ID: 1158053069

View in Genome Browser
Species Human (GRCh38)
Location 18:53247119-53247141
Sequence CTATACACACAGTTTGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158053069 Original CRISPR CTATACACACAGTTTGGACT TGG Intronic
906577756 1:46905957-46905979 CCATACTCACAGTCTGGACATGG - Intergenic
907726622 1:57026103-57026125 CTTTACACACAGTATGGTATGGG + Intronic
910253090 1:85218923-85218945 CTACAGACTCAGTGTGGACTAGG - Intergenic
918033049 1:180835726-180835748 TTAAACACACAGTTTGTTCTTGG + Intronic
921163802 1:212491491-212491513 CTACATACACAGATTGGAATGGG + Intergenic
921308499 1:213820440-213820462 ATATACACACACTTTGAATTTGG + Intergenic
922554262 1:226521039-226521061 TTCTACACACAGGTGGGACTTGG - Intergenic
1063492361 10:6476378-6476400 CTATAAACACATTTTAGACTGGG - Intronic
1064784307 10:18877115-18877137 ATATACATACAGTTTTGAGTCGG + Intergenic
1065323919 10:24533966-24533988 CTCTACACAAAGTTTGTTCTAGG - Intronic
1068153355 10:53163150-53163172 CCATAGCCACAGTTTGGATTTGG - Intergenic
1069881906 10:71598455-71598477 CTATGCCCAGAGTTTGGAGTGGG + Intronic
1074310866 10:112322205-112322227 CTATAAACAAAGCTTGTACTGGG - Intergenic
1078537826 11:12189247-12189269 CTTTACACATAGTGGGGACTGGG - Intronic
1087828000 11:102788106-102788128 CGATACACACATTCTTGACTTGG - Intergenic
1087903711 11:103671361-103671383 CTTTACACACAGACTGGAGTTGG - Intergenic
1089185985 11:116615026-116615048 CTTTACACTCAGTTTGGACAGGG - Intergenic
1090509431 11:127358362-127358384 CCACACACACAGTTTGGGCTTGG - Intergenic
1091500362 12:1010932-1010954 TTATATACACAGTGTGTACTAGG + Intronic
1095478084 12:42606417-42606439 CTGTATACACAGTCTGTACTGGG - Intergenic
1097599697 12:61675732-61675754 CTACAAACACACTTTGGTCTTGG - Intergenic
1100566906 12:95804802-95804824 CTATAAACACAATTAGGACGAGG + Intronic
1102177542 12:110887050-110887072 TTATAAAAAGAGTTTGGACTTGG - Intronic
1109334346 13:60974008-60974030 TTACACACACAGATTGTACTTGG - Intergenic
1110540712 13:76703646-76703668 ACATACACACAGTTTGGAGAGGG + Intergenic
1111067726 13:83119089-83119111 GTATACACATGGTTTGGACATGG + Intergenic
1111495546 13:89044419-89044441 TTATACACAGATTTTCGACTGGG - Intergenic
1114310868 14:21465867-21465889 CTATACAAACACCTTGAACTTGG - Intronic
1114524905 14:23361397-23361419 CTAGGCACACTGTCTGGACTAGG - Intronic
1115536523 14:34378454-34378476 CTATAAACTCAGAATGGACTAGG - Intronic
1116556379 14:46315587-46315609 CTATAGTCAGAGGTTGGACTGGG + Intergenic
1118730882 14:68665496-68665518 TTATAGACACAGTTTGGGATGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1127540337 15:59931540-59931562 CTAAAGACACAGTTAGGTCTAGG - Intergenic
1128727189 15:69997005-69997027 ACAGACACACTGTTTGGACTAGG - Intergenic
1133467196 16:6039079-6039101 CTATGCACACAGTTTGGTCTGGG - Intronic
1133596500 16:7298585-7298607 TTATACACAAATTTTGGGCTGGG - Intronic
1135657004 16:24258991-24259013 CTACACCCACAGTTTGTACAAGG + Intronic
1135889042 16:26340918-26340940 CTATACTCCAAGCTTGGACTTGG + Intergenic
1138015573 16:53425408-53425430 ATTTAAACACAGTTTGGACCGGG + Intergenic
1140518610 16:75563180-75563202 ATATACATATATTTTGGACTAGG + Intergenic
1141018841 16:80475910-80475932 CCATACACATAGTTCAGACTTGG + Intergenic
1141267739 16:82512166-82512188 CTAGACACACAGGTAGGCCTCGG - Intergenic
1142171968 16:88627676-88627698 CTCTGCACACAGCGTGGACTCGG + Exonic
1144590487 17:16519688-16519710 CTATAAAAACAGTATGGGCTGGG - Intergenic
1145961444 17:28888570-28888592 TTATACGCCCAGTTTGGAGTGGG - Intronic
1149499708 17:57143012-57143034 CTATACTCACTGTGTGGACTTGG - Intergenic
1152243273 17:79171205-79171227 CAATGAAAACAGTTTGGACTGGG + Intronic
1155843211 18:30671759-30671781 ATATAAACAAAGTCTGGACTAGG + Intergenic
1156883788 18:42111078-42111100 GTTTACACACAGTTTGGCTTGGG + Intergenic
1158053069 18:53247119-53247141 CTATACACACAGTTTGGACTTGG + Intronic
1159242458 18:65759790-65759812 CGAAGCACACAGTCTGGACTAGG - Intronic
1162943946 19:14031318-14031340 CAATGGCCACAGTTTGGACTGGG - Intergenic
1166016624 19:39984955-39984977 TTATACAAACAGTTTTAACTTGG + Intronic
1166561463 19:43735088-43735110 CTATACAGACAGTCTGGATAAGG - Intronic
925657302 2:6164099-6164121 GTAAACACACAGTTAGGACGGGG + Intergenic
926231129 2:11005116-11005138 CTGTTCACACAGGATGGACTAGG - Intergenic
933978609 2:87531893-87531915 CCATACACACAACTTGGACTTGG - Intergenic
936315222 2:111418909-111418931 CCATACACACAACTTGGACTTGG + Intergenic
936648532 2:114400051-114400073 CTGCACACCCAGTTTGGCCTTGG + Intergenic
941083185 2:161086241-161086263 CTATACACAAAGTTTAGTTTGGG + Intergenic
941937573 2:170997355-170997377 CCACACACACAGTTTGGCCTGGG - Intronic
942995485 2:182255178-182255200 CTATAAACACAGGTTGATCTAGG - Intronic
943877056 2:193081241-193081263 CAATAAACACAGTTAGGAATTGG - Intergenic
946342454 2:219079603-219079625 CTAGAGGCAAAGTTTGGACTCGG - Intronic
1174702373 20:52621813-52621835 CTATTCAAACTCTTTGGACTGGG - Intergenic
1179358940 21:40687732-40687754 CTACACACACGGTTTTGCCTGGG - Intronic
1179778093 21:43680838-43680860 CTATACTAACATTTTGGGCTAGG - Intronic
1180618127 22:17141826-17141848 CTAGACACACAGTAAGCACTAGG + Intronic
1182641519 22:31771771-31771793 ACACACACACAGTTAGGACTAGG + Intronic
951598020 3:24339284-24339306 TTAAACACACATTATGGACTGGG + Intronic
951753387 3:26061796-26061818 CCCTACACTCAGTTTGGACCAGG - Intergenic
953848360 3:46446451-46446473 CTATCCACACAGTTAGGATCAGG + Exonic
956638382 3:71390040-71390062 CCATGCACACAGTTTGTTCTTGG - Intronic
961903150 3:130234382-130234404 ATATACACACACTATGGGCTGGG - Intergenic
967271737 3:187738497-187738519 GTAGAGACACAGCTTGGACTCGG + Intronic
967491995 3:190103437-190103459 ATTTACACAGAGTTTGGAATAGG - Intronic
967730798 3:192904983-192905005 CTTTTCACACAGTTTTGATTTGG - Intronic
972696693 4:41453297-41453319 TTATACACAGATTTTTGACTAGG - Intronic
979154481 4:117365655-117365677 CTAGACACACAGGTTGTGCTGGG + Intergenic
991372357 5:65932507-65932529 TTATAAACACAGTTTTGACCTGG + Intronic
993997530 5:94740711-94740733 CTCTGCACACAGTTGGCACTCGG - Intronic
994818421 5:104615292-104615314 CTATACAGACAAGTTGGACAAGG + Intergenic
994878870 5:105460829-105460851 CCATACACAGAGTTTTTACTGGG - Intergenic
996293384 5:121881324-121881346 CTCTACTGACATTTTGGACTTGG - Intergenic
998222914 5:140302614-140302636 CTAAAAACAAAGGTTGGACTTGG + Intronic
1001246668 5:170109965-170109987 CTGAACACACAATATGGACTTGG + Intergenic
1002584724 5:180236631-180236653 CTATACTCATAGTTAGGATTGGG - Intronic
1009675862 6:66820311-66820333 TTAAACACACATTTTGGTCTGGG - Intergenic
1010052487 6:71523695-71523717 CTGAAAACAGAGTTTGGACTTGG - Intergenic
1015800077 6:137051865-137051887 CTATCCAAACAGTGTGGCCTTGG + Intergenic
1026386104 7:69849374-69849396 CTATACACATATATTGTACTAGG - Intronic
1033355286 7:140594284-140594306 CTATACACAAGGTGTGGATTTGG - Intronic
1034741296 7:153475967-153475989 CTCTAGAGACAGTTTGGACTTGG + Intergenic
1039550909 8:38442212-38442234 CTAAACACTCAGGTTGGACCGGG + Intronic
1039737984 8:40352848-40352870 CTATTTAGACAGTTTGGATTTGG + Intergenic
1042477961 8:69270660-69270682 CTAGACAAACAATTTTGACTTGG + Intergenic
1043456057 8:80413133-80413155 CTATAGACACACTTTGAAGTTGG - Intergenic
1045425496 8:102061847-102061869 CTTTATACAAAGTTTTGACTGGG - Intronic
1048479697 8:134777454-134777476 CCATCCACACAGTTTGGCCAAGG - Intergenic
1051411290 9:16792144-16792166 CTATACACTCAGTATGCACCAGG + Intronic
1051974771 9:22936131-22936153 CTATTGACACAATTTGGATTGGG - Intergenic
1053224670 9:36343836-36343858 ATATAGACACAGTGTAGACTGGG + Intronic
1057669610 9:97076712-97076734 CTCTACACTGGGTTTGGACTGGG + Intergenic
1060823894 9:126676647-126676669 CAATACACCCAGTTTGGTCATGG - Intronic
1187018531 X:15355080-15355102 CTCTACACACAGTTTTGGCAAGG + Intronic
1188615888 X:32158772-32158794 CACTACAAACAGTTTGGACATGG + Intronic
1195638549 X:107147448-107147470 CTTTTTACACAGTTTTGACTTGG - Intronic
1198917646 X:141691289-141691311 CTGCACACACAGTATGTACTAGG + Intronic