ID: 1158059477

View in Genome Browser
Species Human (GRCh38)
Location 18:53321176-53321198
Sequence GCACTATTTCAGATGAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158059477 Original CRISPR GCACTATTTCAGATGAATGG GGG Intronic
905130917 1:35756514-35756536 GGACTAATAGAGATGAATGGAGG - Intronic
907660188 1:56384583-56384605 GCACTATTTCAGAATGTTGGAGG - Intergenic
909074555 1:71037599-71037621 ATACTATTTCAGATATATGGGGG - Intronic
911187183 1:94915856-94915878 CCCCTATTTCAGATGAAAAGAGG + Intronic
912256382 1:108062949-108062971 GCACTGTTTCATATGATTGTTGG - Intergenic
915754993 1:158250791-158250813 GCTCTATTTCATTTGAATGAGGG + Intergenic
916040716 1:160958919-160958941 GCACTAATTGTGATGAAAGGCGG - Intergenic
916181206 1:162085289-162085311 GTTCTATTTCAGAGGAATAGGGG + Intronic
917654905 1:177116649-177116671 GTATTATTTCAGTAGAATGGTGG - Intronic
920945061 1:210521162-210521184 ACACTATTTCATATAAATGTTGG - Intronic
921260436 1:213381406-213381428 GAACTAGATCAGATTAATGGGGG - Intergenic
923132151 1:231085630-231085652 GTAGCATTTCAGATGAGTGGGGG - Intergenic
1068625157 10:59237061-59237083 TCTCTATTTCAGGTGAATGGAGG + Intronic
1070274612 10:74993671-74993693 GTACTATTCCAGATTAAAGGAGG - Intronic
1078682268 11:13487896-13487918 GCACTACTTCAGGGGTATGGAGG + Intergenic
1084118081 11:67053504-67053526 CCAGTATTTCAGATGAATGTGGG + Intergenic
1085588401 11:77733323-77733345 GCACTTTTTCATATGAATACTGG + Intronic
1087273023 11:96131086-96131108 ACACTATTTAAGATGTATGTTGG + Intronic
1088180531 11:107104109-107104131 GCATTCCTGCAGATGAATGGAGG + Intergenic
1090191599 11:124774178-124774200 GCTCTATTCAAGATAAATGGAGG + Intronic
1091100806 11:132871678-132871700 GCACTGTTGCAGATGAACAGAGG - Intronic
1096924459 12:55127747-55127769 GCACTATTTGGTATGAATAGTGG + Intergenic
1099079933 12:78164706-78164728 GCAAGACTTCAGATGCATGGTGG + Intronic
1099393166 12:82104439-82104461 GCACTTTTTCACATGATTGTTGG - Intergenic
1102324412 12:111967338-111967360 GCACTATTTCATTTGAATTGTGG + Intronic
1104167168 12:126243613-126243635 GCACTCTTGCAGATGAAAGATGG - Intergenic
1105080690 13:16113012-16113034 CAACTCTGTCAGATGAATGGAGG - Intergenic
1105082040 13:16133572-16133594 CAACTCTGTCAGATGAATGGAGG - Intergenic
1105082497 13:16140422-16140444 CAACTCTGTCAGATGAATGGAGG - Intergenic
1105223594 13:18357489-18357511 GCATTGTTTCAGGTGAAAGGTGG + Intergenic
1107746989 13:43520857-43520879 GCTCTATTTAAGATCAGTGGTGG + Intronic
1109155118 13:58900200-58900222 GGACTACTTTAGATAAATGGTGG + Intergenic
1109483682 13:62990878-62990900 GCACTCTTTCATATGTTTGGTGG + Intergenic
1113375145 13:109758455-109758477 GCACTTTGTCATATAAATGGCGG + Intronic
1113678836 13:112227805-112227827 ACAGTATTTCAGGTGACTGGAGG - Intergenic
1115839284 14:37448829-37448851 GGACTCTTTCATATGTATGGAGG + Intronic
1115964376 14:38870752-38870774 TGAATATTTCAGATGAATGTGGG + Intergenic
1116527929 14:45929997-45930019 GTACTATTTCTGAAGGATGGGGG + Intergenic
1116615661 14:47135053-47135075 GTACTATTTCAGTGGAATGTTGG - Intronic
1117733498 14:58747088-58747110 ACACCCTTCCAGATGAATGGAGG - Intergenic
1121272132 14:92644826-92644848 TCACTATTTCACATGAAGGTTGG - Intronic
1129488077 15:75895763-75895785 GCACTCTTACAGATGGCTGGTGG + Intronic
1141217618 16:82039748-82039770 TCAATATTTGAGATGACTGGAGG - Intronic
1146703725 17:34984252-34984274 GAAATATTTCAGATTAAAGGAGG - Intronic
1148581256 17:48745559-48745581 GCACTGTTTCAGATGCCTAGTGG - Intergenic
1149711589 17:58747291-58747313 ACATTCTTTCAGATGAATGCAGG - Intergenic
1150050396 17:61957017-61957039 GCAGTATTGCTGATGAATTGAGG - Intronic
1151763760 17:76121878-76121900 GGACTGGTTCAGAGGAATGGAGG - Intergenic
1153877271 18:9385168-9385190 GAACTTTTTCTGACGAATGGAGG - Intronic
1153966988 18:10191121-10191143 GAACTTTATCACATGAATGGGGG - Intergenic
1155834348 18:30560084-30560106 GTACTATTTCTGAGAAATGGGGG - Intergenic
1157011691 18:43656808-43656830 CCACTAACTCAGATGACTGGAGG + Intergenic
1157372125 18:47124043-47124065 GCACAATTGCAAATCAATGGGGG + Intronic
1157900086 18:51506549-51506571 GCAATAGTTCAGAGGAATGGTGG + Intergenic
1158059477 18:53321176-53321198 GCACTATTTCAGATGAATGGGGG + Intronic
1159692387 18:71505015-71505037 GCAATAATCCAGATGACTGGAGG + Intergenic
1165046170 19:33106736-33106758 GCATTATTTCAGACCCATGGTGG + Exonic
927273667 2:21241879-21241901 GCAGTAATTGAGTTGAATGGTGG - Intergenic
930726264 2:54684786-54684808 GAACTGTTCCAGATGAAAGGAGG + Intergenic
933026511 2:77266628-77266650 GCACTGTCTCAGGTGATTGGTGG - Intronic
935012438 2:99148078-99148100 GAACTGTTTCAGATTAAAGGAGG - Intronic
938172193 2:129089127-129089149 TAACTATTTCAGAAGAATAGAGG + Intergenic
942476048 2:176321927-176321949 GCACTATGAAAGATGAATTGTGG + Intronic
942554985 2:177162709-177162731 GCACTATTTCGAATGAAAGGAGG + Intergenic
943451837 2:188052199-188052221 GCATTAGTTCAGCTGAATGAAGG + Intergenic
948299608 2:236892880-236892902 GCACTGTTTCAGTTGCATGTTGG + Intergenic
1169662071 20:7990520-7990542 GCTCTACCTCAGATGCATGGAGG - Intronic
1171038057 20:21732776-21732798 GAACTGTTCCAGATGAAAGGAGG - Intergenic
1173987781 20:47275947-47275969 GCACTGTTTAATATGAATGTAGG + Intronic
1174334504 20:49849362-49849384 GCAGTGTTTCAGATGAAAGATGG + Intronic
1176261675 20:64185182-64185204 TCAATATTCCAGAAGAATGGAGG + Intronic
1176732137 21:10509870-10509892 GCATTGTTTCAGGTGAAAGGTGG + Intergenic
1177883763 21:26724055-26724077 GCACCACTTCAGATGCCTGGGGG + Intergenic
950322168 3:12066824-12066846 GCACAATTTCACATGGCTGGGGG + Intronic
951377669 3:21941132-21941154 GCACTATTTCTATTGTATGGTGG + Intronic
951997240 3:28744728-28744750 GCTCTATATCTGAAGAATGGGGG - Intergenic
952100761 3:30010465-30010487 GCACTGTTCCAGATTAAAGGTGG - Intergenic
953878088 3:46677620-46677642 GCAGCATTTCAGATGTAGGGAGG - Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
959304849 3:104649269-104649291 GCACTCTTTCACATTATTGGTGG - Intergenic
960596076 3:119409388-119409410 GCCCTGTTTCAGAAGGATGGAGG - Intronic
961069107 3:123904898-123904920 ACAATTTTGCAGATGAATGGGGG + Intronic
966029919 3:175333318-175333340 GCCCTATTTCTGGTGAATGTGGG + Intronic
971709240 4:30090365-30090387 GCACTTTTTCATATGATTGTTGG - Intergenic
973534782 4:51869801-51869823 GCAGTATTTCTGATTAATGTGGG + Intronic
977819954 4:101459519-101459541 GAACTATTACAGTTGATTGGAGG - Intronic
979568113 4:122179903-122179925 GTACCATTCCAGATCAATGGAGG + Intronic
981385407 4:144124679-144124701 GAAATATTTCAGACGAAGGGAGG - Intronic
987900968 5:24011673-24011695 GTACCATATCAGATTAATGGTGG - Intronic
989652983 5:43714287-43714309 GCCCTGTTTCTGATGGATGGTGG + Intergenic
989946982 5:50248027-50248049 GAACTGTGTGAGATGAATGGAGG + Intergenic
991592593 5:68269103-68269125 GCATTATTTCAAAAGAAAGGAGG - Intronic
995502771 5:112825915-112825937 CCACTGTTGCAGGTGAATGGAGG + Intronic
996903382 5:128570211-128570233 TCACTATTTCAGAGGGATGAAGG - Intronic
997591879 5:135079009-135079031 GCACTATCTCAGCTGCAGGGAGG - Intronic
998727706 5:145036710-145036732 GAGCAGTTTCAGATGAATGGTGG - Intergenic
1002482311 5:179510799-179510821 ACATTATTTCATATGAATGCTGG - Intergenic
1003041289 6:2689986-2690008 TCACTGTTTCAGATTAATAGAGG + Intronic
1009254153 6:61354694-61354716 GAGCTCTTTGAGATGAATGGAGG + Intergenic
1009258839 6:61456515-61456537 GAGCTCTTTGAGATGAATGGAGG + Intergenic
1011052547 6:83169265-83169287 GCAGTATTTCAGCTGGCTGGAGG - Exonic
1014149901 6:118042694-118042716 GCAATAGTCCAGATGAATGATGG + Intronic
1014508803 6:122294611-122294633 GCACTATATCACATGATTTGGGG + Intergenic
1015339800 6:132085273-132085295 GCACTGTTTCAGAGGTATGCTGG + Intergenic
1015408122 6:132860260-132860282 GCTGTATTTAAGATGAGTGGTGG + Intergenic
1016979823 6:149843870-149843892 GCACTGTTTCAGGGGGATGGTGG - Intronic
1017663712 6:156698123-156698145 GGAGCATTTCAGATCAATGGAGG + Intergenic
1018115569 6:160580672-160580694 GCACTTTTTCAGGTGATTGTTGG + Intronic
1026573606 7:71553885-71553907 GCACTATTTAAGAGGAAAGCTGG - Intronic
1027342278 7:77222335-77222357 GCACTATTACTGATGAATACTGG + Intronic
1028846987 7:95492347-95492369 GAAATATTACAGATGAATTGAGG + Intronic
1030671578 7:112344032-112344054 AAACTATTTCAGATTAAAGGTGG + Intergenic
1034597446 7:152211534-152211556 GCATTGTTTCAGGTGAAAGGTGG - Intronic
1036801889 8:11798776-11798798 GCACTATTCCAGATGGTTGAGGG + Intronic
1037210841 8:16385279-16385301 GCACTTTTTCATATGCCTGGTGG + Intronic
1038885843 8:31662365-31662387 GCACTTTTCCTGATGAATGAAGG + Intronic
1041674911 8:60528158-60528180 GCACTATTATGCATGAATGGAGG - Intronic
1042340789 8:67676767-67676789 GCACTTTTATAAATGAATGGGGG - Intronic
1042880561 8:73483848-73483870 GCACTATGTTAGATGCATGTAGG - Intronic
1047363056 8:124186634-124186656 GAACTATTCAAGATGAAAGGAGG + Intergenic
1047558560 8:125961354-125961376 GTAATATTTCACATGAATAGTGG + Intergenic
1049113224 8:140662935-140662957 GAGCTGTTTCAGATGAAAGGAGG + Intronic
1051061841 9:13053970-13053992 GCATTATATCAGATGAAGGTAGG + Intergenic
1054362250 9:64185407-64185429 GAGCTCTTTGAGATGAATGGAGG + Intergenic
1060027914 9:120188499-120188521 GCAGTAGTTCAAATGACTGGAGG - Intergenic
1186997940 X:15143550-15143572 GCACTTTTTCAGTTGAAGTGCGG + Intergenic
1187697460 X:21936655-21936677 CCATTTTTTCAGATGAATGTGGG - Intergenic
1188735937 X:33715964-33715986 GCAGTATTTCTGAAGAAAGGCGG - Intergenic
1191747530 X:64506204-64506226 GCACTATTTCATATGCTTGTTGG - Intergenic
1192736090 X:73850797-73850819 GCACCAATACAGAGGAATGGAGG + Intergenic
1199657240 X:150008228-150008250 GAACTAGTTCAGATGATTGTGGG - Intergenic
1199778079 X:151033234-151033256 TCAGGATTTCATATGAATGGGGG + Intergenic
1200892285 Y:8336767-8336789 TCACTATTCCAGATGGATGGAGG + Intergenic
1202247583 Y:22835516-22835538 TCACTATTACAGATGGATGGAGG + Intergenic
1202400571 Y:24469264-24469286 TCACTATTACAGATGGATGGAGG + Intergenic
1202470209 Y:25200822-25200844 TCACTATTACAGATGGATGGAGG - Intergenic