ID: 1158056645

View in Genome Browser
Species Human (GRCh38)
Location 18:53288420-53288442
Sequence TTTCCCTCAATTATGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158056645_1158056646 29 Left 1158056645 18:53288420-53288442 CCATGTTGCATAATTGAGGGAAA 0: 1
1: 0
2: 0
3: 9
4: 183
Right 1158056646 18:53288472-53288494 TTTTAAAATATTTTATTAATTGG 0: 1
1: 0
2: 39
3: 336
4: 2690

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158056645 Original CRISPR TTTCCCTCAATTATGCAACA TGG (reversed) Intronic
901331298 1:8410817-8410839 TTTCCCTCCAGTATGCACCGTGG + Intronic
902940189 1:19795595-19795617 TTTCTCTCAATAATCCTACAAGG + Intronic
903939951 1:26922687-26922709 TTTGCCTAGATCATGCAACATGG + Intronic
906808791 1:48805470-48805492 ATTTCCTCAACTATGGAACAGGG + Intronic
907519295 1:55012611-55012633 CTTCCCTCATCTATGCATCAGGG + Intergenic
907648067 1:56264187-56264209 CTTCCCCCAATTAAACAACATGG + Intergenic
910391611 1:86751208-86751230 TTTTCCTCACTGATACAACAGGG + Intergenic
913112438 1:115668600-115668622 TTTCTCACAATTCTGCAGCATGG + Intronic
914427186 1:147588159-147588181 TTTCCTTCAATTATGGATCCAGG - Intronic
915495308 1:156278324-156278346 TTTCCCTTCATTATGCAGTATGG + Intronic
916965253 1:169933020-169933042 TTGCCCTCAATTTTGCAAAAAGG - Intronic
921081588 1:211742974-211742996 TTCCCATCAAAAATGCAACAAGG + Intergenic
921725324 1:218516968-218516990 TTCCCCTCAAGCCTGCAACAGGG - Intergenic
921894797 1:220388767-220388789 TTTCCCACCATTAAGCAACCTGG + Intergenic
923126131 1:231036042-231036064 TTTCCCTCCATTTTGGAACCTGG - Intronic
923363571 1:233236724-233236746 TTTCCCTGAATTTTGCATCACGG - Intronic
1063028829 10:2211020-2211042 TTTCTATAAATTATGCAAGATGG + Intergenic
1066459087 10:35597614-35597636 TTTCACTCAGTTGTGAAACAGGG - Intergenic
1069092377 10:64216630-64216652 TTTTCCTCAATTCTGCATGAAGG - Intergenic
1070064739 10:73022206-73022228 TTTCCCCCAGTTAGGCTACACGG - Intronic
1071560935 10:86646483-86646505 TTTCCCTCCATTATGAACAAGGG - Intergenic
1072555438 10:96511206-96511228 TTTGCCTTAAATATGCAACCAGG + Intronic
1074343299 10:112655665-112655687 TTTACTTAAATTATGAAACAAGG - Intronic
1074486015 10:113881043-113881065 TTTCCCTAAAATATACACCATGG - Intronic
1075835147 10:125446605-125446627 AATCCCTCAATTTTGCAACCTGG - Intergenic
1080019019 11:27539790-27539812 TTTCCCTCAATTTAGGAATAAGG + Intergenic
1080354478 11:31426035-31426057 TTTTTCACAATCATGCAACATGG - Intronic
1080672896 11:34397252-34397274 CTTCCCTCATGGATGCAACATGG - Intergenic
1081947028 11:47005780-47005802 ATTCCAACAATTATGTAACATGG - Intronic
1085997702 11:81940727-81940749 TTTCCATCATTTCTACAACAGGG + Intergenic
1087094351 11:94305596-94305618 TTTCCATCAAGTGTGCAGCATGG + Intronic
1087329372 11:96760573-96760595 TTTTCCTCACTTATGAAAAAGGG + Intergenic
1089977858 11:122747892-122747914 GTTCCCTCATTTGTGTAACAGGG + Intronic
1093453331 12:19340148-19340170 TTTACCTCAAAAATTCAACAAGG + Intronic
1093906020 12:24692653-24692675 TTTCCCTCTTTTGTGCAATATGG + Intergenic
1095701570 12:45195972-45195994 TTTGCCTCTATTATCGAACATGG + Intergenic
1098633468 12:72752941-72752963 TGTCCCTAAATATTGCAACAGGG + Intergenic
1099312578 12:81046066-81046088 TTTCTATGCATTATGCAACAAGG - Intronic
1100479240 12:94961950-94961972 TTTACCTCAATAAAGCCACATGG + Intronic
1102168852 12:110826882-110826904 TTTCCTGGAATTGTGCAACATGG + Intergenic
1105575035 13:21642755-21642777 TTTCCTTAGATTATGCAAAAAGG - Intergenic
1106185482 13:27406054-27406076 TTTGCCTCAATTATGCAGTTTGG - Intergenic
1106450977 13:29881914-29881936 CTTCCCTCAATTAGGCACCCAGG + Intergenic
1106842844 13:33704164-33704186 TGTCCCTCCATGATGAAACACGG - Intergenic
1107864527 13:44690881-44690903 TTCCCCTCAATCATGCTAGAGGG + Intergenic
1109046643 13:57421224-57421246 TTCCCCACAATTATGCCACAGGG + Intergenic
1109401754 13:61840221-61840243 TGTGCCTCAACTATGAAACAGGG - Intergenic
1110548153 13:76780018-76780040 TTAACCTCAACTAGGCAACACGG + Intergenic
1112766206 13:102747134-102747156 TTTCCCTCATTAATGAAATATGG + Exonic
1112957247 13:105074804-105074826 TATGCCTCAGTTAAGCAACATGG - Intergenic
1117066660 14:52018348-52018370 TATCCCTGAATAATTCAACAAGG + Intronic
1117359915 14:54962659-54962681 TTTCCCTCAGTTAAGCAAAATGG + Intronic
1120309610 14:82813162-82813184 TCTACTTCAATTATGAAACACGG - Intergenic
1123951326 15:25279309-25279331 TTTTCCTCATTGTTGCAACAAGG + Intergenic
1124075890 15:26443842-26443864 TTTCCCTCAACTCTGCCTCATGG - Intergenic
1128180186 15:65595632-65595654 TTCCCCTAAATTCTGCAAAATGG + Intronic
1131801086 15:96070020-96070042 TTACCATCAATTAAGCCACACGG + Intergenic
1134753551 16:16646700-16646722 TTTCCCTCAAATATCCAGAAAGG - Intergenic
1134992508 16:18712343-18712365 TTTCCCTCAAATATCCAGAAAGG + Intergenic
1138197636 16:55063447-55063469 GTTCCCTTAATTATTCAGCAGGG + Intergenic
1139107367 16:63843058-63843080 TTCCACTCAATTATGCATCATGG - Intergenic
1139860679 16:70018563-70018585 GTTCCCTCAATTATAAAACAGGG + Intergenic
1140440299 16:74982981-74983003 ATTCACTCATTTATTCAACAAGG - Intronic
1140446956 16:75037267-75037289 TTTGCCTCATTTATTAAACAAGG + Intronic
1140716551 16:77731328-77731350 TTTCCATCAATGATGGACCATGG + Intronic
1141692823 16:85606260-85606282 TTTCTCTCAAATATGAAAAATGG + Intergenic
1148524443 17:48317230-48317252 TTTTCCTCAATTATCATACAAGG - Intronic
1149151932 17:53576378-53576400 ATTGCCTGAATTATTCAACACGG - Intergenic
1151040523 17:70855183-70855205 TTTTCCTCAATGAAGCAACAAGG + Intergenic
1157331842 18:46709932-46709954 CTTCCCTCAATCTTGTAACAGGG - Intronic
1158056645 18:53288420-53288442 TTTCCCTCAATTATGCAACATGG - Intronic
1159171983 18:64782579-64782601 TTTACCTCCAATTTGCAACATGG - Intergenic
1159849181 18:73506544-73506566 TTTCCCTTAATTGTGAAAGATGG - Intergenic
1159997454 18:74980113-74980135 TTTCCCTCTATTCTGAAAGAAGG + Intronic
1160090279 18:75820411-75820433 TTTCTCTCTGATATGCAACAAGG + Intergenic
1160600857 18:80011502-80011524 TTTCCCACAATATTGCAGCAAGG - Intronic
1162606624 19:11713918-11713940 TTTCCCTCATTCATCCAACTTGG + Intergenic
1166621715 19:44306810-44306832 TTTCCCTCCATTATTCCTCAAGG + Intergenic
1168412850 19:56150610-56150632 TTTCCAGCAATGATACAACATGG + Intronic
928656767 2:33460254-33460276 TTTCCCTTAATAATGTATCATGG - Intronic
929334299 2:40722055-40722077 TTTCCCTGAATTGTGCCATAAGG + Intergenic
929728728 2:44462410-44462432 TTTCACTCAATAATGAAACTTGG + Intronic
930445523 2:51466672-51466694 TTTCCCTTAAATATGCCTCAAGG + Intergenic
931005216 2:57842936-57842958 CTTCCCTGAATAATGAAACAAGG + Intergenic
931009550 2:57893580-57893602 TTCCAATCAATTATGCAGCACGG + Intergenic
931488443 2:62717821-62717843 TATCCCTAAATTAGTCAACATGG - Intronic
933162250 2:79038362-79038384 TTTCCCTCATTGATACAAAATGG + Intergenic
936765652 2:115845480-115845502 TTTCCCTCAGATATTCTACATGG + Intronic
937798817 2:126057784-126057806 TTTCCTTCATTTATGAAACTTGG + Intergenic
937871146 2:126787283-126787305 CTTCCCCCAAGTATGAAACAGGG - Intergenic
937879566 2:126855335-126855357 TTTGGCTCATTTATGTAACACGG - Intergenic
938323234 2:130379805-130379827 TTTCCCTCATCTAGGAAACATGG - Intergenic
939646380 2:144704255-144704277 TTATCCTTAATTATGTAACATGG - Intergenic
939933819 2:148263690-148263712 TCTCCCTTAATTGTGCAGCAGGG - Intronic
942379419 2:175373014-175373036 TTTTCCTCAAGAATGCAAGATGG + Intergenic
943400338 2:187401557-187401579 TTTCCCTCAACTATGTACAATGG - Intronic
943723131 2:191226209-191226231 TTTCACTCATGTAGGCAACATGG - Intergenic
944785748 2:203068179-203068201 TTTTTTTGAATTATGCAACATGG - Intronic
947478496 2:230474151-230474173 ATTTCCTCATTTATGAAACAGGG - Intronic
948276842 2:236715426-236715448 TTTCACTAACTGATGCAACATGG - Intergenic
1172503872 20:35446666-35446688 ATTTCCTCATTTATGAAACAAGG - Intronic
1173722994 20:45276494-45276516 CTTCCCTCTATTATGGTACATGG - Intergenic
1175141282 20:56861964-56861986 TTTCCTTCCAGTAGGCAACAGGG - Intergenic
1176132873 20:63503644-63503666 CTTCCCTCAATTAGGCAGCTGGG + Intergenic
1176358275 21:5970727-5970749 TCTCCCTCAATAATTCAATATGG - Intergenic
1178571143 21:33738307-33738329 GTTCCCTCATTTATATAACAGGG - Intronic
1179765243 21:43567824-43567846 TCTCCCTCAATAATTCAATATGG + Intronic
1180629633 22:17219464-17219486 TTTCCCTCCAGTGTGCACCAGGG + Exonic
1183867169 22:40713086-40713108 TTTCCCTCAATTCTATAGCAAGG + Intergenic
1184505243 22:44896839-44896861 TTTCTGTCACTTATGAAACAGGG + Intronic
949514339 3:4793767-4793789 TTTCCCTCATTTATACAATGAGG + Intronic
950100552 3:10353980-10354002 TTTCTCTCATAAATGCAACAGGG + Intronic
950504282 3:13384400-13384422 TTTTCCTCATGTATGAAACAGGG + Intronic
951918449 3:27826754-27826776 TCTTCCTCAATTATGGGACATGG - Intergenic
955103110 3:55871058-55871080 TATCCCTCAATTAGGTAACCAGG - Intronic
955197373 3:56817677-56817699 ATGCCCTCATTTATACAACAGGG - Intronic
959085978 3:101850614-101850636 TTCCCCCAAATTATGCAACTCGG - Intronic
961367903 3:126413072-126413094 TTGCCCTCAATTAGGAATCATGG - Intronic
964980796 3:162675923-162675945 GTTCACTCAATGATGCAAAAAGG + Intergenic
965789424 3:172372018-172372040 ATTCTCTCAATAATGCTACAAGG + Intronic
967096722 3:186183287-186183309 TTTTCCTCAACTATGAAATAGGG + Intronic
970495943 4:16626127-16626149 TTTCCCTCATTTATACAAAGGGG - Intronic
970710205 4:18852901-18852923 TTTGCCTTATTTATGCACCATGG - Intergenic
971233526 4:24819974-24819996 TTTTCCTCTTTTCTGCAACAGGG - Exonic
971694676 4:29885273-29885295 TTTACCTCATTTATGCAGTATGG + Intergenic
972563665 4:40250638-40250660 TTTCCCTGCAGTATGTAACAAGG - Intergenic
975108411 4:70595663-70595685 TTTCCTTCAGTTATACCACAAGG - Intronic
975165278 4:71171470-71171492 GTTCCCTCAATTGTAGAACAGGG + Intergenic
975960058 4:79891651-79891673 TTTCCCTGAATTATAGCACAAGG - Intergenic
976698182 4:87940537-87940559 TTTTTCTCCATTATGCAACTGGG - Intergenic
977042099 4:92028534-92028556 TTACCCTACATTTTGCAACAGGG + Intergenic
977787285 4:101051714-101051736 TTTACTTCCCTTATGCAACATGG + Intronic
978442194 4:108745166-108745188 TTTACCTATATTATGCAACTAGG - Intronic
979469077 4:121072995-121073017 TTTCCCTCTATTGTGCACCCCGG - Intronic
980295371 4:130907948-130907970 TTTACCACAGTTATTCAACATGG + Intergenic
980714954 4:136616309-136616331 TTTCCCTACTTTTTGCAACAGGG + Intergenic
982511775 4:156291241-156291263 TTTCCCCTAATTCTACAACATGG + Intergenic
982678712 4:158405091-158405113 TTTGCCTCAATTATGCAGGTGGG - Intronic
986473284 5:8096880-8096902 TTTCCCTGAATTATTTATCAAGG - Intergenic
987111876 5:14695614-14695636 TTTCCCTGTATTATGCTTCATGG + Exonic
987338450 5:16918352-16918374 TTTCCCTCAATATTGCTTCATGG + Intronic
987437988 5:17921518-17921540 TTTTCCTCAATTAAGGAAAACGG + Intergenic
991433671 5:66573829-66573851 CTTCCTTCATTTATGCAACTGGG + Intergenic
992311383 5:75503512-75503534 TTTCCTTTAAATATGTAACATGG + Intronic
993030234 5:82697187-82697209 TGTCACTGAATTCTGCAACATGG - Intergenic
994165683 5:96605999-96606021 TTTCCCTCAAATATCAAATATGG + Intronic
994636622 5:102352005-102352027 TGTCTCTCAGTTAGGCAACACGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996494566 5:124138922-124138944 TTTTCCTCAGGTATGCATCAGGG - Intergenic
996794347 5:127328091-127328113 TTTCTCTAAATTAGGAAACATGG - Intronic
997188947 5:131912209-131912231 GTTACCTCATTTATGCAAAAGGG + Intronic
998062797 5:139132431-139132453 CTTCCCTCAATAATTCCACATGG + Intronic
998441294 5:142164547-142164569 GTTCTCTCAATTAAGCAAAATGG + Intergenic
998664029 5:144275300-144275322 TTGCACTTAATTATGCAAAATGG + Intronic
999528871 5:152439472-152439494 TTTCCCTCATTTGTGAAATAGGG - Intergenic
1000305735 5:159992919-159992941 CTTCCCTCATCTATGCAAGAAGG + Intergenic
1000356433 5:160400370-160400392 TTTCTCTCATTTATTCCACATGG - Intergenic
1000605773 5:163326126-163326148 CTTTCCTCAATTATGAAAGATGG - Intergenic
1003197362 6:3926880-3926902 TTTCCCTCAATGCTGTAAGAAGG - Intergenic
1003284051 6:4718780-4718802 TTTCACTCGATTATGTATCATGG + Intronic
1003483765 6:6556850-6556872 TTTTCCACAGTTAGGCAACATGG - Intergenic
1004066503 6:12250570-12250592 TTTCCCCAGATTATGCAACATGG - Intergenic
1007082940 6:39121541-39121563 TTACCCTCCTTTTTGCAACAGGG + Intergenic
1008246441 6:49179705-49179727 TTTTCCTCATATATGGAACATGG - Intergenic
1008746280 6:54673403-54673425 TTTCCATCGATTATTCATCAAGG - Intergenic
1008797973 6:55328778-55328800 TTTCCCTCCTTCATGCAACCTGG - Intronic
1009598129 6:65762901-65762923 TTTCTCTCCTTTATGCAACAGGG + Intergenic
1011171570 6:84510387-84510409 TCTCCCCAAATTGTGCAACATGG + Intergenic
1011790499 6:90893555-90893577 TTTCCCTCACGCATGCCACAAGG - Intergenic
1011960856 6:93088273-93088295 TTCCTTTCAATTATGCAAAAGGG - Intergenic
1012861387 6:104564046-104564068 TTTCCCTGAATTTTGAGACATGG - Intergenic
1017791418 6:157802900-157802922 TTTCCCTATATTCTGGAACATGG - Intronic
1020528511 7:9296597-9296619 TTTCCTGCAAATATGCAACTAGG - Intergenic
1026439780 7:70434045-70434067 TTTGCCTCATTTTTGCAAGATGG + Intronic
1030934515 7:115568590-115568612 TTTTCCTGAATTATGCAAGTGGG - Intergenic
1033496658 7:141904778-141904800 TTTCCTTTAATTAGGAAACAGGG + Intergenic
1037505465 8:19525173-19525195 TTTTCATCAATTTGGCAACAGGG - Intronic
1038655002 8:29442352-29442374 TTTCCCTCAATAATGTTATATGG - Intergenic
1041865404 8:62567524-62567546 TTTTCCTAAATTATCCAAAAGGG + Intronic
1042905219 8:73765702-73765724 TTTCATTCAATAATGTAACAAGG - Intronic
1046834129 8:118780422-118780444 TTTGCTTCAGTTATGCAACCAGG + Intergenic
1047496132 8:125410271-125410293 TTTCCCTCAAGGTTGCAAGATGG - Intergenic
1047743762 8:127828254-127828276 TTTCCCTCACCTGTACAACAAGG - Intergenic
1055364905 9:75533001-75533023 TATCCCTCAGCAATGCAACAGGG + Intergenic
1057836515 9:98449755-98449777 CTTCTGTCAATTATGCAACCAGG - Intronic
1062133288 9:134911951-134911973 ATTCCTTCAATCATGCCACAGGG + Intronic
1187091235 X:16099020-16099042 TTTCCCAGAGTTATGTAACAAGG + Intergenic
1191084336 X:56547907-56547929 TTTCTCTCAGTTAGGCTACAAGG - Intergenic
1194767503 X:97859041-97859063 TTTCCCACAATCCTTCAACAGGG - Intergenic
1195537958 X:106030298-106030320 TTTCCCTGTATGATGCACCAAGG + Intergenic
1200958645 Y:8975050-8975072 TTTTCCTCAGTTATTAAACATGG + Intergenic
1201353507 Y:13072314-13072336 TTTCTCCCAATTAGGCTACATGG - Intergenic
1201428550 Y:13881925-13881947 GTTCCCTACATTATGAAACAAGG - Intergenic