG - Intergenic
1117592573 14:57287934-57287956 CTGATGGAACTGAGAGATTAGGG + Intronic
1118004977 14:61557559-61557581 GAGAGTGAACTGAGTGATGAAGG + Intronic
1119888833 14:78167307-78167329 GTCCCTGAACTGAGTGAAGATGG + Intergenic
1120049167 14:79845384-79845406 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1120625803 14:86824677-86824699 CTTAAAGAACCGAGTGAAGATGG - Intergenic
1121240719 14:92428111-92428133 CTGAATGAACTGAGACAAGTGGG + Intronic
1121296261 14:92827646-92827668 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1125340559 15:38671543-38671565 CTGGTTCAACGGAGGGAAGATGG - Intergenic
1126873010 15:53009845-53009867 CCGGTTTAACTGAGAGAAGATGG + Intergenic
1127705195 15:61539962-61539984 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1130109583 15:80953630-80953652 AGGAATGAACTAAGTGAAGAAGG + Intronic
1130619013 15:85441841-85441863 CTGACTGAATTGGGAGAAGAGGG + Intronic
1130765968 15:86871564-86871586 CTTAGTGAACAGAGTGAGGAAGG - Intronic
1131498950 15:92941862-92941884 CTCATTGAAATGACTGGAGAAGG + Exonic
1131638069 15:94259101-94259123 CAGAGTGAACTGAGTGAGCATGG - Intronic
1131756558 15:95569909-95569931 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1133846365 16:9457634-9457656 CTGAGAGAAGTCAGTGAAGATGG + Intergenic
1136867190 16:33767865-33767887 CTGATTGCACGGTGGGAAGATGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140446024 16:75028699-75028721 CTGTTTCAATTGAGTGATGAGGG - Intronic
1140546966 16:75819996-75820018 CTGATTAAACTGAATGCTGATGG + Intergenic
1203104972 16_KI270728v1_random:1348338-1348360 CTGATTGCACGGTGGGAAGATGG + Intergenic
1203128542 16_KI270728v1_random:1614030-1614052 CTGATTGCACGGTGGGAAGATGG - Intergenic
1142571693 17:878716-878738 CTGATTGAACCCAGTGAATGGGG + Intronic
1143110102 17:4548277-4548299 CTGCTTGAACTGCGTGCTGAGGG + Exonic
1143437903 17:6942854-6942876 CTGAGTGAAATGAGTGACCAAGG - Intronic
1144265689 17:13566516-13566538 ATGATTAAACTTAGTGAGGAAGG + Intronic
1146451903 17:32981414-32981436 CTGGTGGAACTGTGAGAAGAGGG - Intronic
1146978576 17:37138189-37138211 CTGATTAGACTGTGTGATGATGG + Intronic
1147451571 17:40508559-40508581 CTGATTGACATGAGAGAAGATGG - Intergenic
1148696238 17:49560810-49560832 ATGATTAAACTCAGTGAGGAAGG + Intergenic
1149216173 17:54357356-54357378 CTAATGGAGCTGTGTGAAGAGGG - Intergenic
1149557272 17:57582717-57582739 CTGATTGACATCAGGGAAGATGG - Intronic
1150615450 17:66767349-66767371 CTGCTGGTACGGAGTGAAGACGG + Intronic
1151949330 17:77341199-77341221 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1153336912 18:3934175-3934197 CTAATTAAAATGAATGAAGAAGG - Intronic
1153395380 18:4614318-4614340 ATGACTGAACTTAGTGAGGAAGG - Intergenic
1153443587 18:5148336-5148358 CTCATTTACCTGAGTGAAGCTGG + Intronic
1153698973 18:7673441-7673463 CTGATTAATCTGCGTGAAGAAGG + Intronic
1154163154 18:11994930-11994952 ATGTTTGAACTGAGTCATGAAGG + Intronic
1154341665 18:13507900-13507922 ATGATTAAACTTAGTGAGGAAGG + Intronic
1155371814 18:25110169-25110191 CTGACAGAACTGACTGTAGATGG - Intronic
1155616139 18:27723754-27723776 ATGACTGAATTGAGTAAAGATGG - Intergenic
1156562276 18:38138875-38138897 CTGATTGCTCTGAGTAAACAGGG + Intergenic
1156583812 18:38409767-38409789 CTAGTGGAACTGAGAGAAGAGGG + Intergenic
1156659595 18:39331125-39331147 CTGAATGAACTGATCGAAGTTGG - Intergenic
1156851978 18:41739214-41739236 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1156875950 18:42011737-42011759 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1157743912 18:50118075-50118097 TTGATTGCATTGAGTGAAGGAGG - Intronic
1157811272 18:50697900-50697922 CTAATTGAAGTGAGTAAAGAAGG - Intronic
1158047878 18:53178093-53178115 CTGATTGAACTGAGTGAAGAAGG - Intronic
1158919201 18:62170703-62170725 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1163803437 19:19382115-19382137 TTGAATGAAAGGAGTGAAGATGG - Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165125029 19:33588373-33588395 ATGATTAACCTTAGTGAAGAAGG + Intergenic
1166226006 19:41395784-41395806 CTGAACGAAGTGAGTGTAGATGG - Intronic
1166557696 19:43712246-43712268 ATGATTAAGCTCAGTGAAGAAGG - Intergenic
1167426868 19:49434079-49434101 CTCCTTGATCTGAGGGAAGATGG - Intronic
1167495161 19:49813249-49813271 CTGTTTGAGTTGGGTGAAGAAGG - Exonic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
926319647 2:11740272-11740294 ATCAGTGAACTGAGTGAGGAAGG - Intronic
926813759 2:16780070-16780092 CTGAGAGTTCTGAGTGAAGAGGG - Intergenic
928274952 2:29892149-29892171 CTGATTGGAATGTGTGCAGAAGG + Intronic
929742503 2:44617695-44617717 CTGATTTATGTGAGTGAGGAAGG + Intronic
930426189 2:51216080-51216102 CTAATGGAACTTAGTGAAGAAGG + Intergenic
930864334 2:56107986-56108008 CTGATGGAACAGGGAGAAGATGG + Intergenic
933171010 2:79125167-79125189 ATGATTGAGCTTAGTGAGGAAGG - Intergenic
933626710 2:84609343-84609365 ATGATTAAACTTAGTTAAGAAGG - Intronic
934138958 2:89026687-89026709 CTGATTGAGCTGGGGGTAGAAGG + Intergenic
934230285 2:90173874-90173896 CTGATTGAGCTGGGGGTAGAAGG - Intergenic
935047639 2:99496824-99496846 CTGATTGAAATGAATCAGGATGG - Intergenic
935627011 2:105179994-105180016 CTGCTTGGACTTAGAGAAGATGG - Intergenic
935846572 2:107172206-107172228 CTGATTGAAATAAATGGAGAAGG - Intergenic
937767049 2:125673671-125673693 ATGATTAAACTTAGTGAGGAAGG + Intergenic
939720918 2:145650181-145650203 CTAATTGAACTGGGTGGATATGG + Intergenic
939740748 2:145902506-145902528 CTAGTGGAACTGAGAGAAGAAGG + Intergenic
939936658 2:148301172-148301194 ATGAGTTAACTGAGTCAAGAAGG + Intronic
940037452 2:149325760-149325782 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
940608450 2:155958914-155958936 ATGATTGAGCTTAGTAAAGAAGG + Intergenic
941414113 2:165197419-165197441 CTGATTGAATTGGTTGAAGGTGG + Intronic
942575864 2:177362890-177362912 CTGATTGAAGTAATTGAAGGAGG - Intronic
943776782 2:191774557-191774579 CTAATGGAACTGTGAGAAGAGGG + Intergenic
944449272 2:199824559-199824581 ATGATTAAACTTAGTGAAGAAGG - Intronic
947020709 2:225672651-225672673 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
947045269 2:225975368-225975390 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
947754165 2:232549794-232549816 ATGATTAAACTGAGTGAGGAAGG - Exonic
947932845 2:233977701-233977723 ATGTTTGAACTGAGTGAATAGGG + Intronic
948547734 2:238744942-238744964 ATGATTGAACTAAGAGCAGAAGG + Intergenic
1169275262 20:4229528-4229550 CTGAATGAAGTGAGTGAATGAGG + Intronic
1169744618 20:8931025-8931047 ATGATTAAACTTAATGAAGAAGG - Intronic
1176420021 21:6506622-6506644 CTGATTGATCTGGCTGGAGATGG + Intergenic
1177200869 21:17954449-17954471 ATCAGTGAACTGAGTAAAGAAGG + Intronic
1177201093 21:17956958-17956980 ATCAGTGAACTGAGTAAAGAAGG + Intronic
1177457485 21:21360603-21360625 GTGATTGAAAGGAGTGAACAAGG - Intronic
1179360226 21:40699438-40699460 ATGATTAAACTTAGTGATGAAGG + Intronic
1179668232 21:42927180-42927202 GTGATTGTAATGAGTGAAGCAGG + Intergenic
1179695513 21:43114942-43114964 CTGATTGATCTGGCTGGAGATGG + Intergenic
1182832191 22:33313267-33313289 CTGAGTGGACTGAGAGTAGAAGG - Intronic
1183050070 22:35253742-35253764 CTGAGAGAACAGAGTTAAGAGGG + Intergenic
1185178021 22:49341406-49341428 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
949610776 3:5701240-5701262 GTGATTGAAATGAGTCAGGATGG + Intergenic
950100777 3:10355435-10355457 CTGAAGGAAGTGAGGGAAGATGG + Intronic
950806073 3:15604069-15604091 CTGGTGGAACTGTGAGAAGAGGG - Intronic
951898663 3:27635062-27635084 CTGATTAAACTGGGTAATGAAGG + Intergenic
953355578 3:42253764-42253786 TGGAGTGAAGTGAGTGAAGAGGG + Intergenic
953445731 3:42964111-42964133 ATGATTAAGCTTAGTGAAGATGG + Intronic
953456577 3:43047108-43047130 CTGATGGAGCTGTGAGAAGAGGG + Intronic
954077695 3:48193282-48193304 GTGGTTGAAGTGAGTGGAGATGG + Intergenic
955228213 3:57078500-57078522 CTGATTGAGCCGAGTGGAAACGG - Intronic
955905399 3:63802293-63802315 CTGATTGAGCTTAGTTAGGAAGG - Intergenic
955969825 3:64427216-64427238 ATGATTAAGCTTAGTGAAGAAGG + Intronic
956034391 3:65074614-65074636 CTGATTTAACATAGTGTAGATGG + Intergenic
956919828 3:73915464-73915486 TTGATTGAACAGTGTGAATAGGG + Intergenic
957115760 3:76023347-76023369 ATGATTAAACTTAATGAAGAAGG - Intronic
958091946 3:88887822-88887844 ATGATTCAGCTTAGTGAAGAAGG + Intergenic
958500921 3:94907582-94907604 CTGAGTGAACTGAGTTCAGTAGG - Intergenic
958655516 3:96997386-96997408 ATGATTAAACTTAGTGAGGAAGG - Intronic
959655386 3:108798436-108798458 TTGCTTGAACTGAGCCAAGATGG + Intergenic
960154599 3:114286038-114286060 ATGATTAAGCTTAGTGAAGAAGG - Intronic
962028931 3:131578534-131578556 ATGATTAAACTTAGTGAGGAAGG + Intronic
962322425 3:134402898-134402920 CTGATTGAACTGAATCTTGAGGG + Intergenic
962339465 3:134569714-134569736 CTGGTGGAACTGTGAGAAGAGGG - Intronic
962426935 3:135278443-135278465 CTGATTGACCTGGGAGATGAAGG - Intergenic
963183823 3:142390783-142390805 ATGATTAAGCTTAGTGAAGAAGG - Intronic
964494908 3:157278277-157278299 CTACTTTAACTAAGTGAAGAAGG + Intronic
964772754 3:160241012-160241034 GTGATTGAAATGAGTCAGGATGG + Intronic
964942183 3:162172201-162172223 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
965005406 3:163016449-163016471 ATGATTTAGCTTAGTGAAGAGGG + Intergenic
965078286 3:164004753-164004775 CTGATTTATCTGAGAAAAGAAGG + Intergenic
965224198 3:165966813-165966835 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
967710772 3:192705216-192705238 ATGATTAAACTTAGTGAGGAAGG - Intronic
968192396 3:196678567-196678589 CTACTTGAACCGAGTGATGAAGG + Intronic
971414637 4:26413058-26413080 CGGATTTAACTGAGGGAGGAGGG - Intronic
971797556 4:31248177-31248199 CTCATCAAACTGAGTGTAGAAGG + Intergenic
972006816 4:34119840-34119862 TTGAATGAACTCATTGAAGAGGG - Intergenic
972189332 4:36571015-36571037 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974171297 4:58270275-58270297 CTAATGGAACTGTGAGAAGAGGG + Intergenic
974212089 4:58791251-58791273 ATGATTAAACTTAGTGAAGAAGG + Intergenic
975501451 4:75090044-75090066 GTGATTAAGCTTAGTGAAGAAGG + Intergenic
978083056 4:104618073-104618095 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
978304132 4:107303663-107303685 ATGATTAAACTTAGTGAGGAAGG - Intergenic
978314411 4:107419641-107419663 GTGATTGAAATGAGTCAAGGTGG - Intergenic
978338024 4:107690422-107690444 CTGCTTGAAATGAGTCATGAAGG - Intronic
979390081 4:120117816-120117838 CTAATGGAACTGTGAGAAGAGGG - Intergenic
981229773 4:142339080-142339102 CTGAGAGAACTGAGTAGAGAAGG - Intronic
981343367 4:143647868-143647890 CTGATTAAACGGTGAGAAGAAGG + Intronic
981806633 4:148723598-148723620 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
981888748 4:149711919-149711941 CTGAATATACTTAGTGAAGATGG - Intergenic
982233389 4:153229964-153229986 CTGAATGAACTGGCTGAATAAGG - Intronic
985076106 4:186216539-186216561 CTGATTGAAGTGAGTCACGTGGG + Intronic
986151795 5:5136866-5136888 CTGTTTGAACTTACAGAAGAGGG + Intergenic
987058651 5:14220490-14220512 ATGATTAAACCTAGTGAAGAAGG + Intronic
987095916 5:14549758-14549780 ATGATTGAGCTTAGTGAAAAAGG - Intergenic
987731969 5:21785403-21785425 ATGATTAAGCTCAGTGAAGAAGG + Intronic
988286364 5:29222819-29222841 CTGATAAAACGGAGTGAACAAGG - Intergenic
988476358 5:31589538-31589560 CTGACTGAGCTGACTGAATAGGG + Intergenic
988868050 5:35356949-35356971 TTGATTAAACTGAATGAAAAGGG - Intergenic
989230332 5:39078478-39078500 CTGATTGACATTAGGGAAGATGG - Intergenic
989408684 5:41091838-41091860 CTGAATGAGCTGACTGAAGAAGG + Intergenic
989576221 5:42991114-42991136 CTGATTGAACAGTGAGGAGAGGG + Intergenic
989802286 5:45557985-45558007 ATGATTGAGCTTAGTGAGGAAGG + Intronic
990979404 5:61588354-61588376 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
991170011 5:63613900-63613922 CTGAATGAACTGCATGAAGAGGG + Intergenic
991188631 5:63841536-63841558 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
991651368 5:68858246-68858268 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
991664315 5:68982586-68982608 CTGATTGAAATAATGGAAGAAGG + Intergenic
991729818 5:69574701-69574723 ATGATTGAGCTTAGTGAGGAAGG + Intronic
991806250 5:70429842-70429864 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
991865136 5:71053173-71053195 ATGATTGAGCTTAGTGAGGAAGG - Intronic
992271291 5:75065941-75065963 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
992462794 5:76977776-76977798 ATGATTAAGCTTAGTGAAGAAGG + Intronic
992483425 5:77173385-77173407 CTGATTCATCTGACTTAAGAAGG + Intergenic
993126368 5:83840902-83840924 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
993852832 5:93032571-93032593 ATGATTGAACTGCCCGAAGAGGG + Intergenic
994507941 5:100665401-100665423 CTAATGGAGCTGTGTGAAGAGGG - Intergenic
994625939 5:102219099-102219121 ATGTTTGAGCTTAGTGAAGAAGG - Intergenic
994807852 5:104475251-104475273 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
995283219 5:110358138-110358160 CTAGTGGATCTGAGTGAAGAGGG + Intronic
995339562 5:111042593-111042615 ATGATTAAACTTAGTGAGGAAGG - Intergenic
996194493 5:120586856-120586878 ATGATTAAACTTAGTGAGGAGGG + Intronic
996390964 5:122961163-122961185 CTGATGAAACTGAGTAAAGTTGG + Intronic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
999111438 5:149124976-149124998 CTGATTGAACAGAGTGAGCTGGG + Intergenic
1003459355 6:6315861-6315883 CTGGGTGAACTGCATGAAGATGG + Intronic
1003822901 6:9919916-9919938 ATGATTAAACTTAGTGAGGAAGG + Intronic
1004070873 6:12296242-12296264 CTGATGGAAGCCAGTGAAGATGG - Exonic
1004869578 6:19891089-19891111 ATGATTGAAATGACTGAAGGAGG + Intergenic
1005501103 6:26429942-26429964 CTGATTTAAATGACTGACGAGGG - Intergenic
1005790749 6:29297167-29297189 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1006875684 6:37293684-37293706 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1006883609 6:37360989-37361011 CAGATTGAAAGGAGTGAGGAAGG - Intronic
1007017754 6:38486397-38486419 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1009468120 6:63999124-63999146 ATGATTGAAATGACTGCAGATGG - Exonic
1010650997 6:78455438-78455460 CTGATGGAGCTGTGAGAAGAGGG - Intergenic
1011855328 6:91682794-91682816 CTGATCTAACTAAGTGAAGGAGG - Intergenic
1013057659 6:106600092-106600114 CTGACTGAACTAGGTGAAGGAGG - Intronic
1013172661 6:107650856-107650878 GTGATTAAACTTAGTGAGGAAGG + Intronic
1013367064 6:109444553-109444575 CTGATTGAACTGAAGTGAGAAGG + Intronic
1013540524 6:111103708-111103730 CTGATTGAGCTGACTAGAGAAGG + Intronic
1013922780 6:115428798-115428820 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1015180995 6:130362412-130362434 TTGACTGAAATGAGAGAAGATGG - Intronic
1015485131 6:133761117-133761139 CTGCTTGGACTGAGTGGAGCAGG - Intergenic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1018271439 6:162082644-162082666 ATGATTGAGCTCAGTGAGGAAGG - Intronic
1019230688 6:170559274-170559296 ATGATTATACTTAGTGAAGAAGG + Intronic
1019821984 7:3251016-3251038 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
1020090893 7:5340087-5340109 ATGATTAAACTTAGTGAGGAAGG + Intronic
1020596857 7:10217507-10217529 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1020939397 7:14511701-14511723 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1022403844 7:30067746-30067768 CTGAAAATACTGAGTGAAGAAGG - Intronic
1022917643 7:34975173-34975195 ATGATTAAACTTAGAGAAGAAGG + Intronic
1023445158 7:40223412-40223434 CTGATTCCATTGAGTGACGAAGG + Intronic
1024133320 7:46379623-46379645 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1024549327 7:50548301-50548323 ATGATTCAGCTGAGTGAGGAAGG + Intronic
1024920535 7:54549498-54549520 TTCATTGAACTGAGTTAAGCAGG + Intronic
1025812852 7:64886219-64886241 CTCATTCAACTGAGTAAAGGAGG - Intronic
1026804402 7:73420906-73420928 GTGATAGAACTGACTGAAAAGGG + Intergenic
1027623128 7:80517484-80517506 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1027631999 7:80618443-80618465 GTGATTAAACTTAGTGAGGAAGG + Intronic
1027944990 7:84733193-84733215 CTAATTAAGCTTAGTGAAGAAGG - Intergenic
1028408605 7:90503482-90503504 ATGATTAAACTTAGTGAGGAAGG - Intronic
1028660951 7:93274183-93274205 ATGATTAAGCTTAGTGAAGATGG + Intronic
1030172912 7:106622663-106622685 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1030396858 7:108996576-108996598 CTGATTTAACTCAGCCAAGATGG - Intergenic
1031359060 7:120824502-120824524 GTGATTGAACTGAACGAACATGG - Intronic
1032246324 7:130216881-130216903 CTGAATGAACTAGGTGAAGTTGG + Intergenic
1032485206 7:132281366-132281388 CTGATTGACATCAGAGAAGATGG - Intronic
1033080558 7:138293036-138293058 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1033241608 7:139684392-139684414 ATGATTGAGCTTAGTGAGGAAGG + Intronic
1033386496 7:140881663-140881685 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1033388440 7:140902509-140902531 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1036195176 8:6708137-6708159 CTGACGGAACTGGGTGAAGGTGG - Intergenic
1037136472 8:15468511-15468533 CTAATTTGACAGAGTGAAGAGGG - Intronic
1037145908 8:15572629-15572651 ATGATTAAACTTAGTGAGGAAGG - Intronic
1038424623 8:27456652-27456674 ATGATTAAGCTGAGTGAGGAAGG + Intronic
1038886077 8:31664312-31664334 ATGATTTAAATGAGTGGAGAAGG + Intronic
1039556198 8:38476980-38477002 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
1039577175 8:38632910-38632932 CTGAGTGAACAGAATGGAGAAGG - Intergenic
1040732389 8:50464336-50464358 CTTATTAAACTTAGTGAGGAAGG - Intronic
1042281158 8:67057798-67057820 TTGACTGAACTGAGTTAAGCAGG - Intronic
1042466110 8:69131651-69131673 CTGATTAAACTGGATGATGAGGG + Intergenic
1042819709 8:72916671-72916693 ATGAATGAATTGAATGAAGATGG + Intronic
1043099024 8:76016341-76016363 ATGATTAAGCTGAGTGATGAAGG + Intergenic
1043196214 8:77295627-77295649 CTTATAGAATTGTGTGAAGAGGG - Intergenic
1043826431 8:84934697-84934719 GTGAATGAAGTGAGTGGAGAAGG - Intergenic
1043862736 8:85339607-85339629 ATGATTAAGCTCAGTGAAGAAGG + Intronic
1044356462 8:91228229-91228251 ATGGTTGGAGTGAGTGAAGATGG + Intronic
1044596117 8:93960375-93960397 CTGCTTAAAGTGGGTGAAGAAGG - Intergenic
1045073155 8:98532164-98532186 ATGATTAAACTTAGTGAGGAAGG - Intronic
1045129527 8:99133557-99133579 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1045563523 8:103289829-103289851 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1045889586 8:107139109-107139131 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1046485223 8:114878863-114878885 TTGAATGAACTGATTGATGATGG - Intergenic
1046743822 8:117855998-117856020 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1047873069 8:129106446-129106468 CTGACTGAAGTGAGGGAACAAGG - Intergenic
1048046704 8:130779666-130779688 CTGATTTAACTGAGTCACCAGGG - Intergenic
1048518950 8:135136414-135136436 CTGAATGATGTGAGGGAAGAGGG + Intergenic
1048744817 8:137602346-137602368 CTAATTTAACTGAATGAATAAGG + Intergenic
1049103171 8:140593956-140593978 CAGATGGAACTGAGTGAACCTGG - Intronic
1049719860 8:144110798-144110820 CTGGCTGGACTGAGTGGAGAAGG + Intronic
1050437296 9:5624632-5624654 ATGATTAAACTAAGTGAGGAAGG - Intergenic
1051820428 9:21159714-21159736 CTGATTGAAATAAGTGAATGAGG + Intergenic
1053578955 9:39383112-39383134 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053620637 9:39810637-39810659 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053626072 9:39873298-39873320 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1053720957 9:40946269-40946291 CTAATGGAGCTGAGAGAAGAGGG - Intergenic
1053843467 9:42211187-42211209 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053878803 9:42569923-42569945 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053893869 9:42724448-42724470 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054100538 9:60941916-60941938 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054121934 9:61217541-61217563 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054217816 9:62377403-62377425 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1054232886 9:62531772-62531794 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054263526 9:62896807-62896829 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054585808 9:66964970-66964992 ATGATTGAGCTGAGTGAGGAAGG + Intergenic
1055421349 9:76146404-76146426 CTGATAGAAATGACTGAAGAAGG + Intronic
1057750580 9:97789407-97789429 GTGTTTGAACTGAGTCATGAGGG + Intergenic
1059121622 9:111644434-111644456 CTGAGTGAAATGTTTGAAGAGGG + Intronic
1059558912 9:115311931-115311953 ATGATTAAACTCAGTGAGGAAGG + Intronic
1059925846 9:119208457-119208479 CTGATTCACCTGATTGAGGAGGG - Intronic
1060882437 9:127127273-127127295 CTGCTTGAAATCAGTGGAGAAGG - Intronic
1061648564 9:132027138-132027160 CTGAATCAACGGAGTGAGGATGG + Intronic
1187474448 X:19598539-19598561 ATGATCGAGCTTAGTGAAGAAGG - Intronic
1187524358 X:20040492-20040514 ATGATTGAGCTCAGTGAGGAAGG - Intronic
1187814933 X:23221250-23221272 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1188223713 X:27571645-27571667 CTGCTTTAACTGACTGAATATGG + Intergenic
1188278859 X:28238072-28238094 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1188816151 X:34716990-34717012 CTGATTGAACCCAGTGAGGGAGG + Intergenic
1191013200 X:55782830-55782852 CTGATTCAGCTGTATGAAGAAGG + Intergenic
1191803840 X:65111959-65111981 ATGATTACACTTAGTGAAGAGGG + Intergenic
1191891591 X:65948693-65948715 TTGATTGAACTGCCAGAAGAAGG - Intergenic
1192754474 X:74032649-74032671 ATGATTGAACTTAGTGAGGAAGG + Intergenic
1192754541 X:74033647-74033669 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1194294314 X:92109428-92109450 CTGATTGTTCGGATTGAAGATGG + Intronic
1194588637 X:95769492-95769514 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1194591241 X:95802520-95802542 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1195760488 X:108240679-108240701 TTGGTTGAACTGAATGAAGGGGG + Intronic
1197578758 X:128255917-128255939 CTCATGGAACTGTGAGAAGAAGG - Intergenic
1198034622 X:132788587-132788609 ATGATTAAACTTAGTGAGGAAGG + Intronic
1198323126 X:135539646-135539668 ATGATTAAACTTAGTGAGGAAGG - Intronic
1198847551 X:140928956-140928978 CAGTTTGTACTGAGTGAAGATGG - Intergenic
1200611818 Y:5333946-5333968 CTGATTGTTCGGACTGAAGATGG + Intronic
1200910340 Y:8526299-8526321 CTGATGGAACTGGGAGAACAAGG - Intergenic