ID: 1158049830

View in Genome Browser
Species Human (GRCh38)
Location 18:53203557-53203579
Sequence CAGTGATACCATAAGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158049826_1158049830 -6 Left 1158049826 18:53203540-53203562 CCAAATGAATGTATGAGCAGTGA 0: 1
1: 0
2: 2
3: 8
4: 168
Right 1158049830 18:53203557-53203579 CAGTGATACCATAAGGGGCCTGG 0: 1
1: 0
2: 2
3: 10
4: 143
1158049825_1158049830 14 Left 1158049825 18:53203520-53203542 CCATGAATAGAAATATTTTTCCA 0: 1
1: 0
2: 3
3: 72
4: 581
Right 1158049830 18:53203557-53203579 CAGTGATACCATAAGGGGCCTGG 0: 1
1: 0
2: 2
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158049830 Original CRISPR CAGTGATACCATAAGGGGCC TGG Intronic
901185075 1:7367782-7367804 CAGTGAAACCATGAGTGCCCAGG - Intronic
901185083 1:7367814-7367836 CAGTGAAACCATGAGTGCCCAGG - Intronic
901185121 1:7368006-7368028 CAGTGAAACCATGAGTGCCCAGG - Intronic
901185175 1:7368262-7368284 CAGTGAAACCATGAGTGCCCAGG - Intronic
901387917 1:8923299-8923321 CAGTGATGGCAGATGGGGCCGGG - Intergenic
902696938 1:18146472-18146494 CAGTGATCCCAGGAGGGCCCAGG - Intronic
903101990 1:21038035-21038057 CAGTGATACTATATGGAGCAGGG + Intronic
907138047 1:52157824-52157846 CATTGATAGCAATAGGGGCCAGG - Intronic
907529625 1:55081618-55081640 CAGTGAATCCATAAAGGGACTGG - Intronic
908581128 1:65518559-65518581 CGGTGAAACCAAAAGTGGCCAGG - Intronic
909082699 1:71132943-71132965 CAGTGAAACCATCAGGTGCAAGG - Intergenic
913962675 1:143352392-143352414 CAGGGCTACCACCAGGGGCCTGG - Intergenic
913963985 1:143359720-143359742 CAGGGCTACCACCAGGGGCCTGG + Intergenic
914057030 1:144177977-144177999 CAGGGCTACCACCAGGGGCCTGG - Intergenic
914058349 1:144185324-144185346 CAGGGCTACCACCAGGGGCCTGG + Intergenic
914120799 1:144781047-144781069 CAGGGCTACCACCAGGGGCCTGG - Intergenic
914122116 1:144788389-144788411 CAGGGCTACCACCAGGGGCCTGG + Intergenic
919405793 1:197181522-197181544 CAGTGTTACTATGAGAGGCCTGG - Intronic
919798270 1:201334745-201334767 CAGTGAGAGCAAAAGGGTCCAGG + Intergenic
1062902155 10:1154685-1154707 CAGAGCTGCCAGAAGGGGCCCGG - Intergenic
1063276633 10:4575832-4575854 CAGTGACACCATATGGGCCTAGG - Intergenic
1063488466 10:6441657-6441679 CAGTTATAACATAACGGCCCAGG - Intronic
1070495262 10:77015589-77015611 CAGTGATATCATAAGGCGGTTGG - Intronic
1071570726 10:86695364-86695386 CAGAGATACCATCAGGAGCCAGG - Intronic
1072933825 10:99692728-99692750 GAGTGCTATCATAAGGGGACTGG + Intronic
1078552986 11:12293229-12293251 CAGTCCTACCATCATGGGCCCGG + Intronic
1081470020 11:43361024-43361046 CAGTGTAACAATAAGAGGCCAGG + Intronic
1088273963 11:108064956-108064978 CAGTGAAGCCATCAGGTGCCAGG + Intronic
1088604647 11:111516411-111516433 CAGAAATAGCATAAGAGGCCAGG + Intronic
1091729263 12:2867678-2867700 TAGTTCTACCATGAGGGGCCAGG + Intronic
1093550565 12:20405251-20405273 CAAAGAAACCATAAGAGGCCTGG - Intronic
1098662136 12:73108333-73108355 AAATGATACAATATGGGGCCAGG - Intergenic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1109112447 13:58338784-58338806 CAGTGAAACCATCAGGTCCCAGG + Intergenic
1113825400 13:113248837-113248859 CAGTGATCCCCTAAAAGGCCAGG - Intronic
1115306747 14:31941576-31941598 CTGGGATACCATATGGTGCCTGG - Intergenic
1118005099 14:61558431-61558453 CAGTGAAAGCAGCAGGGGCCTGG - Intronic
1119232468 14:72991482-72991504 AAGTAAGACCATCAGGGGCCGGG - Intronic
1122120485 14:99550842-99550864 CAGCGGTACCATAACAGGCCTGG + Intronic
1122388050 14:101362335-101362357 CTGTAATATCATAAGGGGGCAGG - Intergenic
1122506704 14:102236239-102236261 CAGTGATGGCAGATGGGGCCGGG - Intronic
1122950631 14:105042548-105042570 CAGTGACACCACAAGGAGGCAGG + Intergenic
1134278139 16:12794930-12794952 CAGTGATGCCAAAAGCCGCCTGG - Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138450123 16:57088740-57088762 CAGTGAGACCGTAACGTGCCAGG - Intergenic
1141717093 16:85733078-85733100 CAGAGATACCTCCAGGGGCCTGG + Intronic
1142213745 16:88821026-88821048 CCGTGAAACCATGGGGGGCCTGG - Intronic
1146076804 17:29738080-29738102 CCGTGACCCCACAAGGGGCCCGG + Intronic
1148795842 17:50196282-50196304 CAGGGATCCCCCAAGGGGCCAGG + Intronic
1149816638 17:59731684-59731706 CAGTGATGGCAGAAGGAGCCTGG + Intronic
1152105795 17:78328119-78328141 CAGGGACACCACAAGTGGCCAGG + Intergenic
1155731797 18:29168834-29168856 CAGTGAAACCATCAGGATCCAGG + Intergenic
1157535106 18:48452159-48452181 CAGTGATACAGGACGGGGCCAGG - Intergenic
1158049830 18:53203557-53203579 CAGTGATACCATAAGGGGCCTGG + Intronic
1162831127 19:13285329-13285351 CAGTGATGTCATAAGATGCCTGG - Intronic
1164729162 19:30489047-30489069 CAGTGATTCCACAAGGGGGCTGG - Intronic
1168546044 19:57250526-57250548 GAGTAAGACCATAAGGGGGCCGG - Intronic
1202696513 1_KI270712v1_random:130650-130672 CAGGGCTACCACCAGGGGCCTGG - Intergenic
1202697830 1_KI270712v1_random:137981-138003 CAGGGCTACCACCAGGGGCCTGG + Intergenic
928224073 2:29432378-29432400 CAGTCATAGCAGAAGGGGCGGGG - Intronic
929742286 2:44615329-44615351 CAGAGAAACCATTTGGGGCCGGG + Intronic
930778335 2:55197225-55197247 CAGAGATACCATCAGGAGCCAGG - Intronic
930895820 2:56444762-56444784 CAGTGATTCCACAGAGGGCCTGG + Intergenic
933273160 2:80255339-80255361 CAGTGATTCCATACGGGCTCTGG + Intronic
933903234 2:86864095-86864117 CAATCATACCATAAGGGGCCTGG + Intergenic
934277675 2:91587675-91587697 CAGGGCTACCACCAGGGGCCTGG - Intergenic
934279001 2:91594977-91594999 CAGGGCTACCACCAGGGGCCTGG + Intergenic
934682574 2:96295634-96295656 CAGTGATGCCATAAGTGGCCAGG + Exonic
935777281 2:106484852-106484874 CAATCATACCATAACGGGGCTGG - Intergenic
940922024 2:159318288-159318310 CAGTGATGCCTTAAAGGGGCTGG - Intergenic
941757818 2:169206867-169206889 CAGTGATGCCATAAGGAGTTGGG + Exonic
941968289 2:171322343-171322365 CACTGATACCAGAAAGGGTCTGG + Exonic
942265849 2:174224831-174224853 CAGTGATATCATCAAAGGCCTGG - Intronic
943055288 2:182970141-182970163 CAGTGAAACCATCAGGTCCCAGG - Intronic
944077788 2:195751769-195751791 CATTGTCACCATAAGGGGTCTGG + Intronic
947140086 2:227012530-227012552 CAGTGATCCCATAAAGGGCTAGG + Intronic
1169662261 20:7992764-7992786 TAGTGATTCCTTAAGGGGCTTGG - Intronic
1169899903 20:10542324-10542346 CAGAGAAACCATAAGGAGACAGG - Intronic
1171284673 20:23927160-23927182 CAGTGATAACATCATGGGCAGGG - Intergenic
1172329284 20:34063783-34063805 TAGTGACACCAGAAGAGGCCTGG - Intronic
1174803035 20:53581312-53581334 GAGTGATACCAAAAAGAGCCTGG + Intronic
1176520758 21:7822353-7822375 CAGGGATGGGATAAGGGGCCTGG - Intronic
1178654782 21:34452365-34452387 CAGGGATGGGATAAGGGGCCTGG - Intergenic
1180707155 22:17817003-17817025 CAGTGCTACCAGGAGGGGCTGGG - Intronic
1181472795 22:23151275-23151297 CAGTGCTGCCATAAGGGATCAGG - Intronic
1181795320 22:25304356-25304378 AAGTGATACCATTAAAGGCCAGG - Intergenic
1181945385 22:26512810-26512832 CTGTGAGACAATAAGGGGCCTGG + Intergenic
1184509166 22:44922040-44922062 CAGTCAAACCATCAGTGGCCAGG + Intronic
1185413521 22:50697831-50697853 CAGGGATCCCACAAGGGCCCAGG - Intergenic
951670136 3:25172111-25172133 CAGTGAGACCATATGGTCCCAGG - Intergenic
955273969 3:57529349-57529371 CAGTGAAGCCATAAGGGCCTGGG + Intronic
955389485 3:58510270-58510292 AAGTGAGACCACAAGGGGGCAGG - Intronic
956693688 3:71900931-71900953 AAGAAAAACCATAAGGGGCCAGG - Intergenic
957695671 3:83635719-83635741 AAGGGAAACCATGAGGGGCCTGG + Intergenic
959547110 3:107609487-107609509 CAGTGAAACCATCAGGTCCCAGG + Intronic
961771899 3:129256133-129256155 CAGTGATAACATCATGGTCCAGG + Exonic
963709235 3:148727439-148727461 CAGTGATACCACAAGAGGGCAGG + Intronic
973196609 4:47450472-47450494 CAGTGATTCAATAAGGAGCTTGG - Intergenic
976041269 4:80887391-80887413 CAGTGGAAACATTAGGGGCCAGG + Intronic
977564105 4:98564129-98564151 CAGTGATAACAGGAGGGGCTGGG - Intronic
978523154 4:109637263-109637285 CAGTGTAACCATAAGGGAGCAGG + Intronic
980498688 4:133619337-133619359 CAGTTATACCAGAAGGTGGCTGG - Intergenic
983305518 4:165980200-165980222 CAGTAAGAACATAAGGGGACTGG - Intronic
985047114 4:185951636-185951658 CAGCAGTACCATAAGGTGCCAGG + Intronic
990214158 5:53512832-53512854 CAGAGATACCATCAGGAGCCAGG + Intergenic
991193018 5:63897673-63897695 CACTGATACCATGAAGGGCTGGG - Intergenic
994266997 5:97729202-97729224 GAATGATACCATAGTGGGCCGGG + Intergenic
997365057 5:133320319-133320341 CAGTGAAACCAGCAGGGGGCAGG - Intronic
997792043 5:136770061-136770083 CAGTCATCCCAGAAGGGCCCGGG - Intergenic
1001629321 5:173163133-173163155 CAGTGATTCCTTAAGGGACGTGG + Intronic
1001895473 5:175376147-175376169 CAGTGTTGCCATTGGGGGCCAGG - Intergenic
1003944224 6:11058952-11058974 TAGAAATACCATAAGAGGCCGGG + Intergenic
1004015314 6:11726910-11726932 GAGTGATACCAGCAGGGCCCAGG - Intronic
1004620205 6:17324935-17324957 CAGTGATGGCAGATGGGGCCAGG + Intergenic
1005005857 6:21286947-21286969 CAGTGATCCAATTAGGGGCATGG - Intergenic
1007796761 6:44355106-44355128 CAGTGAAACCATAATGTGCTGGG - Intronic
1007952395 6:45884100-45884122 CAGTGATGCCTCCAGGGGCCTGG + Intergenic
1008924528 6:56877993-56878015 CAGTCATGCAATAAAGGGCCAGG + Intronic
1009740678 6:67741184-67741206 CAGTGATACCATGGGAGACCTGG - Intergenic
1013955526 6:115836243-115836265 CAGTGTAACCATAAGAGTCCTGG + Intergenic
1014488934 6:122037556-122037578 AAGTTATACCATAAGGAGGCCGG - Intergenic
1014508840 6:122294985-122295007 CAGTGAGGTCATAAGGGGTCTGG - Intergenic
1018207166 6:161446382-161446404 CACTGAGACCCAAAGGGGCCTGG + Intronic
1019745030 7:2695034-2695056 CAGTGGTTCCAAAAGAGGCCAGG - Intronic
1023702220 7:42904068-42904090 CATAGAAACTATAAGGGGCCAGG - Intergenic
1032436936 7:131908502-131908524 CAGTAATACCCCAAGGGGCAAGG + Intergenic
1041188289 8:55325751-55325773 CAGTGATAACATTTGGGGCCAGG - Intronic
1041616336 8:59911401-59911423 CAGTGAAACCATCAGGTGCTGGG - Intergenic
1042286770 8:67121765-67121787 CAGTGAAACCATAAGGTACAGGG + Intronic
1042428629 8:68678102-68678124 CAGTGAAGCCATCAGGTGCCAGG - Intronic
1042625271 8:70749792-70749814 CAGTGATACCCTAGGGTGGCTGG - Intronic
1043233944 8:77837004-77837026 CAGTGTTACCCCAAGGGACCTGG + Intergenic
1048284530 8:133131480-133131502 CAGTGATACCATAAGTATCGTGG + Intronic
1049700373 8:144008532-144008554 CAGTGAGCCCCTAACGGGCCGGG + Intronic
1051374513 9:16389777-16389799 CAGTGGTACCATGAAGGGGCTGG + Intergenic
1052400606 9:27995270-27995292 CAGTGATGCCATCAGGGCCTGGG - Intronic
1058364204 9:104188439-104188461 CAGTGATACCATAGGGTGTTGGG + Intergenic
1058729798 9:107838840-107838862 CAGGGATAGCTTAAGTGGCCAGG + Intergenic
1060558935 9:124526932-124526954 CTGTGACACCAGTAGGGGCCAGG + Intronic
1188464248 X:30460881-30460903 CAGTGGTTCCATAGGGGTCCTGG - Intergenic
1189483159 X:41408528-41408550 CAGTGATAACCTCAGGGCCCAGG + Intergenic
1189657660 X:43263097-43263119 CAGTGATGCCATCAGGTTCCTGG + Intergenic
1191102237 X:56743403-56743425 CAGTGATGCCATCAGGTCCCAGG + Intergenic
1193412937 X:81186222-81186244 CAGTGAAACCATTGGGTGCCAGG + Intronic
1193981904 X:88191737-88191759 CAGTGACACCATCAGGTCCCGGG - Intergenic
1194352448 X:92837371-92837393 CAGTGACACCATAAGGTCCCAGG - Intergenic
1199803386 X:151273219-151273241 CTGGGCTACCATAAGGGACCAGG + Intergenic
1199899283 X:152157269-152157291 CAGTTATAGCATGATGGGCCTGG + Intergenic
1200660757 Y:5954109-5954131 CAGTGACACCATAAGGTCCCAGG - Intergenic
1200986988 Y:9311829-9311851 CAGAGATACGGTAAGGGTCCAGG - Intergenic
1202118630 Y:21501249-21501271 CAGAGATACGGTAAGGGTCCAGG + Intergenic
1202121082 Y:21524789-21524811 CAGAGATACGGTAAGGGTCCAGG + Exonic
1202123533 Y:21548329-21548351 CAGAGATACGGTAAGGGTCCAGG + Exonic
1202155475 Y:21881051-21881073 CAGAGATACGGTAAGGGTCCAGG - Exonic
1202157923 Y:21904593-21904615 CAGAGATACGGTAAGGGTCCAGG - Exonic
1202206990 Y:22416884-22416906 CAGAGATACGGTAAGGGTCCAGG + Exonic