ID: 1158061064

View in Genome Browser
Species Human (GRCh38)
Location 18:53342957-53342979
Sequence ATGTATATATAGATGTATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1249
Summary {0: 1, 1: 0, 2: 3, 3: 97, 4: 1148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158061064 Original CRISPR ATGTATATATAGATGTATTG TGG Intronic
901288236 1:8100207-8100229 ATATATATATATATATATGGAGG + Intergenic
903627032 1:24738259-24738281 ATATATATATATATTTATGGAGG - Intergenic
904105988 1:28084552-28084574 ATATATATATATATATATTTTGG - Intronic
904150067 1:28431192-28431214 ATATATATATATATATATTTTGG - Intronic
904336183 1:29799955-29799977 ATATATATATATATGTATAAAGG - Intergenic
904753013 1:32752951-32752973 ATATATATATATATATATTTTGG + Intronic
905141254 1:35846613-35846635 ATATATATATATATATATTTAGG + Intronic
905411244 1:37769992-37770014 GTGTATGTATATATGTATTAGGG - Intergenic
905836137 1:41123218-41123240 ATGTATGTATGTATGTATTGAGG - Intronic
906769208 1:48469486-48469508 ATATATATATATATGTTGTGTGG + Intronic
907209079 1:52803065-52803087 GTGTATATATATATATATAGTGG - Intronic
907744149 1:57195956-57195978 ATGAATTTATAGATAAATTGTGG + Intronic
908030226 1:59991275-59991297 ATGTATTTATAGATGTTCTTTGG + Intronic
908677170 1:66618315-66618337 TTGTGTATATAGATGCATTAGGG - Intronic
909010461 1:70328925-70328947 TTGTATGTATACATGTATAGGGG + Intronic
909058165 1:70846729-70846751 ATCTTTATATTAATGTATTGAGG + Intergenic
909157399 1:72095622-72095644 ATGTATATGTAGATGACATGGGG - Intronic
909320839 1:74283753-74283775 ATCTACATATATATGTATAGAGG - Intronic
909473612 1:76057348-76057370 ATATATATATATATATATTAAGG - Intergenic
910011332 1:82466853-82466875 ATATATATATATATATATTTGGG + Intergenic
910153224 1:84180196-84180218 ATATATATATATATGTATGATGG + Intronic
910421874 1:87073618-87073640 ATGTATATATAGTTTAGTTGTGG + Intronic
910898947 1:92098386-92098408 ATTTATATATAAATTTTTTGTGG + Intronic
910910299 1:92226755-92226777 ATGTAGATACTGATGTATTTGGG + Intronic
910946627 1:92599521-92599543 ATATAAATATAGATATATAGAGG - Intronic
911252907 1:95598759-95598781 ATGTATATATACATTTTTGGGGG + Intergenic
911440086 1:97915336-97915358 ATATATATTTATATGTATTGAGG - Intronic
911484597 1:98489516-98489538 ATATATATATATATATATTTTGG + Intergenic
911509589 1:98794805-98794827 ATATATATATAAATTTAATGAGG - Intergenic
911694677 1:100876566-100876588 ATTTATATTTTGGTGTATTGGGG - Intronic
911704350 1:100993586-100993608 ATATATATATATAGCTATTGTGG + Intronic
911755110 1:101544959-101544981 ATATATATATATATATATTTAGG + Intergenic
911757988 1:101582594-101582616 CTGTATCTATAGAATTATTGAGG + Intergenic
911794767 1:102061313-102061335 ATGTATATTTAGTTGTTTTTGGG - Intergenic
911854175 1:102855913-102855935 ATGTATATTTTGTTGTTTTGGGG + Intergenic
911999167 1:104808762-104808784 AGATATATATAGATATATAGAGG + Intergenic
911999169 1:104808796-104808818 AGATATATATAGATATATAGAGG + Intergenic
912025835 1:105170880-105170902 ATGTATATGTATATATTTTGTGG - Intergenic
913077967 1:115357366-115357388 AGGTATATAAAGATTTACTGTGG - Intergenic
913255539 1:116950032-116950054 TGGTATATACAGATATATTGTGG - Intronic
914821242 1:151105489-151105511 ATGTATATATATATATGTTTGGG + Intronic
914878186 1:151527929-151527951 ATATATATATATATATAGTGTGG - Intronic
915149545 1:153819232-153819254 ATGTATATCTAGAGGAAATGTGG - Intronic
915418389 1:155759986-155760008 ATATATATATATATGTTTTCTGG + Intronic
916188416 1:162155217-162155239 ATGTATATATATATGTATAAAGG - Intronic
916188417 1:162155420-162155442 ATGTATATATGTATGTATATAGG - Intronic
916302036 1:163286033-163286055 CTGTATATATATATATAGTGGGG - Intronic
916320006 1:163493368-163493390 ATGTATGTATGTATGTATTATGG + Intergenic
916624998 1:166546008-166546030 GTGTACATATATATGAATTGTGG + Intergenic
917117794 1:171620060-171620082 ATATATATATATATGTAAAGGGG - Intergenic
917231130 1:172839287-172839309 ATATATATATATATATATGGTGG + Intergenic
917289541 1:173458126-173458148 ATGTATATATAAAAGAAATGTGG + Intergenic
917346081 1:174029465-174029487 ATATATATATATATGTATTTTGG - Intergenic
918021435 1:180696214-180696236 ATATATATATATATATATTATGG + Intronic
918112359 1:181468134-181468156 ATGTATCTAGAGATGTGATGTGG - Intronic
918174562 1:182031506-182031528 ATGTATAAATAGATGTTTTAAGG + Intergenic
918648616 1:186931207-186931229 ATCTTTATATAGATGTATATGGG - Intronic
918681686 1:187362967-187362989 ATATATATATATATGTATAAAGG - Intergenic
918689883 1:187466965-187466987 ATGTGAATCTAGATGTATTCAGG - Intergenic
919342455 1:196329942-196329964 ATATATATATATATGTCTTGAGG - Intronic
919346449 1:196385775-196385797 ATATATATATATATATATTTTGG + Intronic
919553230 1:199018985-199019007 GTGTATATATATATTTATTTTGG + Intergenic
919671745 1:200344644-200344666 ATGTAAATCTTGATGTAATGAGG + Intergenic
919932920 1:202233274-202233296 ATGTAGGTAAAGATGCATTGAGG + Intronic
920380680 1:205532951-205532973 ATATATATATATATATAGTGAGG + Intergenic
920460208 1:206133893-206133915 ATTTGTATACAGATGTATAGGGG - Intergenic
920833710 1:209488332-209488354 ATGTATATAAAGAAGTGTGGAGG + Intergenic
920983112 1:210856874-210856896 ATATATATATATATATATAGTGG - Intronic
921015396 1:211185673-211185695 ATATATATATATATATATAGTGG + Intergenic
921429395 1:215046328-215046350 ATGTATATATTCATGAATTTTGG + Intronic
921444600 1:215230582-215230604 ATATATATATATATATATTACGG - Intronic
921501438 1:215908967-215908989 ATGTATATATAGATATATATAGG - Intronic
921837906 1:219796506-219796528 ATATATATATATATATATTTAGG + Intronic
922380962 1:225025338-225025360 ATATATATATATATGTTTTGTGG + Intronic
922690654 1:227686812-227686834 ATGTATTTATAGATTAATTTTGG - Intergenic
922779283 1:228238927-228238949 ATGTGTATATAGGTGTATGTGGG - Intronic
922790589 1:228308825-228308847 GTGGATAAATAGATGGATTGTGG - Intronic
922794178 1:228331403-228331425 ATATATATATATATATATGGTGG - Intronic
922862244 1:228829502-228829524 ATATATATATATATGTAAAGAGG + Intergenic
922997008 1:229972139-229972161 ATGCATGTATATATGTAGTGTGG - Intergenic
923355370 1:233149881-233149903 ATTTATATATATATAAATTGAGG - Intronic
923400494 1:233611793-233611815 AAATATACATACATGTATTGTGG - Intergenic
923464597 1:234236947-234236969 ATATATATATATATATATGGAGG + Intronic
923825839 1:237499365-237499387 ATTTAAATATAGAAGTAGTGTGG + Intronic
924162665 1:241249634-241249656 ATGAATCTATAGATCTTTTGGGG + Intronic
924179040 1:241423259-241423281 ATGTATATATAACTTTATTGAGG + Intergenic
924360108 1:243230857-243230879 ATGTGTGTATTGATGTATTTTGG - Intronic
924402355 1:243699462-243699484 ATATATATATATATATATAGTGG - Intronic
924467285 1:244310070-244310092 ATATATATATATATATATTTTGG - Intergenic
924587143 1:245369869-245369891 ATGTGTATATAAATATAATGAGG + Intronic
924925243 1:248673126-248673148 ATATATATATATATATATTTGGG + Intergenic
1063036545 10:2291214-2291236 TTGTATATATTTATTTATTGGGG - Intergenic
1064025131 10:11842814-11842836 ATGTATACATACATATATTTGGG - Intronic
1064127612 10:12677324-12677346 ATTTATATATAAATATATTAAGG - Intronic
1065124509 10:22561241-22561263 ATGCATGTACAGATGTCTTGAGG - Intronic
1065234446 10:23634745-23634767 ATGTATATTTTGATGATTTGGGG - Intergenic
1065270081 10:24020606-24020628 GTGTGTATATATGTGTATTGGGG - Intronic
1065270364 10:24025577-24025599 ATGAATCTACAGATGAATTGGGG + Intronic
1065406040 10:25366317-25366339 ATGTATAAATTGATGTAATCTGG - Intronic
1065457151 10:25918650-25918672 ATGTATATATAGGTATATAGAGG + Intergenic
1065458173 10:25929480-25929502 ATGTATATGTAAATGTTTTGAGG + Intergenic
1065495624 10:26324801-26324823 ATATATATATATATATATGGTGG - Intergenic
1066169898 10:32830168-32830190 ATGTATATACACATGTATTAGGG - Intronic
1066335117 10:34468621-34468643 TTGTTTTTATAGATGTGTTGAGG - Intronic
1066608609 10:37210414-37210436 ATGCATACATAGGTTTATTGGGG - Intronic
1066982013 10:42425058-42425080 ATGTGTTTATTGATGTGTTGGGG + Intergenic
1067158727 10:43804289-43804311 ATATATATATATATATATTTTGG - Intergenic
1067312843 10:45131181-45131203 ATATATATATAAATGCATTTAGG - Intergenic
1067983070 10:51109425-51109447 ATGTATCTATATATGTGTTGGGG - Intronic
1068172547 10:53414807-53414829 ATATATATATATATATATTTGGG + Intergenic
1068333105 10:55598509-55598531 ATATATATATATATATATTAGGG - Intronic
1068740913 10:60469415-60469437 ATATATATATATATATATGGTGG + Intronic
1068740915 10:60469441-60469463 ATATATATATATATATATGGTGG + Intronic
1068740925 10:60469553-60469575 ATATATATATATATATATGGTGG + Intronic
1068740927 10:60469579-60469601 ATATATATATATATATATGGTGG + Intronic
1068740929 10:60469603-60469625 ATATATATATATATATATGGTGG + Intronic
1068740931 10:60469637-60469659 ATATATATATATATATATGGTGG + Intronic
1068740933 10:60469663-60469685 ATATATATATATATATATGGTGG + Intronic
1068978824 10:63039081-63039103 ATGTAATTATTGATGTATTAGGG - Intergenic
1069235810 10:66071586-66071608 GTGTATATATTGGTATATTGTGG - Intronic
1069378961 10:67822643-67822665 ATGAATATATGGATATATTCAGG + Intronic
1069492851 10:68876115-68876137 ATATATATATATATATATTCTGG - Intronic
1069506011 10:68998722-68998744 ATGTATGTATGTATGTAGTGGGG - Intronic
1070046658 10:72844577-72844599 ATATATATATAGATATTCTGAGG + Intronic
1070066219 10:73037522-73037544 ATATATATATATATATATAGTGG - Intronic
1070104752 10:73420962-73420984 ATGTGTATGTGTATGTATTGGGG - Intergenic
1070595178 10:77827873-77827895 AGGTATATATAGATTTGTAGGGG + Intronic
1070908166 10:80093177-80093199 ATATATATATATATATATTTTGG + Intergenic
1070938950 10:80326372-80326394 ATATATATATATATATATTCAGG - Intergenic
1071145065 10:82559261-82559283 ATGTGAATAAAGATGTATTTAGG + Intronic
1071314391 10:84379672-84379694 ATGGATATATAAATGCATTAAGG - Intronic
1071758974 10:88578961-88578983 ATGTATATATGCATGTGTAGGGG + Intronic
1072067224 10:91883102-91883124 ATATATATATATATATTTTGTGG - Intergenic
1072763092 10:98074101-98074123 ATGTATAAATAAATATACTGTGG + Intergenic
1073487957 10:103833452-103833474 ATATATATATATATGTCTTTGGG - Intronic
1073695034 10:105856626-105856648 ATGTGTATATATATATATAGTGG + Intergenic
1073923760 10:108489329-108489351 ATATATATATATATATATAGTGG - Intergenic
1073961408 10:108934138-108934160 ATGTATATATATATAAATTATGG + Intergenic
1074130757 10:110571976-110571998 AGTTATTTATAGATGGATTGTGG + Intronic
1074297099 10:112200216-112200238 ATATATATATACATATAGTGTGG - Intronic
1074980756 10:118618397-118618419 ATGTATGTGTATATGTATTTCGG + Intergenic
1075215712 10:120531806-120531828 ACATATATATATATGTACTGTGG - Intronic
1075284733 10:121173472-121173494 AAGTAAATATACATGTATCGGGG - Intergenic
1075285059 10:121176723-121176745 GTGTATATATATATATATTCAGG - Intergenic
1076922315 10:133460463-133460485 ATATATATATATATGAATTTCGG - Intergenic
1077738093 11:4813013-4813035 ATGTATATATATATATATATGGG + Intronic
1077885877 11:6387241-6387263 ATATATATATATATGTTTTTTGG - Intergenic
1078962943 11:16300757-16300779 ATGTAGATCTAGAAGTGTTGAGG - Intronic
1078998604 11:16730025-16730047 ATATATATATATATATATTTAGG - Intronic
1079118846 11:17662283-17662305 TTGAATATATAGATAAATTGGGG - Intergenic
1079173422 11:18117437-18117459 ATATATATACAGATATATAGTGG - Intronic
1079188183 11:18255756-18255778 ATGTATATATATATGTATATTGG + Intergenic
1079205734 11:18412896-18412918 TTGTATATGTCGATGTATTCAGG + Intronic
1079400112 11:20100005-20100027 ACTTAGATATAGATGCATTGGGG + Intronic
1079702457 11:23565695-23565717 ATATATATATATATGCCTTGTGG - Intergenic
1079826282 11:25199670-25199692 ATATATATATATATATATGGTGG - Intergenic
1080040063 11:27750509-27750531 TTGTTTATATACATTTATTGAGG + Intergenic
1080235964 11:30068771-30068793 AGGTATACTTACATGTATTGAGG - Intergenic
1080309490 11:30872986-30873008 ATTTATATATATATATATTCAGG - Intronic
1080862728 11:36163825-36163847 ATGGAAATATACATATATTGGGG + Intronic
1080980597 11:37399713-37399735 ATATATATATATATATATTTTGG + Intergenic
1081001323 11:37676132-37676154 ATGTATATATATGTTTATTAAGG + Intergenic
1081063766 11:38513148-38513170 ATGTACATATATGTTTATTGTGG - Intergenic
1081141031 11:39500525-39500547 ATATATATATATATGCATTATGG - Intergenic
1081309240 11:41550470-41550492 ATGTACATATATGTTTATTGTGG + Intergenic
1081369253 11:42278664-42278686 ATATATATATATATATATTTAGG + Intergenic
1081464958 11:43307945-43307967 ATGTATATATATATATATATTGG + Intergenic
1082271606 11:50178221-50178243 ATATATATATATTTGTATTTAGG + Intergenic
1082727574 11:56754806-56754828 ATTTATATATATATGTTTTTTGG - Intergenic
1082751714 11:57026017-57026039 ATATATATATATATATATTCTGG + Intergenic
1082921624 11:58501215-58501237 ATATATATATAGATATGCTGAGG - Intergenic
1082968764 11:58996544-58996566 TTGTATATTTAGATATTTTGTGG - Intronic
1083134879 11:60662870-60662892 ATGTATAGATTGATTGATTGAGG - Intergenic
1083980652 11:66165717-66165739 ATTTATATATATATGTATTAAGG + Intronic
1084241134 11:67821099-67821121 ATATATATATATAGGTATGGTGG - Intergenic
1084351816 11:68606982-68607004 ATTTATATTTTGATGTATTTTGG - Intronic
1084559914 11:69898581-69898603 ATATATATATATATATATTAGGG - Intergenic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1085659129 11:78346670-78346692 ATATATATATATATATATGGAGG - Intronic
1086326310 11:85704047-85704069 ATATAAATATTGATGTATTTGGG - Intronic
1087540382 11:99509779-99509801 ATTAATAAATAGATGTATTAAGG - Intronic
1087654272 11:100903703-100903725 ATATATATATATATATTTTGAGG - Intronic
1087780543 11:102297087-102297109 ATGTATATGTATGTTTATTGCGG - Intergenic
1087952532 11:104240571-104240593 ATGTATATATGTATGTATGGAGG + Intergenic
1087980072 11:104601254-104601276 GTATATATATATATGTACTGTGG + Intergenic
1088077308 11:105866567-105866589 ATATATATATATATATATTCAGG + Intronic
1088650612 11:111954924-111954946 ATGTATATATATACATATGGGGG - Intronic
1088791036 11:113226606-113226628 ATGTATATTTTGTTGAATTGGGG - Intronic
1088826922 11:113503675-113503697 ATATATATATATATATATTGAGG - Intergenic
1088981592 11:114869464-114869486 ATATATATATTTATATATTGAGG - Intergenic
1089714587 11:120345743-120345765 CTGTATATATATATATATTTAGG - Intronic
1089970644 11:122690306-122690328 ATATATATATATATATAATGAGG + Intronic
1090059501 11:123451841-123451863 ATATATATATGTATGTATGGTGG + Intergenic
1090071505 11:123548287-123548309 ATATATATATATATATATTTTGG - Intronic
1090133092 11:124166279-124166301 ATATATATATATATATATTGCGG + Intergenic
1090356581 11:126144589-126144611 ATATATATATGTATGTATGGTGG - Intergenic
1090810064 11:130231192-130231214 TTGTATATATAGTAGTATTTAGG - Exonic
1091510844 12:1123999-1124021 ATGTATATATAGCAGCAATGAGG + Intronic
1092303142 12:7271820-7271842 ATGTATACATAGTTGAATTATGG - Intergenic
1092582481 12:9858686-9858708 GTGTATATATATATGTATATAGG + Intronic
1092608047 12:10141657-10141679 ATATATATATAAAAGAATTGAGG - Intergenic
1092620325 12:10258159-10258181 ATATGTTTATAGAGGTATTGGGG - Intergenic
1093052193 12:14516572-14516594 AGGTATGTATACATGTATGGGGG + Intronic
1093135981 12:15451290-15451312 ATATATATATATATGTATATAGG - Intronic
1093323434 12:17742438-17742460 ATATATATATATATATATGGTGG - Intergenic
1093397139 12:18696319-18696341 ATATATATATATATATATAGTGG - Intronic
1093721050 12:22442688-22442710 ATGGATATATATATATATTATGG - Intergenic
1093811735 12:23500229-23500251 ATATATATATATATATATAGTGG - Intergenic
1093834693 12:23814066-23814088 ATTTATTTATAGATGTATTTTGG + Intronic
1094102116 12:26775925-26775947 ATATATATATATATGTAAAGGGG - Intronic
1094405544 12:30112325-30112347 ATATATATATATATATATGGGGG - Intergenic
1095199836 12:39370795-39370817 ATATATATACATATATATTGTGG - Intronic
1095249321 12:39960093-39960115 ATGTAAATATATCTTTATTGGGG + Intronic
1095336225 12:41030347-41030369 AAGGATGTATATATGTATTGTGG - Intronic
1096342459 12:50812954-50812976 ATATACATATACATGTATTTTGG + Intronic
1096868595 12:54579340-54579362 ATATATATATATATATATTTAGG + Exonic
1097329883 12:58321345-58321367 ATGTATATATTTATGTTTTTAGG + Intergenic
1097547268 12:61019606-61019628 ATATATATATATATGTATGGTGG - Intergenic
1098236851 12:68425650-68425672 ATGTATTTAGAGAAGTTTTGTGG - Intergenic
1098298334 12:69027592-69027614 AAGGATATAGAGAAGTATTGAGG - Intergenic
1098469803 12:70830163-70830185 ATGTATTTGTTGATGTTTTGTGG + Intronic
1098485064 12:71011077-71011099 ATTTATATATATATATATAGCGG - Intergenic
1098593142 12:72238271-72238293 ATATATATATATATATATTAAGG - Intronic
1098652543 12:72991310-72991332 ATGTATATATTTATGTATGTGGG + Intergenic
1099008892 12:77267672-77267694 ATATATATATGTATGTATTCTGG + Intergenic
1099074566 12:78090148-78090170 ATATATATATGTATGTATTTGGG - Intronic
1099366262 12:81768135-81768157 ATATATATATATATGTAAAGGGG - Intergenic
1099391324 12:82082936-82082958 ATACATATATATATGTATTTAGG + Intergenic
1099418605 12:82424546-82424568 ATATATATATATATGTATAAAGG + Intronic
1099444412 12:82735139-82735161 ATTTAAACATAGATGTTTTGAGG - Intronic
1099536998 12:83857413-83857435 ATATATATATATATATATTCAGG - Intergenic
1099582815 12:84474229-84474251 ATATATATATGTATGTATGGTGG - Intergenic
1099689245 12:85929574-85929596 ATGCATATATGTATGTTTTGTGG + Intergenic
1099730776 12:86497889-86497911 ATATATATATATATATATTTAGG - Intronic
1099799324 12:87437515-87437537 GTGTATATATATATGGATTATGG - Intergenic
1100066746 12:90656131-90656153 ATGTATATATATATATATATAGG + Intergenic
1100627706 12:96353159-96353181 ATGTATTTATATATGTTTTTTGG - Intronic
1100662468 12:96715018-96715040 ATGGATGGAGAGATGTATTGTGG + Intronic
1100755194 12:97743676-97743698 CTATATATATATATATATTGGGG + Intergenic
1101858229 12:108462088-108462110 ATATATATATATATATATTTTGG - Intergenic
1102282862 12:111632250-111632272 ATGTATATATATATATATGTAGG + Intergenic
1102291468 12:111703898-111703920 ATATATATATATATAAATTGTGG - Intronic
1102321613 12:111940458-111940480 ATGTATATATATATATGTGGGGG - Intronic
1102674871 12:114650589-114650611 ATATATATATATATGTTTTTAGG + Intergenic
1103178918 12:118890497-118890519 ATGAATAGATAGATGTATGAGGG + Intergenic
1103278199 12:119731809-119731831 ATATATATATATATATATTTAGG - Intronic
1103436165 12:120928783-120928805 ATATATATATATATGTAAAGGGG + Intergenic
1103538038 12:121646885-121646907 ATGTATGTATATATTTATTTGGG - Intergenic
1104097826 12:125575066-125575088 ATATATATATATATATATTCAGG + Intronic
1104269039 12:127265508-127265530 ATATATATATATATATATTCTGG - Intergenic
1104925730 12:132313186-132313208 ATGGATGTACAGATGTATGGAGG - Intronic
1105312618 13:19226395-19226417 GTGTATATATATATTTTTTGAGG - Intergenic
1105446266 13:20460234-20460256 ATATACATATATATGTAATGTGG - Intronic
1105500745 13:20969738-20969760 ATATATATATATATATATGGCGG + Intergenic
1105774483 13:23644829-23644851 GTGTATATATATATATATTTGGG + Intronic
1105873721 13:24534953-24534975 GTGTATATATATATGTATATGGG + Intergenic
1106601989 13:31196182-31196204 ATATATATATATATATATTTAGG - Intergenic
1106894418 13:34283056-34283078 ATATATATATATATTTATTTAGG + Intergenic
1107414177 13:40186062-40186084 GTGTATATATATATGTATGTTGG + Intergenic
1107606636 13:42063949-42063971 ATATATATATATATATACTGTGG + Intronic
1107678478 13:42821118-42821140 ATATATATATACATATATTTAGG + Intergenic
1107860244 13:44653779-44653801 ATATATATATATATATATGGTGG - Intergenic
1108208028 13:48110833-48110855 ATATATATATACATATATTCTGG - Intergenic
1108399469 13:50024599-50024621 ATGAAAATATAGATGTATATGGG + Intergenic
1108625786 13:52227479-52227501 ATATATATATATATATATTTTGG - Intergenic
1108775849 13:53764117-53764139 ATGTATATTTTGTTGTTTTGAGG - Intergenic
1109269319 13:60236738-60236760 ATGTCAATATTGATGTTTTGTGG - Intergenic
1109454770 13:62570677-62570699 ATATATATATATATGTAATGGGG + Intergenic
1109660282 13:65449675-65449697 ATATATATATATATATATGGAGG + Intergenic
1109672960 13:65634508-65634530 ATATATATATATATGTATATTGG - Intergenic
1109769366 13:66950826-66950848 ATGGATAGATAGATGGCTTGTGG - Intronic
1109774458 13:67021902-67021924 ATGTGTATATATATGTATGTAGG + Intronic
1109837611 13:67878978-67879000 ATGTTTATTTAGATATATTTAGG - Intergenic
1109903335 13:68803586-68803608 ATATATATATATATTTTTTGAGG - Intergenic
1110009905 13:70319129-70319151 ATATATATATATATATAGTGTGG + Intergenic
1110057969 13:71001470-71001492 ATGTATATACATAAGTATTTGGG - Intergenic
1110110013 13:71734100-71734122 GTGTATATATATATGTATATGGG + Intronic
1110444390 13:75561901-75561923 ATGCACATATATATGTATAGTGG + Intronic
1110959615 13:81604967-81604989 ATATATATATATATATATTTGGG - Intergenic
1110975590 13:81830050-81830072 ATGTAGATATAGATATATGATGG + Intergenic
1111044720 13:82799502-82799524 ATGTATTGATTGATGTATTATGG - Intergenic
1111141358 13:84123693-84123715 AAGGATATAAAGATGGATTGGGG + Intergenic
1111187147 13:84752903-84752925 ATGTGTATATATAAGTTTTGAGG - Intergenic
1111190750 13:84803474-84803496 ATGTATATCTATAGGCATTGAGG + Intergenic
1111294073 13:86257295-86257317 ATATATATATATATATATTTCGG - Intergenic
1111330087 13:86754563-86754585 ATATATATATATATATATAGCGG - Intergenic
1111330089 13:86754578-86754600 ATATATATATATATATATGGTGG + Intergenic
1111399642 13:87717760-87717782 ATATATATATATATATATGGAGG + Intergenic
1111460518 13:88535906-88535928 ATATATATATATATATATTTTGG + Intergenic
1111477878 13:88776790-88776812 ATATATATATATATATATTTTGG - Intergenic
1111495926 13:89050096-89050118 ATGTATCTATAGTTTTATAGAGG - Intergenic
1111822607 13:93231306-93231328 ATATATATATATATGAAATGAGG - Intronic
1111849653 13:93556416-93556438 ATATATATATATATATATTTTGG + Intronic
1111849655 13:93556418-93556440 ATATATATATATATATTTTGGGG + Intronic
1112210595 13:97373608-97373630 ATATATATATATATATATTAAGG + Intronic
1112665289 13:101564570-101564592 ATGTACATATATATGTATCCTGG + Intronic
1112680484 13:101759296-101759318 ATATATATGTACATGTATTAGGG + Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112781773 13:102908513-102908535 ATGTATATGTAGATTCATTTAGG + Intergenic
1112818838 13:103307005-103307027 GTGTATATATATATGTATATAGG + Intergenic
1112835162 13:103505971-103505993 ATGTATATTTTGTTGAATTGGGG + Intergenic
1112850686 13:103702348-103702370 ATGTACATGTATATTTATTGCGG - Intergenic
1112945872 13:104926274-104926296 ATGTATATATATATATATGATGG + Intergenic
1112997508 13:105592467-105592489 ATATATATATATATGTATATAGG + Intergenic
1113297223 13:108972380-108972402 ATATATATATATATATATAGTGG + Intronic
1113320131 13:109225041-109225063 ATATATATATATATGTATAGGGG + Intergenic
1113336591 13:109382862-109382884 ATATATATATATATATATGGTGG + Intergenic
1114753005 14:25227171-25227193 ATGCATGTATATGTGTATTGGGG + Intergenic
1114846444 14:26328735-26328757 ATATATATATATATATATTTTGG - Intergenic
1114901700 14:27068702-27068724 ATGTGTATATATAAATATTGTGG + Intergenic
1115019876 14:28664559-28664581 ATATATATATATATGTATGATGG + Intergenic
1115037597 14:28878359-28878381 ATGTATATATATATGAATATAGG + Intergenic
1115083337 14:29484032-29484054 ATATATATATATATATATTTGGG + Intergenic
1115256428 14:31407624-31407646 ATATATATATATATGTATTTTGG + Intronic
1115450801 14:33544875-33544897 ATGTATGTATGTATATATTGTGG + Intronic
1115724560 14:36198907-36198929 ATTTATATATTTATTTATTGGGG - Intergenic
1116115071 14:40637520-40637542 ATGTATATATATATGTATATTGG + Intergenic
1116301649 14:43190720-43190742 ATGTATATTTTGTTGTTTTGGGG - Intergenic
1116327715 14:43553076-43553098 ATATATATATATATGTATATAGG + Intergenic
1116370214 14:44121186-44121208 ATATATATATAAATGGATTCTGG - Intergenic
1116507971 14:45709010-45709032 AGGCATATATATATATATTGTGG - Intergenic
1116671550 14:47848595-47848617 ATGTATATTTTGTTGTTTTGGGG - Intergenic
1117315749 14:54568725-54568747 ATATATATATATATATAATGCGG + Intronic
1118173687 14:63415013-63415035 ATATATATATATATATTTTGTGG + Intronic
1118522443 14:66599851-66599873 ATCTATATCTATATGTATTCAGG + Intronic
1118868499 14:69722036-69722058 AAATAAATATAGAAGTATTGTGG + Intergenic
1119147171 14:72327925-72327947 ATATATATAAGGATTTATTGTGG + Intronic
1119311230 14:73648395-73648417 ATATATATATATATGAAATGAGG - Intronic
1119927550 14:78510042-78510064 ATATATATATATATATATTTTGG + Intronic
1120249072 14:82040110-82040132 ATGTATTTATTGGTGTATTGAGG - Intergenic
1120398252 14:83995632-83995654 ATGTATTTAAAGATGTATATAGG + Intergenic
1120549219 14:85848603-85848625 ATGTATATATAAATATATGAAGG - Intergenic
1120573538 14:86152107-86152129 ATATATATATATATATATTCAGG - Intergenic
1120660475 14:87243292-87243314 ATATATATATATATAAATTGAGG + Intergenic
1121056057 14:90854017-90854039 GTGTATACACACATGTATTGGGG - Exonic
1121596108 14:95164028-95164050 ATGTATATATATGTGTATTAGGG - Intergenic
1121670663 14:95708515-95708537 ATATATATATATATATATGGAGG + Intergenic
1123440401 15:20286884-20286906 ATATATATATATATGTGTTTTGG + Intergenic
1124360976 15:29036212-29036234 AAATATATATATATGTATTCAGG - Intronic
1124504105 15:30257470-30257492 ATATATATATAGATTTATTTTGG + Intergenic
1124695411 15:31860703-31860725 ATGTATATATATATATTTTTTGG + Intronic
1124739448 15:32281176-32281198 ATATATATATAGATTTATTTTGG - Intergenic
1124799753 15:32820510-32820532 CTATATATATATATGTGTTGGGG - Intronic
1125180267 15:36874945-36874967 ATATATATATATATGTAGTTGGG + Intergenic
1125462234 15:39918451-39918473 ATGTATATATATGTATATTGGGG + Intronic
1125472418 15:40017541-40017563 ATATATATATATATGTATTTTGG + Intronic
1125665136 15:41424650-41424672 ATGTACATGTAGATGTATACTGG + Intronic
1126038350 15:44568100-44568122 AATTATATATAGATGTTTTCAGG + Intronic
1126307898 15:47281859-47281881 ATCTATATTTAGATGTATCGTGG - Intronic
1126413181 15:48393233-48393255 ATATATATATATATATATTTAGG + Intergenic
1126430194 15:48575349-48575371 ATGTATGTATGTATGTATTTAGG + Intronic
1126641713 15:50833702-50833724 ATATATATATATATGAAGTGGGG - Intergenic
1127252715 15:57257685-57257707 ATATATATATATATATATAGTGG + Intronic
1127769676 15:62221090-62221112 ATATATATATATATATATTTGGG - Intergenic
1128042830 15:64590686-64590708 ATGTATATATATATGTATCTGGG + Intronic
1128315879 15:66659066-66659088 ATGTCTATATGTGTGTATTGGGG + Intronic
1128409810 15:67383592-67383614 ATGTTTAGAAAGATGTATTGTGG - Intronic
1129410138 15:75346208-75346230 GTGTATATATATATATATTTGGG + Intergenic
1129511459 15:76126383-76126405 ATATATATATATATATATAGTGG + Intronic
1131480519 15:92776864-92776886 ATATATATATATATATATTGAGG + Intronic
1131714015 15:95088894-95088916 TTGTATATATGTATGCATTGTGG + Intergenic
1132270411 15:100519386-100519408 ATTTAAATATAGATGTCTTTAGG + Intronic
1132378059 15:101344913-101344935 ATGTATTTAAAAATGTATTTGGG - Intronic
1132811947 16:1804243-1804265 ATATATATATATATATATAGAGG - Intronic
1133138228 16:3727126-3727148 ATGTATAGATAGATGTGTGTGGG + Exonic
1133343905 16:5057288-5057310 ATGTGTATATATATATATAGTGG + Intronic
1133524003 16:6586540-6586562 ATGTATATATAGCTGGTTTGGGG + Intronic
1133814519 16:9186401-9186423 ATGTATGTATGTATGTATGGAGG + Intergenic
1134632514 16:15767090-15767112 ATGAATGTATAAATGTATAGAGG + Intronic
1135124673 16:19798428-19798450 ATATATATATATATATATTTCGG + Intronic
1135246124 16:20858569-20858591 ATGTATATATACATATTTGGGGG + Exonic
1136000508 16:27288893-27288915 ATATATATACTTATGTATTGTGG + Exonic
1137069404 16:35888147-35888169 ATTTATATATATATCTTTTGGGG + Intergenic
1137237945 16:46630551-46630573 ATATATATATATATATATTTGGG - Intergenic
1137489251 16:48917341-48917363 ATATAGATATAGATATATGGGGG + Intergenic
1137570308 16:49561359-49561381 GTGTGTATATAGATGTATAGAGG + Intronic
1137841004 16:51640819-51640841 ATGTATATAAAAATCTCTTGAGG + Intergenic
1137972096 16:52995646-52995668 ATATATATATATATATATTCTGG + Intergenic
1138252996 16:55520042-55520064 ATGTAATTATTGATGTATTTGGG - Intronic
1138718805 16:59054528-59054550 ATATATATATATATATATAGTGG + Intergenic
1138806571 16:60097132-60097154 ATATATATATATATGTAAAGGGG + Intergenic
1138929702 16:61637998-61638020 ATATATATATATATGCATTTAGG + Intergenic
1139458016 16:67098087-67098109 CTGTAAATATAGATTTGTTGTGG + Intronic
1139791006 16:69435243-69435265 ATGCATATATAGACTTATTATGG + Intronic
1139928143 16:70503353-70503375 ATGTTTGTAAAGATGTCTTGGGG - Intronic
1140247560 16:73265007-73265029 ATATATATATATATGCACTGAGG - Intergenic
1140937044 16:79682369-79682391 GTGTATATATATATTTATTGAGG + Intergenic
1141126799 16:81406607-81406629 ATCTATATATATATATATTTTGG - Intergenic
1141357616 16:83363380-83363402 ATGTGTGTATACATGCATTGTGG + Intronic
1141591836 16:85074273-85074295 ATGTATATATAAATGGAATATGG - Intronic
1141933833 16:87222972-87222994 ATGTATAGATGAATGTATTTGGG - Intronic
1142913520 17:3114853-3114875 ATATATATATACATATTTTGTGG + Intergenic
1144060375 17:11578705-11578727 ATATATATATATATGTATATGGG - Intergenic
1144060386 17:11578849-11578871 ATATATATATATATATATAGAGG - Intergenic
1144066466 17:11628867-11628889 ATGTATGTATATATTTATTTTGG + Intronic
1144234767 17:13248546-13248568 ATCTATATATTGCTGGATTGAGG - Intergenic
1144900584 17:18585454-18585476 ATATATATATATATATATTTTGG - Intergenic
1145032191 17:19512832-19512854 ATATATATATATATATATTCTGG - Intronic
1145895781 17:28456521-28456543 ATGTATAAAGAGATGTGTTATGG - Intronic
1145984961 17:29039638-29039660 ATATATATATATATATATTCTGG + Intronic
1146097239 17:29943037-29943059 ATATATATATATATATATTTTGG - Intronic
1146334392 17:31956776-31956798 ATGTATATATATATATTTTTTGG + Intronic
1146514215 17:33476523-33476545 ATATATATATATATGTACAGGGG + Intronic
1147567065 17:41544081-41544103 ATATATATATAAATATATTTGGG - Intergenic
1147837647 17:43346311-43346333 ATGTATATATACATATTTGGGGG - Intergenic
1148881308 17:50729936-50729958 ATATATATATGTATGTATTTTGG + Intronic
1148939628 17:51197100-51197122 ATATATATATATATATATGGAGG + Intronic
1148971719 17:51489550-51489572 ATATATATATATATACATTGTGG - Intergenic
1149133607 17:53338658-53338680 ATGTATGTATATGTGTATTTAGG - Intergenic
1149236425 17:54595574-54595596 ATATATATATATATGTATAAAGG + Intergenic
1149236436 17:54595774-54595796 ATATATATATATATATATTTAGG - Intergenic
1149803409 17:59591708-59591730 ATTTATATATACATATATAGAGG - Intronic
1149827769 17:59845173-59845195 ATTTATATATATATTTTTTGAGG - Intergenic
1149949798 17:60973595-60973617 ATATATATATATATGTATGAAGG + Intronic
1149957882 17:61073639-61073661 GTGTATATATAAATGTCTTTTGG + Intronic
1150430837 17:65115692-65115714 ATGTATATATATATATATTTTGG - Intergenic
1150869326 17:68887877-68887899 ATATATATATATATATATGGAGG - Intronic
1150889655 17:69132849-69132871 ATGTATGTATATATGTATGTAGG - Intronic
1151048812 17:70952733-70952755 TTGGATGTATAGATGTATAGTGG - Intergenic
1151134105 17:71928399-71928421 ATATATATATATATGTAAAGGGG - Intergenic
1151853100 17:76702875-76702897 ATATATATATATATATCTTGAGG + Intronic
1152182806 17:78835001-78835023 ATATATATATATATATATTTTGG + Intronic
1153104329 18:1510034-1510056 ATATATATATAGTTGTTTTATGG + Intergenic
1153167323 18:2277368-2277390 ATGTATATATATATATAATTAGG - Intergenic
1153378603 18:4410681-4410703 ATATATATATATATATATTTGGG - Intronic
1153442553 18:5136682-5136704 AGGTATATTTATGTGTATTGGGG - Intergenic
1153490513 18:5642634-5642656 AAGTATATATATATGTATGCAGG + Intergenic
1153644562 18:7183711-7183733 ATGTACATATATGTTTATTGCGG + Intergenic
1153725653 18:7952068-7952090 ATGCATATATACATGCATTGTGG - Intronic
1155473818 18:26217703-26217725 ATGTATATATTGAAGTATTTAGG + Intergenic
1155573425 18:27219835-27219857 ATATATATATATATGTAAAGGGG - Intergenic
1155672285 18:28386872-28386894 ATATATATATATATATATTCTGG - Intergenic
1155725005 18:29070416-29070438 ATGTGAATATAAATGTAATGAGG - Intergenic
1155869972 18:31015172-31015194 AAATGTATATAAATGTATTGGGG + Intronic
1155881636 18:31156523-31156545 ATGTATAAATGATTGTATTGTGG - Intronic
1156084449 18:33382240-33382262 ATGTATACATATATCTATTGGGG - Intronic
1156299492 18:35823734-35823756 ATGTATATATGCATGTATATAGG - Intergenic
1156563941 18:38162538-38162560 ATGTATATATAGGTATATATAGG - Intergenic
1156744823 18:40377104-40377126 ATGTATAGATACATTCATTGGGG - Intergenic
1156770959 18:40724439-40724461 ATTTATATATAGCTGTTTTATGG + Intergenic
1156787563 18:40933658-40933680 ATATATATATATATATATGGGGG + Intergenic
1156805178 18:41169829-41169851 ATATATATATAAATGTATAAGGG + Intergenic
1156995391 18:43459737-43459759 ATATATATATATATATATTCTGG - Intergenic
1156995395 18:43459845-43459867 ATGAATATATATATATATTCTGG - Intergenic
1157178612 18:45475620-45475642 ATATATATATATATATATTTAGG + Intronic
1158003096 18:52642030-52642052 ATATATATATATATATACTGTGG + Intronic
1158061057 18:53342726-53342748 ATATATATATATATATATTTGGG - Intronic
1158061064 18:53342957-53342979 ATGTATATATAGATGTATTGTGG + Intronic
1158140088 18:54246298-54246320 ATATATGAATAGATATATTGTGG - Intergenic
1158239878 18:55365152-55365174 ATATATATATATATATATTTTGG - Intronic
1158470445 18:57731302-57731324 ATATATATATATATATTTTGAGG - Intronic
1158473106 18:57756186-57756208 ATATATATATATATATGTTGTGG - Intronic
1159273883 18:66190621-66190643 ATATATATATATATATATGGAGG + Intergenic
1159305934 18:66641950-66641972 ATATATATATATATATATTTTGG + Intergenic
1159484472 18:69036997-69037019 ATGTGTATATATATGTGTGGGGG + Intronic
1159528770 18:69628493-69628515 ATATATATATATATATATTTGGG + Intronic
1159830243 18:73268394-73268416 GTTTATATATATATGTATAGAGG + Intergenic
1160068766 18:75606073-75606095 GTGTATATATATATGCTTTGTGG + Intergenic
1160290714 18:77590637-77590659 CTGTTTTTATAGCTGTATTGGGG + Intergenic
1160315090 18:77836131-77836153 ATGAATAGATGGATGAATTGGGG + Intergenic
1160438492 18:78869510-78869532 ATATATATATATATATATTTGGG - Intergenic
1160438498 18:78869579-78869601 ATATATATATATATATATTTGGG - Intergenic
1162993406 19:14318349-14318371 ATATATATATATATATATTTGGG + Intergenic
1163165720 19:15496381-15496403 ATATATATATATATATCTTGAGG - Intronic
1163806822 19:19404753-19404775 TTGTACATATAGATTTATTAGGG + Intronic
1163950404 19:20579533-20579555 ATGTATATATATATATGTTTTGG - Intronic
1164524444 19:29003099-29003121 ATATATATATATATATATAGGGG + Intergenic
1164578977 19:29422659-29422681 GTGTATATATATATGTGGTGGGG - Intergenic
1164889535 19:31811464-31811486 ATATATATATATATATATAGTGG - Intergenic
1164900313 19:31914401-31914423 TTGTATATATGTATATATTGAGG - Intergenic
1165019624 19:32913284-32913306 ATATATATATATATATATGGTGG - Intronic
1165281709 19:34803532-34803554 ATTTATAGAAAGATGTACTGGGG - Intergenic
1165503237 19:36206849-36206871 ATGTATATATAGATGTCAGGTGG + Intronic
1165685342 19:37815114-37815136 ATGTACTTATATATGTGTTGTGG + Intronic
1165763335 19:38335543-38335565 ATATATATATATATATATTTGGG + Intergenic
1165952946 19:39484679-39484701 ATGTGTTTATATATTTATTGTGG + Intronic
1166313025 19:41973838-41973860 GTGTATGCATAGATGTCTTGGGG + Intronic
1166380988 19:42355260-42355282 ATATATATATAACTTTATTGAGG + Intronic
1166404979 19:42513889-42513911 ATATATATATATATATATGGAGG - Intronic
1166492761 19:43272838-43272860 ATTTATTTATTGATGTGTTGAGG + Intergenic
1166582176 19:43910908-43910930 ATGAATATATAGATGAGTTTGGG - Intergenic
1166962982 19:46510575-46510597 ATATATATATATATATATAGTGG + Intronic
925074705 2:1005800-1005822 ATATATATATATATATTTTGAGG - Intronic
925074818 2:1007065-1007087 ATATATATATGTATGTATAGGGG + Intronic
925296827 2:2782843-2782865 ATATATATATATATATATTTAGG + Intergenic
925561973 2:5205896-5205918 ATATATATATATATATATGGGGG - Intergenic
925844439 2:8022816-8022838 ATGTATTTTTAGATTTCTTGAGG - Intergenic
925922936 2:8649476-8649498 ATGTATATATATATGTGTGTAGG + Intergenic
926364815 2:12123316-12123338 ATATATATATAGATATATATGGG - Intergenic
926364819 2:12123362-12123384 ATATATATATAGATATATATGGG - Intergenic
926364821 2:12123386-12123408 ATATATATATAGATATATATGGG - Intergenic
926666453 2:15529155-15529177 AAGTATATATATATGTGCTGAGG + Intronic
926719007 2:15944974-15944996 ATGTATGTATGTATGTATGGGGG + Intronic
926854375 2:17237348-17237370 TTTTATATATACATATATTGGGG + Intergenic
926931343 2:18044204-18044226 TTCTATATATAGATCTACTGGGG + Intronic
927349986 2:22099799-22099821 ATATATATATATATGTACTCTGG + Intergenic
928073862 2:28244975-28244997 GCGTATATATATATTTATTGTGG + Intronic
928192435 2:29184874-29184896 ATCTATATATATATTTTTTGAGG + Intronic
928434468 2:31245524-31245546 ATATATATATATATATATTTGGG - Intronic
928564547 2:32531208-32531230 ATTTAGATATAGCTGTATTATGG - Intronic
928621684 2:33095312-33095334 GTTTATATATAGATGTTTGGGGG - Intronic
928823080 2:35386724-35386746 ATATATATATATATGAAATGAGG + Intergenic
928889225 2:36182732-36182754 ATCTATATATAGATATATATAGG + Intergenic
928889228 2:36182766-36182788 ATCTATATATAGATATATATAGG + Intergenic
928889231 2:36182800-36182822 ATCTATATATAGATATATATAGG + Intergenic
929324078 2:40584914-40584936 ATGCATATATACACGTATTAAGG + Intronic
929366615 2:41165938-41165960 ATATATATATATATGGATAGAGG + Intergenic
929725139 2:44417430-44417452 ATGAATACATAAATGAATTGTGG - Intronic
930340472 2:50107512-50107534 ATATATATATATATGTAGTCTGG - Intronic
930463662 2:51716485-51716507 ATATATATATATATATATAGTGG + Intergenic
930568291 2:53051160-53051182 TTGAATATATAAATGTATGGAGG + Intergenic
931173246 2:59827426-59827448 ATGTCTATATAGATGATTTTTGG - Intergenic
931266879 2:60668486-60668508 ATTTATATTAACATGTATTGTGG + Intergenic
931368641 2:61641555-61641577 ATGTATATGTATATATATTCTGG + Intergenic
931402382 2:61942920-61942942 ATATATATATATATGTGTTTAGG - Intronic
931458445 2:62430714-62430736 ATATATATATATATATATCGAGG + Intergenic
931749579 2:65318670-65318692 ATGTATTTATTTATGTATTTGGG + Intronic
932267222 2:70378145-70378167 ATGTGTATATAGACGTGTAGGGG + Intergenic
932345512 2:70992770-70992792 ATATATGTATATATGTGTTGGGG - Intronic
932754937 2:74400878-74400900 ATATATATATATATATATTCTGG - Intergenic
932920663 2:75910720-75910742 TTGTATATATAGATAGATAGGGG + Intergenic
933246563 2:79982189-79982211 ATATATATATATATATATAGTGG - Intronic
933513461 2:83270550-83270572 ATATATATATATACGCATTGTGG + Intergenic
934319095 2:91956194-91956216 ATATATATATATATATTTTGAGG + Intergenic
935167157 2:100579734-100579756 ATATATATATATATATATTTGGG - Intergenic
935399674 2:102646764-102646786 ATATATATATATATATATTTAGG - Intronic
935541006 2:104349173-104349195 ATGTATATATGAATACATTGTGG + Intergenic
935616173 2:105084243-105084265 ATATATATATATATATATTTTGG - Intronic
935699208 2:105796451-105796473 ATGTAAATATGGATGAATGGGGG + Intronic
935766217 2:106370327-106370349 ATGTATGTATATATGTATATAGG + Intergenic
936595261 2:113841231-113841253 ATATATATATATATTTTTTGAGG - Intergenic
936877231 2:117205215-117205237 ATATATATATATATATACTGGGG - Intergenic
937072060 2:119072017-119072039 ATTTATAAATACATGTATTGGGG - Intergenic
937482246 2:122274438-122274460 ATGTATATATAGGAGTATATAGG - Intergenic
937482263 2:122274666-122274688 AGGTATATATAGATATATATAGG - Intergenic
937482279 2:122274986-122275008 GTGTATATATAGGTGTATATAGG - Intergenic
937482284 2:122275061-122275083 GTGTATATATAGGTGTATATAGG - Intergenic
937482331 2:122275725-122275747 ATGTATATATAGGTATATATAGG - Intergenic
937721607 2:125103461-125103483 ATGTAGATTTATATGTTTTGAGG + Intergenic
937785744 2:125895398-125895420 ATATATATATATATATATAGGGG + Intergenic
937852982 2:126652027-126652049 CTGTATATATATATATAGTGTGG + Intergenic
938777987 2:134558986-134559008 ATGTATGTGTGTATGTATTGTGG - Intronic
939024504 2:136995869-136995891 ATTTATAGATGGATGTAATGAGG + Intronic
939171013 2:138695508-138695530 ATGAATATATAGATTTATTTGGG - Intronic
939211776 2:139184762-139184784 ATATATATATATATATAATGGGG - Intergenic
939709886 2:145504519-145504541 ATATATATATATATATATTCTGG - Intergenic
939839488 2:147169954-147169976 ATATATATATATATATATGGGGG - Intergenic
940104060 2:150077710-150077732 ATGGACACATATATGTATTGCGG - Intergenic
940372150 2:152915477-152915499 ATATATATATATATGAACTGTGG - Intergenic
940606336 2:155927722-155927744 ATGTATATATATATATATATAGG + Intergenic
940629269 2:156217237-156217259 ATATATATATGTATATATTGGGG - Intergenic
940937585 2:159515211-159515233 ATGTATGTATATATGTATTATGG - Intronic
941120035 2:161517796-161517818 ATGAATATATATATATATGGGGG - Intronic
941139904 2:161767238-161767260 ATATATATATATATATATTCAGG + Intronic
941288061 2:163639586-163639608 ATGTATATCCAAATATATTGTGG - Intronic
941417393 2:165238306-165238328 ATGTGTATATACATATTTTGTGG + Intergenic
941475521 2:165947165-165947187 ATATATATATATATATATGGGGG - Intronic
941949364 2:171137470-171137492 GTGTATATGTAGATGGCTTGGGG - Intronic
942257337 2:174116811-174116833 ATGTATGTATGTATGTGTTGGGG - Intronic
942549478 2:177100163-177100185 ATATATATATAAGTGTTTTGGGG + Intergenic
942557171 2:177183818-177183840 ATGTATCTATATATGTATGGTGG - Intergenic
942605755 2:177688941-177688963 ATGTATCTATACATGTACTTAGG + Intronic
943166012 2:184327530-184327552 ATATATATATATATATATAGTGG + Intergenic
943384802 2:187188395-187188417 ATATATATATATATATATAGGGG + Intergenic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
943709393 2:191073714-191073736 ATGTTTATATTTATGTATGGTGG - Intronic
943829194 2:192437275-192437297 ATGTATTAATAGATATATTAGGG - Intergenic
943932533 2:193872389-193872411 AAGTATTTATAGATATATTATGG + Intergenic
943945023 2:194048623-194048645 ATGTATATATACATGTATACAGG + Intergenic
943945024 2:194048653-194048675 ATGTATATATACATGTATACAGG + Intergenic
943945025 2:194049916-194049938 ATGCATATATACATGTATATAGG - Intergenic
943945026 2:194049946-194049968 ATGTATATATACATGTATATAGG - Intergenic
943990163 2:194679030-194679052 ATAAATATATAGAAGTACTGAGG + Intergenic
944331562 2:198473463-198473485 ATGTATATTTTGATGTTTTTAGG + Intronic
944378221 2:199074020-199074042 ATATATATATATATATATTTAGG - Intergenic
944445734 2:199786322-199786344 CTGTTTATATATATATATTGGGG + Intronic
944560942 2:200937145-200937167 ATGTAGGTATATATGTTTTGTGG + Intronic
944627046 2:201581473-201581495 ATATATATATATATATATTCCGG - Intronic
944744355 2:202640289-202640311 ATATATATATATATATTTTGTGG - Intronic
944974724 2:205035827-205035849 ATCTATATATATATATATAGTGG + Intronic
944974728 2:205035923-205035945 ATATATATATATATATATAGTGG - Intronic
945011937 2:205473731-205473753 ATATATATATATATATATTTAGG - Intronic
945156147 2:206840353-206840375 ATGGATAGATGGATATATTGTGG - Intergenic
945642835 2:212451171-212451193 ATGTATCTATAGAATTGTTGAGG + Intronic
946092155 2:217237155-217237177 ATGTATATTTTGTTGTTTTGGGG + Intergenic
946249786 2:218405186-218405208 ATGTGTATATAGATTTTTAGGGG + Exonic
946469805 2:219947965-219947987 CTGGATATAGAGATGGATTGTGG + Intergenic
946489733 2:220136360-220136382 ATGTATTTATAGATATATACAGG - Intergenic
946604054 2:221383370-221383392 ATATATATATATATGTCCTGTGG - Intergenic
946758378 2:222969441-222969463 ATATATATATATATATATTTAGG + Intergenic
946937202 2:224734579-224734601 GTGTATATATATATATATGGAGG + Intergenic
946945390 2:224816198-224816220 ATATAAATATATATGTATTATGG - Intronic
946983672 2:225247779-225247801 ATATATATATATATATATGGTGG + Intergenic
947480938 2:230499491-230499513 ATTTATATATATATATATAGGGG - Intronic
947634644 2:231673762-231673784 ATATATATATATATATATGGAGG - Intergenic
1168817131 20:746216-746238 ATTTGTATATAATTGTATTGTGG + Intergenic
1168873925 20:1156939-1156961 ATCTACATACATATGTATTGGGG + Intronic
1169086453 20:2827853-2827875 TTGAATATATAGATAAATTGGGG - Intergenic
1169627108 20:7583320-7583342 ATGTATGTATATATATATTTAGG - Intergenic
1169833362 20:9850586-9850608 ATGTATATGTATATGTATGTAGG - Intergenic
1169896218 20:10507901-10507923 ATGTATATATATATATATAAAGG - Intronic
1170107926 20:12772084-12772106 ATATATATATATATATATAGTGG - Intergenic
1170336237 20:15273413-15273435 ATATATATATATATATATGGAGG - Intronic
1170650198 20:18232330-18232352 ATATATATTTGGATGTATTCAGG - Intergenic
1171538529 20:25922488-25922510 ATATATATATATATATATTTTGG - Intergenic
1172051854 20:32123643-32123665 ATGTATATATAAATGTATAAGGG - Intronic
1172137940 20:32700234-32700256 ATGTATATGTATATGTATTGGGG - Intergenic
1173893562 20:46532100-46532122 ATATATATATATATATATTATGG - Intergenic
1174758885 20:53186902-53186924 ATATATATATATATATATTTTGG + Intronic
1174758887 20:53186904-53186926 ATATATATATATATATTTTGGGG + Intronic
1174856885 20:54054374-54054396 GTGTATACATATATGTATAGAGG - Intronic
1175356819 20:58375239-58375261 ATATATATATATATATATTTGGG - Intergenic
1175675196 20:60940572-60940594 ATATGGATATAGATGTAGTGTGG + Intergenic
1175991330 20:62791183-62791205 ATATATATATATATATATTTGGG + Intergenic
1177052362 21:16252631-16252653 ATGTATATAGATATGTATGTGGG + Intergenic
1177257940 21:18690471-18690493 ATGAAAATAAAGGTGTATTGTGG - Intergenic
1177257966 21:18690763-18690785 ATGAAAATAAAGGTGTATTGTGG - Intergenic
1177277345 21:18929651-18929673 ATGAATATATCGATCAATTGGGG - Intergenic
1177309277 21:19367515-19367537 ATATATATATATATATATTCTGG - Intergenic
1177383510 21:20377220-20377242 ATATATATATATATGTGGTGTGG - Intergenic
1177507145 21:22033956-22033978 ATGTAAATATACATGAATTCTGG - Intergenic
1177625726 21:23656895-23656917 ATTTAGATATAGATATACTGTGG - Intergenic
1177722213 21:24922039-24922061 GTGTATATATATATTTATGGTGG + Intergenic
1177922512 21:27170030-27170052 ATATAAATATAGATGTATGTTGG - Intergenic
1177923313 21:27182407-27182429 ATGTATATATAGATCTTGTGTGG - Intergenic
1178002064 21:28173033-28173055 ATATATATATATATATATAGTGG - Intergenic
1178105356 21:29312831-29312853 ATGAAAATATAGATCTATTTGGG - Intronic
1178538077 21:33426774-33426796 ATGTATATATATATATATAGTGG - Intronic
1179947783 21:44689723-44689745 ATATATATATATATATATTTTGG + Intronic
1179947785 21:44689725-44689747 ATATATATATATATATTTTGGGG + Intronic
1180254603 21:46616529-46616551 ATATATATATATATATATTTAGG + Intergenic
1180610583 22:17094701-17094723 ATATATATATATATATATTCAGG + Intronic
1181193927 22:21167512-21167534 ATGTATATATATATATAATTTGG - Intergenic
1181714510 22:24714362-24714384 ATGTATTTAATGATGTGTTGGGG - Intergenic
1181784030 22:25213030-25213052 ATGTATAAAAATATGTATTTTGG - Intergenic
1181789145 22:25249670-25249692 ATATATATATATATATATTTGGG - Intergenic
1181824904 22:25507193-25507215 ATGTATATATACATATATGGAGG - Intergenic
1182046691 22:27279958-27279980 ATATATATATATATATATAGTGG + Intergenic
1182139844 22:27944259-27944281 ATATATATATATATATATTCTGG + Intergenic
1182741267 22:32569342-32569364 ATGGATAGATAGATATATTTTGG - Intronic
1184824749 22:46942000-46942022 ATATATATATATATGTATGCTGG - Intronic
1185163414 22:49243286-49243308 ATGGATAGATAGATGGATGGAGG + Intergenic
949116258 3:328671-328693 ATGTTTACATAGAGGTTTTGGGG - Intronic
949178613 3:1098800-1098822 ATATATATATATATATATAGTGG + Intronic
949304141 3:2620505-2620527 ATATATATATATATTTATTAAGG + Intronic
949607431 3:5669532-5669554 GTGTATTCATAGATGTATGGAGG - Intergenic
949736025 3:7172556-7172578 ATTTATATATAGATATATGTGGG - Intronic
949784602 3:7726610-7726632 ATATATATATATATATATAGAGG - Intronic
950065091 3:10105806-10105828 ATATATATATATATATTTTGAGG + Intronic
950634557 3:14305751-14305773 TTTTATATACAGATGAATTGAGG + Intergenic
951083281 3:18478167-18478189 GTGTATATATAGATATATATAGG - Intergenic
951086914 3:18522487-18522509 ATATATATATAAATATATTTTGG + Intergenic
951163859 3:19461250-19461272 ATATATAAATAGAAGTTTTGAGG - Intronic
951390252 3:22094262-22094284 AAGGATAAATACATGTATTGAGG - Intronic
951555094 3:23913188-23913210 ATGTATATATTAATAAATTGGGG + Intronic
951602861 3:24396144-24396166 ATATATATATATATGCCTTGTGG - Intronic
952205319 3:31175719-31175741 ATGTATATATACGTGTTTTGGGG - Intergenic
952773805 3:37025581-37025603 ATATATATATATATATATAGTGG - Intronic
953044679 3:39283825-39283847 ATATATATATATATATAATGTGG + Intergenic
953291895 3:41673669-41673691 ATGTATATATATATATATTTAGG - Intronic
953380460 3:42467484-42467506 GTGTATATATGGATGTAGAGAGG + Intergenic
953489811 3:43339814-43339836 ATATATATATATATATATTTTGG - Intronic
954866478 3:53734034-53734056 ATATATATATATATATGTTGAGG + Intronic
955096039 3:55799353-55799375 ATATATATATATAAGAATTGTGG - Intronic
955185261 3:56709166-56709188 ATATTTAAATAGATTTATTGTGG - Intergenic
955251173 3:57284130-57284152 ATGTAAATATATATATATTTAGG + Intronic
955452244 3:59081666-59081688 ATATATATATAGATAGATTCAGG - Intergenic
955542011 3:59986494-59986516 ATATATATATATATATATTTTGG - Intronic
955782094 3:62495678-62495700 GTATATGTATATATGTATTGTGG - Intronic
956042890 3:65164201-65164223 ATTTATAGATAGATATCTTGAGG + Intergenic
956323974 3:68030326-68030348 AAGTATATATATATGTGCTGTGG + Intronic
956594646 3:70952828-70952850 GTGTATATATATATATATTTTGG + Intergenic
956679985 3:71769530-71769552 ATATATATATATATATATGGGGG + Intergenic
956732716 3:72211353-72211375 ATGTGTGTATATATGTATTAGGG - Intergenic
956819257 3:72938225-72938247 ATGGATGTATAGATGGATAGGGG + Intronic
957056600 3:75447974-75447996 ATATATATATATATGTATGGTGG - Intergenic
957194282 3:77047741-77047763 ATGTATATAAAGATATATATGGG + Intronic
957313986 3:78553761-78553783 ATGTATATATATATATATAAAGG - Intergenic
957385660 3:79492576-79492598 ATATATAAATAAATGTATTATGG + Intronic
957403261 3:79744295-79744317 CTGTATATAAATATGTATTTAGG + Intronic
957627681 3:82675165-82675187 ATATATATATATATATGTTGAGG + Intergenic
958403054 3:93712998-93713020 CTGGATATGTGGATGTATTGAGG - Intergenic
958537789 3:95426004-95426026 ATATATATATATATATATAGTGG + Intergenic
958880955 3:99669129-99669151 ATATATATATATATATATAGAGG + Intronic
958910592 3:99989661-99989683 ATATATATATATATATATAGAGG - Intronic
959195076 3:103169931-103169953 ATATATATATATATATATAGGGG + Intergenic
959221462 3:103526034-103526056 ATGTGTATATAGAAGTCTAGAGG - Intergenic
959237609 3:103745051-103745073 GTGTACATATATATGTATTAAGG - Intergenic
959239147 3:103766451-103766473 GTGTATATATATATGCACTGTGG + Intergenic
959297685 3:104557915-104557937 ATATATATATATATATATTTAGG + Intergenic
959360654 3:105386653-105386675 ATATATATATATATTTATGGTGG - Intronic
959784703 3:110281662-110281684 ATGTATATATAGATGAGTCTTGG + Intergenic
959833107 3:110888648-110888670 ATGTAAATATAGATATAGTTTGG + Intronic
960196012 3:114769544-114769566 ATATATATATATATGCATTTTGG - Intronic
960205827 3:114896665-114896687 TGTTATATAGAGATGTATTGTGG + Intronic
960242417 3:115360755-115360777 ATATATATATATATATATAGTGG - Intergenic
960343894 3:116508440-116508462 ATTTATATTTTGATGTTTTGGGG - Intronic
960410636 3:117319385-117319407 ATATATATATATATATATGGAGG - Intergenic
960848706 3:122029516-122029538 ATATATATATATATATATTTAGG + Intergenic
962029074 3:131580385-131580407 ATGTATATGTATATGTATAGAGG - Intronic
962258736 3:133889432-133889454 ATATATATATATATTTATTTTGG + Intronic
962409916 3:135132158-135132180 ATGTAAATATACATCTATTCAGG + Intronic
962798812 3:138872115-138872137 ATATATATATATATATATTTGGG - Intergenic
962912593 3:139867145-139867167 ATGTATGTAAAGATATATTTAGG + Intergenic
963071569 3:141309283-141309305 ATATATATATATATATATGGTGG - Intergenic
963401017 3:144799615-144799637 ATATATATATATATGTATGTTGG + Intergenic
963447340 3:145429163-145429185 GTGTATATATATATATATTTGGG - Intergenic
963453832 3:145518058-145518080 ATATATATATATATATGTTGAGG - Intergenic
963570800 3:146993018-146993040 ATATATACATATATGTATAGAGG + Intergenic
963594596 3:147309569-147309591 ATATATATATATATTTGTTGGGG - Intergenic
963696264 3:148569521-148569543 ACATATGTATAGATGTGTTGTGG + Intergenic
964466110 3:156995221-156995243 ATATATATATAGCTTTCTTGGGG + Intronic
965097741 3:164255755-164255777 TTTTAAAAATAGATGTATTGAGG + Intergenic
965117572 3:164511797-164511819 ATATATATATATATTTTTTGAGG + Intergenic
965197516 3:165620923-165620945 ATATATATATATATATATTGGGG - Intergenic
965288549 3:166847429-166847451 ATGTATATTCAGTTGTTTTGGGG + Intergenic
965565719 3:170115454-170115476 ATGTGTATACATATGTATTGTGG - Intronic
965708428 3:171532835-171532857 ATATATATATATATATATTATGG - Intergenic
965934860 3:174095522-174095544 ATATATATATAGATATATAATGG - Intronic
966274413 3:178147750-178147772 ATGTATATATACACAAATTGTGG + Intergenic
966440256 3:179937064-179937086 ATGTATATATATATATATGAGGG - Intronic
967302641 3:188030800-188030822 AAATATAAATAAATGTATTGAGG - Intergenic
967508556 3:190282788-190282810 ATATATATATATATGTATTCTGG + Intergenic
967657036 3:192063106-192063128 ATATATATATATATATATAGTGG + Intergenic
967670382 3:192226852-192226874 AAGTATATATATATGTATAGTGG - Intronic
967722321 3:192828587-192828609 ATATATATATATATATATGGGGG - Intronic
968209148 3:196833477-196833499 ATATATATATATATATATTCTGG + Intergenic
968258824 3:197302122-197302144 ATATATATATATATTTAATGAGG - Intergenic
968333684 3:197894291-197894313 ATGTATATATATGCGCATTGTGG - Intronic
969904362 4:10379667-10379689 GTGTATATATAAATATATGGGGG - Intergenic
970342477 4:15121119-15121141 CGGTATATATATATGTGTTGTGG - Intergenic
970706304 4:18807543-18807565 ATGTATATATACATATAAAGGGG + Intergenic
970823446 4:20247177-20247199 ATGAAGACAAAGATGTATTGGGG - Intergenic
971097220 4:23420908-23420930 ATATATATATATATGCATTCTGG - Intergenic
971174803 4:24271855-24271877 CTCAATACATAGATGTATTGAGG - Intergenic
971248615 4:24952647-24952669 ATATATATATATATATATAGTGG + Intronic
971252128 4:24981879-24981901 ATATATATATATATATCTTGGGG - Intergenic
971272655 4:25165107-25165129 ATGTATACATTGATATATTTAGG - Intronic
971298977 4:25426364-25426386 GTGTATTTATATATGTATTAGGG + Intergenic
971405229 4:26316240-26316262 ATATATATATATATATGTTGCGG - Intronic
971442612 4:26704694-26704716 ATTTATATATATTTCTATTGGGG - Intronic
971534321 4:27729569-27729591 ATGTATGTATGTATGTATTTGGG - Intergenic
971547054 4:27899262-27899284 GTGTATATATATATTTATTTGGG - Intergenic
971634767 4:29044434-29044456 ATGTATATATATGTATATTTTGG + Intergenic
971674808 4:29612520-29612542 ATGCACATATATATTTATTGTGG - Intergenic
971999707 4:34015155-34015177 ATGTTTATATAGTTTTATTATGG - Intergenic
972051429 4:34739573-34739595 ATGTATATATATATATATGTTGG - Intergenic
972055396 4:34796088-34796110 ATATATATATATATATATTTGGG - Intergenic
972084819 4:35203661-35203683 ATGTATATATATGTGTAAAGAGG + Intergenic
972820334 4:42694477-42694499 ATATATATATATATATATTTGGG - Intergenic
972883971 4:43462245-43462267 ATGTGTGTAAAGATGTATAGAGG - Intergenic
973154229 4:46929603-46929625 ATGTATATAGTTATTTATTGTGG - Intronic
973654887 4:53036386-53036408 ATGTACATGTATATTTATTGTGG + Intronic
973757431 4:54089384-54089406 ATATATATATATATGGAATGTGG - Intronic
973835520 4:54805702-54805724 ATATATATATATATGTATGATGG + Intergenic
973882056 4:55282762-55282784 ATGTATTTATACTTGTTTTGTGG + Intergenic
974069833 4:57113532-57113554 TTTTATATATGTATGTATTGTGG - Intergenic
974071640 4:57129349-57129371 ATGTATACATAATTTTATTGAGG + Intergenic
974246573 4:59327723-59327745 ATATATATATGTATGTATAGTGG - Intergenic
974308667 4:60175098-60175120 ATATATATATAAATGTATACTGG + Intergenic
974337761 4:60573060-60573082 ATATATATATGTATGTATTAGGG + Intergenic
974630624 4:64483019-64483041 ATGTGTATATAGATAAAATGTGG + Intergenic
974724807 4:65784807-65784829 ATGTATGTATGTATGTATTATGG - Intergenic
975390072 4:73805550-73805572 ATGTATATTTTGTTGTTTTGGGG - Intergenic
975520176 4:75292108-75292130 ATGTACATATATGTTTATTGTGG - Intergenic
975690903 4:76962293-76962315 ATGTATGTTTAGATGTTTTAAGG + Intronic
975704971 4:77102867-77102889 ATATATATATATATATATAGCGG - Intergenic
975881581 4:78914722-78914744 ATATATATATATATATATTTGGG + Exonic
975920108 4:79376030-79376052 ATGTATGTATAAATGTATGTAGG + Intergenic
976407337 4:84674894-84674916 ATATATATATATATGTCTAGCGG + Intronic
976620730 4:87124673-87124695 ATGTAAATATGCATGTTTTGTGG + Intronic
976841400 4:89436894-89436916 ATATATATATATATATATTTGGG - Intergenic
977241633 4:94577467-94577489 ATATATATATATATATATTGAGG + Intronic
977630168 4:99234010-99234032 ATTTATATATATATATATAGTGG + Intergenic
977700710 4:100019677-100019699 ATGTATATACTGAAGTATTTAGG - Intergenic
978186212 4:105859535-105859557 ACATATATACAAATGTATTGTGG - Intronic
978267572 4:106844689-106844711 ATATATATATATATGTAATGGGG + Intergenic
978475041 4:109117175-109117197 ATGTATACCTAGGTGTAGTGTGG - Intronic
978540107 4:109807430-109807452 ATATATATATATATATATGGAGG + Intergenic
978606129 4:110481728-110481750 ATGTATATATATTTGTACTTAGG + Intronic
978611883 4:110550709-110550731 ATGTATAGATATATAGATTGTGG + Intronic
978676107 4:111318146-111318168 ATATATATATGTATGTATGGTGG - Intergenic
978771688 4:112463498-112463520 ATGAACATATATATGTATTGTGG - Intergenic
979015617 4:115429653-115429675 ATATATATATATATATTTTGGGG + Intergenic
979191497 4:117864733-117864755 ATGTATATATTGTTTTATAGCGG - Intergenic
979325972 4:119379924-119379946 ATGTATATATATATATATGATGG - Intergenic
979373531 4:119917177-119917199 ATGTATATTTTGTTGTTTTGGGG - Intergenic
979507236 4:121512573-121512595 ATATATATATATATGTAAAGGGG + Intergenic
979535409 4:121814177-121814199 AGCTATATAGAGATGTATAGTGG + Intronic
980300441 4:130984209-130984231 ATGTATATATAAATACATTGTGG + Intergenic
980809986 4:137864976-137864998 ATATATATATATATATATTTTGG - Intergenic
980834159 4:138170202-138170224 ATATATATATATATATATAGTGG - Exonic
980839262 4:138237696-138237718 ATATATATATATATATATTCTGG - Intronic
981015173 4:139966986-139967008 ATGTACACATAGATATATTCTGG + Intronic
981060565 4:140419518-140419540 ATTTATATATAAATGTATTTTGG - Intronic
981160775 4:141496137-141496159 ATTTATATATTTATGTATTTTGG + Intergenic
981173092 4:141647501-141647523 ATGTATATATAGATGGCTTAGGG + Intronic
981503654 4:145477894-145477916 ACGTATATATATATATATGGAGG - Intergenic
981797115 4:148608200-148608222 ATGTATGTATATATGTATATAGG + Intergenic
981824115 4:148919970-148919992 ATGTATATGAACATCTATTGTGG + Intergenic
981858279 4:149322228-149322250 AAGGATATAAAGATGTATTTGGG + Intergenic
981968852 4:150639732-150639754 ATATATATATATATATATTTGGG - Intronic
982386733 4:154813424-154813446 ATGTATATAAATTTGTATAGTGG + Intronic
982531378 4:156548581-156548603 ATATATATATATATATATTTAGG - Intergenic
982553232 4:156828644-156828666 ATGTATATATAATTGTATTCTGG + Intronic
982704228 4:158689620-158689642 ATATATATATATATATATTGTGG + Intronic
982819069 4:159923878-159923900 ATATATATATATATATTTTGGGG - Intergenic
982819071 4:159923880-159923902 ATATATATATATATATATTTTGG - Intergenic
982932039 4:161420677-161420699 ATATATATTTCCATGTATTGAGG + Intronic
982969740 4:161969702-161969724 CTGCTAATATAGATGTATTGTGG + Intronic
983072401 4:163284282-163284304 ATATATATATATATATATTTGGG - Intergenic
983415746 4:167451941-167451963 ATATATATATATATGAAGTGTGG + Intergenic
983442399 4:167803159-167803181 ATATATATATATATATATTTTGG + Intergenic
983779989 4:171657103-171657125 ATGTATATACATATGTATATAGG - Intergenic
983862462 4:172724637-172724659 ATTTTTATACAAATGTATTGAGG - Intronic
983868725 4:172799583-172799605 ATGTATATATAGATAAATTTTGG - Intronic
984116895 4:175693251-175693273 ATGTGTATATATATATATTTAGG - Intronic
984320325 4:178187522-178187544 ATGTATGTATGTGTGTATTGGGG + Intergenic
984540467 4:181031357-181031379 AAGTATATATATACGTAATGGGG - Intergenic
984588000 4:181584951-181584973 ATGTCCATATAGTTGAATTGAGG + Intergenic
984611134 4:181839388-181839410 ATGTATATATATATGTATATAGG - Intergenic
984876539 4:184372895-184372917 AGGTATATATAGGTGTATATAGG + Intergenic
984960469 4:185092802-185092824 ATGAATATATAGACACATTGCGG + Intergenic
985632289 5:1020325-1020347 GTGTATACATACATGTATAGAGG + Intronic
985813384 5:2107880-2107902 ATGAATAGATAGATATATAGAGG + Intergenic
986036529 5:3945562-3945584 GTGTATATATATATATATAGTGG + Intergenic
986487698 5:8255963-8255985 ATATATATATAAATATATAGTGG - Intergenic
986506123 5:8453826-8453848 ATATATATATAGAAGGGTTGTGG + Intergenic
986802254 5:11273941-11273963 ATGAATATATAGATTTCCTGGGG + Intronic
987151692 5:15047028-15047050 ATGTATACATATATGTATATGGG - Intergenic
987442008 5:17967791-17967813 ATGGATATATAGATATATAAAGG + Intergenic
987652817 5:20766063-20766085 TTGAATGTATATATGTATTGTGG - Intergenic
987837165 5:23176790-23176812 ATGTATATTTTGTTGTTTTGGGG + Intergenic
987869544 5:23597443-23597465 ATATATATATATATATATTTAGG - Intergenic
987894080 5:23921914-23921936 ATGTATATAAATATTTATAGTGG - Intergenic
987899598 5:23994432-23994454 ATATATATATATATGTGTGGTGG - Intronic
987966371 5:24881538-24881560 GTGTATGTATATATGTATTTTGG + Intergenic
988010892 5:25483916-25483938 ATGTATATATACATATATAATGG + Intergenic
988041486 5:25893658-25893680 ATGTAAATATACATTTATTATGG - Intergenic
988121583 5:26970450-26970472 GTGTATACATAGATGCAGTGAGG - Intronic
988207265 5:28155577-28155599 ATGTTTATGTATATGTGTTGTGG + Intergenic
988364995 5:30286660-30286682 ATGTATTTATATGTGTTTTGTGG + Intergenic
988742741 5:34095421-34095443 TTGAATGTATATATGTATTGTGG + Intronic
989115079 5:37944749-37944771 ATATATACATAGATGTCTTCTGG - Intergenic
989176593 5:38533673-38533695 ATGTATATAGAGAGGGGTTGGGG - Intronic
989207082 5:38821620-38821642 ATGTGTATATACATGTATATAGG - Intergenic
989262887 5:39438277-39438299 ATATATATATATATATATTACGG + Intronic
989444575 5:41512099-41512121 ATGTATATTAAGATTTATTTGGG - Intergenic
990734551 5:58845682-58845704 GTGTATATATAGTTTTATAGAGG + Intronic
990892959 5:60667342-60667364 TTTTATATATATATGTATTCTGG - Intronic
991266646 5:64727450-64727472 ATATATATATATATATATGGTGG - Intronic
991621873 5:68553037-68553059 ATATATATACACAGGTATTGTGG + Intergenic
991944263 5:71884170-71884192 AAATATATATATATGTATTTGGG + Intergenic
992346820 5:75887679-75887701 ATGTATATATGTATATATGGTGG + Intergenic
992702919 5:79358964-79358986 ATATATATATATATATATTCAGG + Intergenic
992832930 5:80612814-80612836 ATATATATATATATGGAGTGGGG + Intergenic
993034653 5:82743870-82743892 ATATATATATACATATATAGTGG - Intergenic
993284350 5:85971984-85972006 ATTTTTATATACATGTATAGGGG - Intergenic
993405485 5:87507013-87507035 TTGAATATATAGATTTATTTGGG - Intergenic
993484853 5:88471132-88471154 ATATATATATATATCCATTGTGG + Intergenic
993497856 5:88628233-88628255 ATATATATATATATATTTTGTGG + Intergenic
993507674 5:88731190-88731212 ATGTATGGAAAGATGAATTGAGG + Intronic
993527273 5:88981062-88981084 ATGTATAGATGGATGGATAGAGG - Intergenic
993635433 5:90337397-90337419 AAGTATTTTTAGATGTTTTGTGG - Intergenic
993837426 5:92832940-92832962 ATGTATATACTGTTGTTTTGGGG + Intergenic
994006866 5:94847692-94847714 ATATATATATATATGTATGTTGG + Intronic
994016308 5:94970348-94970370 ATATATGTATGGATGTATTTGGG + Intronic
994335410 5:98559567-98559589 ATATATATATATATATATAGTGG + Intergenic
994365424 5:98911159-98911181 ATATATATATATATATATAGAGG + Intronic
994554480 5:101280888-101280910 ATGCATAGATATATGTACTGAGG + Intergenic
994669084 5:102744841-102744863 ATGCTTATATACATGTTTTGTGG - Intergenic
994672543 5:102779878-102779900 ATATATATATATATGTATATGGG - Intronic
994677388 5:102842201-102842223 ATATATATATATATATATTTAGG - Intronic
994842685 5:104947074-104947096 ATATATATATATATGTATAATGG - Intergenic
994866910 5:105285532-105285554 ATATATATATATATGTAAAGAGG - Intergenic
994888401 5:105597326-105597348 ATGTATATGTATATGTATGATGG + Intergenic
995069687 5:107905061-107905083 ATATATATATATATGGATTGTGG + Intronic
995630877 5:114130788-114130810 ATGTATACATACATGCTTTGAGG - Intergenic
995891451 5:116957188-116957210 ATGAATATATAGATTAATTTAGG - Intergenic
995901160 5:117068034-117068056 ATGTATGTACATATGTATTTTGG - Intergenic
996275209 5:121657755-121657777 ATATATATATATATATATAGTGG + Intergenic
996475722 5:123918382-123918404 ATATATATGTACATGCATTGTGG + Intergenic
996686732 5:126290785-126290807 ATGAATATGTAGATGAAATGTGG + Intergenic
996905316 5:128593569-128593591 ATATATATATATATGTATATAGG + Intronic
997003595 5:129792138-129792160 ATATATATATATATATATAGTGG - Intergenic
998276984 5:140764990-140765012 ATGTATATATAGATATGTTCTGG + Intergenic
998452250 5:142244155-142244177 TTATATATATATATATATTGGGG - Intergenic
998546850 5:143036157-143036179 AAGTATTTATAGATGATTTGCGG - Intronic
998807124 5:145929196-145929218 ATATATATATATATATATAGGGG - Intergenic
999926458 5:156384020-156384042 ATGTATATTTATATGTATTTCGG + Intronic
1000208540 5:159087249-159087271 GTGTATATATATATATATTAGGG - Intronic
1000292830 5:159886856-159886878 ATGTATATATATATTTACAGAGG - Intergenic
1000378629 5:160608377-160608399 ATGCATATATATGTTTATTGCGG - Intronic
1000540698 5:162536316-162536338 ATAAATTTATAGATGTATTTGGG + Intergenic
1000647229 5:163773523-163773545 ATGTCTATTGAGATGTGTTGTGG + Intergenic
1000990551 5:167907520-167907542 ATATATATATATATATATTTAGG - Intronic
1001189377 5:169613674-169613696 ATATATATATGTATGTATTACGG - Intergenic
1001290600 5:170456002-170456024 ATGCATACATATATTTATTGAGG + Intronic
1001945773 5:175776417-175776439 ATATATATATATATATATTTGGG - Intergenic
1002390423 5:178907366-178907388 ATGTATATATACATATTTGGGGG + Intronic
1003085979 6:3061977-3061999 ATGTATAAATATATGTATAGAGG - Intergenic
1003300583 6:4877895-4877917 TTGTATCTATAGATGCATTTGGG + Intronic
1003431880 6:6046597-6046619 ATATATATATATATGGAATGAGG + Intergenic
1003696323 6:8409470-8409492 ATATATATATATATATATTAGGG + Intergenic
1003904480 6:10686781-10686803 ATGTTTGTATAGCTTTATTGAGG - Intronic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1004739954 6:18449699-18449721 ATATATATATATATACATTGTGG + Intronic
1004922239 6:20386550-20386572 ATGTATGTATGTATGTATTTAGG + Intergenic
1005100131 6:22162913-22162935 ATATATATATATATGTATGATGG - Intergenic
1005534368 6:26740423-26740445 ATGTATATATACATGTATTATGG - Intergenic
1005715739 6:28545999-28546021 ATCTATATATACTTGTATTTGGG - Intergenic
1005729413 6:28682572-28682594 ATGTATATATATATATATTAGGG + Intergenic
1007040623 6:38718553-38718575 ATGTATTTATATATTTATTTTGG + Intronic
1007445199 6:41899996-41900018 ATATATATATATATATATTTTGG + Intergenic
1008010899 6:46466597-46466619 GTGAATATTTAGCTGTATTGTGG - Intronic
1008375517 6:50786914-50786936 ATATATATATATATATATTTAGG + Intergenic
1008661859 6:53676894-53676916 ATGTATGTATGTATGTTTTGAGG + Intergenic
1008828949 6:55734872-55734894 ATGAATATATAGTTGTATACAGG + Intergenic
1008973093 6:57392995-57393017 ATGTATATATATATATAATAAGG - Intronic
1009755830 6:67939170-67939192 ATGCTTTTATATATGTATTGTGG - Intergenic
1009858757 6:69297414-69297436 ATATATATATATATGCTTTGAGG + Intronic
1010428642 6:75753467-75753489 ATATATATATATATGTTTTTTGG + Intronic
1010560141 6:77339656-77339678 AAGTAAAAATAGATGTCTTGAGG - Intergenic
1010689950 6:78898407-78898429 ATATATATATATATATATTCAGG - Exonic
1010725704 6:79329979-79330001 ATATAGATATAGATATATTGGGG + Intergenic
1011005693 6:82642977-82642999 ATATATATATATATATATTATGG + Intergenic
1011100636 6:83717001-83717023 AGATATATATAGATATATAGTGG + Intergenic
1011250353 6:85365240-85365262 ATGCATATATATGTTTATTGTGG - Intergenic
1011435492 6:87332316-87332338 ATATATATATACATATATGGGGG - Intronic
1011522591 6:88225746-88225768 ATGTATATACACATGATTTGGGG - Intergenic
1011641502 6:89420048-89420070 ATGTATTGATAGATTTAATGTGG + Intergenic
1011677892 6:89753225-89753247 ATGTATATGTTGATTTATTGAGG - Intronic
1011737846 6:90330476-90330498 ATATATATATAGATGGAGTCTGG - Intergenic
1011769692 6:90661687-90661709 ATATATATATATATATATGGTGG - Intergenic
1011909568 6:92419824-92419846 GTGTGTATATATATATATTGGGG + Intergenic
1012050453 6:94335732-94335754 ATATATATATATATATATAGTGG + Intergenic
1012149604 6:95731396-95731418 ATGTAGATATAAATCTATAGAGG + Intergenic
1012158726 6:95855431-95855453 ATATATATATATATATATTTTGG + Intergenic
1012667234 6:101987904-101987926 ATCTATAAATAGGGGTATTGAGG - Intronic
1012726144 6:102813276-102813298 ATATATATATATATGTAGTTTGG + Intergenic
1012738828 6:102987463-102987485 ATGTATATACAAATGTATTTTGG + Intergenic
1012835550 6:104261108-104261130 ATGTGTATATGGATGTCTGGAGG + Intergenic
1012859102 6:104538037-104538059 GAGTCTATATAGATGTCTTGGGG - Intergenic
1013222375 6:108090447-108090469 ATATATATATATATTTTTTGAGG + Intronic
1013331326 6:109103877-109103899 ATGAATATATACATATATAGGGG + Intronic
1013449130 6:110261642-110261664 ATGTATATATTGTTGATTTGGGG - Intronic
1013566187 6:111366178-111366200 ATGTATATATAAGTGTGTTGGGG + Intronic
1014023661 6:116619031-116619053 ATGCATATGAAGAAGTATTGGGG + Intronic
1014338343 6:120168829-120168851 ATATATATATATATGTATGTAGG - Intergenic
1014353675 6:120376695-120376717 AAGCATATAAATATGTATTGTGG + Intergenic
1014457974 6:121659653-121659675 ATATATATATATATGTATACAGG - Intergenic
1014579030 6:123111639-123111661 ATGTATATATGTATCTATAGTGG + Intergenic
1014720044 6:124905434-124905456 ATTTATATATATATATATAGTGG + Intergenic
1014744017 6:125178659-125178681 ATATATATATATATATATTTGGG + Intronic
1014867880 6:126554262-126554284 ATATATATATATATATAATGTGG + Intergenic
1015057216 6:128918282-128918304 ATGGATTTTTAGATATATTGGGG + Intronic
1015067726 6:129051714-129051736 ATCTATAGATAGATATATAGAGG + Intronic
1015083444 6:129256782-129256804 ATATATATATATATATATAGTGG + Intronic
1015348303 6:132186002-132186024 ATATATATATATATATATTCAGG + Intergenic
1015655921 6:135519039-135519061 TTGTATATATAAATGTATTGTGG - Intergenic
1015901099 6:138068416-138068438 ATGTATATATATATCTATCTTGG + Intergenic
1016041198 6:139433451-139433473 CTGTACATATACATGAATTGGGG + Intergenic
1016165383 6:140935682-140935704 ATATATATATATATGCATTATGG - Intergenic
1016768789 6:147825473-147825495 ATATTTATATGGATGTGTTGAGG + Intergenic
1017081957 6:150678088-150678110 ATATATATATATATATGTTGTGG + Intronic
1017104008 6:150870940-150870962 ATATATATATATATGTTTTTTGG - Intronic
1017621533 6:156304262-156304284 ATGTATATAGATATGTATTATGG - Intergenic
1017710284 6:157161437-157161459 ATATATATATATATATATTTTGG + Intronic
1017747919 6:157463452-157463474 ATGGATATACAAATGTATAGGGG - Intronic
1019389129 7:775606-775628 ATATAAATATGTATGTATTGGGG + Intronic
1019836022 7:3384760-3384782 ATGTACATATTGATGTATACTGG - Intronic
1020314669 7:6896910-6896932 ATATATATATATATATATGGTGG + Intergenic
1020704507 7:11527389-11527411 ATATATATATATATATGTTGAGG + Intronic
1020810496 7:12845252-12845274 ATGTACATGTACATTTATTGTGG + Intergenic
1021226294 7:18030623-18030645 ATATATATATATATATATTCTGG - Intergenic
1021312500 7:19111340-19111362 AGGAATATATAGATGTATAAGGG - Intronic
1021425877 7:20498542-20498564 ATGTATATTTTGTTGTTTTGGGG - Intergenic
1021695820 7:23275383-23275405 ATATATATATATATGTAGTTAGG - Intergenic
1021711452 7:23419977-23419999 ATGTATATATGTATGTATAAGGG + Intronic
1021827296 7:24568115-24568137 ATATATATATATATGTACTATGG + Intergenic
1022317106 7:29255512-29255534 ATGTATATATATATTAGTTGGGG + Intronic
1022483870 7:30762660-30762682 ATATATATATAGATATATAAAGG - Intronic
1022826946 7:34024419-34024441 ATATATATATATATATGTTGGGG + Intronic
1023086863 7:36579510-36579532 ATGAATATATATATATATGGGGG + Intronic
1023195959 7:37639758-37639780 ATGTATATTTTGTTGTTTTGGGG + Intergenic
1023538825 7:41242741-41242763 ATATATATATATATATATTTAGG - Intergenic
1023588582 7:41757464-41757486 GTGTAGCTATATATGTATTGTGG - Intergenic
1023758577 7:43443208-43443230 ATCTATATTGAGATGTATGGGGG - Intronic
1024092388 7:45955025-45955047 AGGAATATATAGATTAATTGAGG - Intergenic
1024173872 7:46818511-46818533 ATATATATATATATATATTTAGG - Intergenic
1024392070 7:48826855-48826877 ATGTATAAATAGACCTATTTGGG + Intergenic
1024792169 7:52978872-52978894 ATATATATATATATATATTCAGG + Intergenic
1025791815 7:64695099-64695121 ATGTATATATATATTTATTTGGG - Intronic
1026351766 7:69523107-69523129 ATATATATATATATATATTTGGG - Intergenic
1026432582 7:70361872-70361894 ATGTATATGTATATGTATATAGG + Intronic
1026649750 7:72205570-72205592 ATATATATATATATATATTCAGG + Intronic
1026823118 7:73563059-73563081 ATATATATATATATGTAAAGGGG - Intergenic
1027581242 7:79998476-79998498 ATATTTATATATATATATTGTGG + Intergenic
1027683173 7:81245940-81245962 GTGTATATATTTGTGTATTGAGG + Intergenic
1027694583 7:81393818-81393840 ATTTATATATACATGTAAAGTGG + Intergenic
1027903185 7:84144991-84145013 ATTTATATATTGCTGTATTTAGG - Intronic
1028118424 7:87028512-87028534 ATATTTATATATATGTATTTTGG - Intronic
1028644394 7:93078817-93078839 ATATATATATATATATATTTAGG - Intergenic
1028699287 7:93758209-93758231 ATATATATATATATATATAGTGG + Intronic
1028859878 7:95637063-95637085 ATATATATATATATATATTTGGG + Intergenic
1028859880 7:95637095-95637117 ATATATATATATATATATTTGGG + Intergenic
1029104845 7:98166586-98166608 ATTTTTATATAGATTTAGTGTGG + Intronic
1029157414 7:98527127-98527149 ATATATATATATATATATTTGGG + Intergenic
1029528975 7:101112658-101112680 ATATATATACATATGTATTCTGG - Intergenic
1029587080 7:101481443-101481465 ATATATATATATATATATTTTGG - Intronic
1029790144 7:102834461-102834483 ATATATATATATATGTGATGTGG + Intronic
1030014874 7:105208996-105209018 AAATATCTATAGCTGTATTGGGG - Intronic
1030046528 7:105501974-105501996 ATATATATATATATATATAGGGG + Intronic
1030158264 7:106479747-106479769 ATGCATATACAGATGTATGTTGG + Intergenic
1030390965 7:108928479-108928501 ATGTATATACAGTTGTTTTCAGG + Intergenic
1030393784 7:108960448-108960470 ATATATATATATATATATAGAGG + Intergenic
1030434307 7:109496262-109496284 ATATATCTATATATTTATTGAGG + Intergenic
1030533814 7:110741700-110741722 ATTTATAAATAAATATATTGAGG - Intronic
1030729086 7:112963190-112963212 AGGTGTATTTAAATGTATTGGGG + Intergenic
1030934260 7:115565087-115565109 ATCTATTTATACATTTATTGTGG + Intergenic
1030942902 7:115677679-115677701 ATGTATACATATATGTAATGGGG + Intergenic
1030989755 7:116286254-116286276 ATAGATATATAGATCTATTGAGG - Intergenic
1031336742 7:120543140-120543162 ATATATATATATATATTTTGAGG - Intronic
1031441026 7:121794721-121794743 ATATATATATATATATATGGGGG - Intergenic
1031475877 7:122221000-122221022 ATATATATATATATATATGGTGG - Intergenic
1031878164 7:127165176-127165198 ATATATATATATATATATTCAGG + Intronic
1032452820 7:132048222-132048244 ATATATATATATATATATTTGGG - Intergenic
1032671951 7:134091975-134091997 ATATATAAAGAGATATATTGGGG - Intergenic
1032947143 7:136867785-136867807 ATATATATATATATATATTCTGG + Intergenic
1032947147 7:136867862-136867884 ATATATATATATATATATTCTGG + Intergenic
1032947150 7:136867902-136867924 ATATATATATATATATATTCTGG + Intergenic
1033008989 7:137598865-137598887 AAATATATATATATGTATTATGG + Intronic
1033187369 7:139240425-139240447 ATATATATATATATATATTTAGG - Intronic
1033350055 7:140554901-140554923 ATGTATATATAACAGTTTTGTGG - Intronic
1033783663 7:144703480-144703502 ATGTATGTCAAGATGTATTCAGG + Intronic
1033916970 7:146338095-146338117 ATGGATATACAGATATATGGGGG + Intronic
1035186598 7:157131176-157131198 ATATGTATATATATGTATTAGGG + Intergenic
1035480816 7:159182345-159182367 ATATATATTTTGATGTTTTGGGG + Intergenic
1035611415 8:967813-967835 ATATATATATATATATATAGTGG - Intergenic
1035707053 8:1683831-1683853 ATATATATATATATATATAGTGG - Intronic
1036721370 8:11178679-11178701 ATATATATATATATGTATATCGG + Intronic
1037075901 8:14717997-14718019 ATATATATATATATGTAATATGG + Intronic
1037543420 8:19894153-19894175 TTATATATATATATGGATTGAGG - Intergenic
1037563635 8:20097610-20097632 ATATATATATATATGTAAAGGGG + Intergenic
1037598283 8:20372890-20372912 ATGTATATATAGATATAGATAGG + Intergenic
1037880234 8:22570011-22570033 ATGCACATATATATGTATTCTGG + Intronic
1038020234 8:23546618-23546640 GTGTATATATATATATATTTGGG + Intronic
1038088496 8:24227365-24227387 ATGTATATGTATATGTATATGGG + Intergenic
1038836115 8:31125967-31125989 ATATATATATATATATATTTAGG - Intronic
1038917971 8:32048467-32048489 ATATATATATATATATATAGTGG + Intronic
1038946467 8:32366614-32366636 GTGTATATATACATATATTATGG - Intronic
1038953504 8:32442713-32442735 ATTTAGAAATAGATGTATTGAGG + Intronic
1039185649 8:34913122-34913144 ATGTGTAGATAGATGTGTGGTGG + Intergenic
1039215942 8:35271507-35271529 ATGTATACATATATGTATACAGG + Intronic
1039331113 8:36537822-36537844 ATATATATATATATGAATGGCGG + Intergenic
1039684347 8:39781236-39781258 ACATATATACACATGTATTGGGG + Intronic
1039763190 8:40600143-40600165 GTGTGTGTATACATGTATTGGGG + Intronic
1040614490 8:49020628-49020650 ATATATATATATATATATTTAGG + Intergenic
1040707109 8:50142479-50142501 ATATATATATATATATATTTGGG + Intronic
1040814219 8:51490585-51490607 ATGTATATATATATATTTAGTGG + Intronic
1041266609 8:56071884-56071906 AAGTTTCTATAGATTTATTGTGG - Intronic
1041470804 8:58206681-58206703 ATGTATATATTTATTTATTTTGG + Intergenic
1041561261 8:59221699-59221721 AGGTATATATATATATATTAAGG - Intergenic
1041861935 8:62524221-62524243 ATATATATATATATATATTTTGG - Intronic
1042420794 8:68586185-68586207 AAATAAATATACATGTATTGAGG - Intronic
1043100604 8:76040457-76040479 ATATATATATATATATATAGGGG + Intergenic
1043182181 8:77099011-77099033 ATTTATATATAGTTTTATTGAGG - Intergenic
1043219235 8:77637554-77637576 ATGTGTATATATATGTATATGGG + Intergenic
1043330327 8:79109383-79109405 GTGTATATATAGATATAATATGG + Intergenic
1043352990 8:79383235-79383257 ATATGTATATAAATCTATTGTGG + Intergenic
1043392525 8:79805331-79805353 ATATATATATATATATGTTGAGG + Intergenic
1044606122 8:94049192-94049214 ATATATATATATATGTATTTGGG - Intergenic
1045089706 8:98729110-98729132 ATGTATTTATATGTTTATTGAGG + Intronic
1045519402 8:102890417-102890439 ATGTAAATATATGTGTATTTAGG - Intronic
1045579610 8:103464272-103464294 AAGTTAATATAGATGTATTTGGG + Intergenic
1045691771 8:104766672-104766694 ATGTATATATATATTTTTTAAGG + Intronic
1045838494 8:106551781-106551803 ATATATATATATATGTATAGTGG - Intronic
1045871229 8:106929417-106929439 ATATATATATATATATATTCTGG + Intergenic
1045970796 8:108077665-108077687 ATGTATATTTATATATATTAGGG - Intronic
1045994703 8:108349472-108349494 ATAGATATATAGATGGATAGAGG + Intronic
1046171193 8:110508842-110508864 ATATATATATATATATATTTTGG - Intergenic
1046215914 8:111146731-111146753 ATATATATATATATATATAGTGG + Intergenic
1046238437 8:111458054-111458076 ATGTGTATATATATGTACTAAGG - Intergenic
1046308788 8:112405210-112405232 ATATATATATATATATATGGGGG - Intronic
1046343172 8:112885361-112885383 ATGTATATATATATATATACTGG - Intronic
1046594654 8:116247306-116247328 AGGTATATATGGATGTTGTGTGG + Intergenic
1046995930 8:120522434-120522456 ATGTATATGTGTATGTATTTTGG + Intronic
1047005714 8:120617972-120617994 ATATATATATACATATATTCAGG - Intronic
1047327755 8:123856332-123856354 ATATATATATATATATATTAGGG + Intronic
1047578692 8:126187995-126188017 ATATATATATATATCTTTTGGGG - Intergenic
1048057808 8:130885345-130885367 ATGAATATATAGATATATAATGG - Intronic
1048383984 8:133894078-133894100 ATATATATATATATATATTCTGG + Intergenic
1048556349 8:135481219-135481241 ATATATATATATATATATCGTGG - Intronic
1048690118 8:136953394-136953416 ATATATATATATATGTATGAAGG - Intergenic
1049821977 8:144640984-144641006 ATGTCTATATAGATGAAGAGTGG - Intergenic
1050631604 9:7564778-7564800 ATCTATGTATGTATGTATTGTGG + Intergenic
1050718476 9:8557440-8557462 ATATATATATATATATATTTGGG + Intronic
1051073245 9:13199077-13199099 ATGAATATATAGATATCTTTTGG + Intronic
1051195487 9:14559232-14559254 AGGTAGCTATAGATGTATTTAGG + Intergenic
1051441367 9:17086684-17086706 ATATATATATATATTTTTTGAGG - Intergenic
1051763285 9:20493688-20493710 ATGTAATTATACATGTTTTGGGG - Intronic
1051794152 9:20845438-20845460 ATATATATATATATATATCGAGG - Intronic
1051819845 9:21151668-21151690 ATGTATTTGTATATGTTTTGAGG + Intergenic
1051863684 9:21654532-21654554 GTGTATAGATAGATTTATTTTGG + Intergenic
1052043821 9:23771429-23771451 ATCTATATATAGATATATATAGG + Intronic
1052466564 9:28837664-28837686 ATATATATATATATATATTTAGG + Intergenic
1052599645 9:30608636-30608658 ATGTATATTTATATATAGTGGGG + Intergenic
1052602140 9:30647410-30647432 ATAAATATATAGATATGTTGCGG - Intergenic
1052922299 9:33981081-33981103 ATATATATATATATATATTCTGG + Intronic
1052922300 9:33981120-33981142 ATATATATATATATATATTCTGG + Intronic
1053563164 9:39217388-39217410 ATATATATATATATTCATTGTGG + Intronic
1054133983 9:61401691-61401713 ATATATATATATATTCATTGTGG - Intergenic
1054738154 9:68777383-68777405 ATGTATACATATATGTCATGTGG + Intronic
1054950169 9:70841621-70841643 ATATATATATATATATATAGTGG - Intronic
1055124263 9:72700888-72700910 ATGTAAATATACATATATTTGGG - Intronic
1055557818 9:77493029-77493051 ATATATATATATATATATTTGGG + Intronic
1055797868 9:79994995-79995017 ATATATATATATATATATTTTGG - Intergenic
1055797870 9:79995000-79995022 ATATATATATATATATATTTGGG + Intergenic
1055922119 9:81472072-81472094 ATATATATATATATATATAGCGG + Intergenic
1056088206 9:83177088-83177110 ATATGTATATACTTGTATTGTGG - Intergenic
1056384892 9:86088440-86088462 ATATATATATATATATATTTAGG + Intronic
1056588826 9:87948838-87948860 ATATATATATATATGTATATGGG - Intergenic
1056841183 9:89999194-89999216 ATATATATACATATATATTGAGG - Intergenic
1056987766 9:91379913-91379935 ATATATATATATATATATTTTGG + Intergenic
1058042763 9:100322613-100322635 ATTTATATATATATTTTTTGGGG + Intronic
1058257047 9:102779547-102779569 ATATATATATATATATATTATGG - Intergenic
1058570399 9:106336021-106336043 ATGGATACATACATTTATTGTGG - Intergenic
1058575651 9:106398368-106398390 ATATATATATATATGTATTCTGG + Intergenic
1058821203 9:108731540-108731562 GTGTATATATAGGTGAAGTGTGG - Intergenic
1059004959 9:110392128-110392150 ATATATATATATATATAATGAGG - Intronic
1059354023 9:113686068-113686090 ATGCATATATATGTGTATGGTGG - Intergenic
1059642478 9:116231077-116231099 ATATATATATAGATATATAACGG + Intronic
1060066658 9:120507951-120507973 ATATATATATATATATATAGTGG + Intronic
1060374156 9:123103619-123103641 ATATATATATATATATATAGTGG + Exonic
1060374158 9:123103621-123103643 ATATATATATATATATAGTGGGG + Exonic
1060446464 9:123693106-123693128 GTGTATATATAGATGAATTTTGG + Intronic
1060783007 9:126427209-126427231 ATATATATATCCATGTATTGGGG + Intronic
1061002335 9:127909553-127909575 ATATATATATATATATATTTAGG + Intronic
1061138261 9:128749025-128749047 AAATATATATATATATATTGTGG + Intronic
1185454303 X:300706-300728 GTGTATATATATATTTTTTGAGG + Exonic
1185506681 X:636954-636976 ATATATATATATATATATTTTGG + Intronic
1185583201 X:1226649-1226671 ATGGATAAATGGATGGATTGAGG + Intergenic
1185587495 X:1250753-1250775 ATATCTATATAGATATATAGAGG + Intergenic
1185671684 X:1814881-1814903 ATATATATATATATATATGGAGG + Intergenic
1185819493 X:3188109-3188131 ATAGATATATAGATATATAGAGG - Intergenic
1185972868 X:4684205-4684227 ATATATATATATATATATGGTGG - Intergenic
1186004191 X:5050071-5050093 ATATATATATAAGTTTATTGAGG - Intergenic
1186080500 X:5925821-5925843 ATATATATATATATATATGGTGG - Intronic
1186584537 X:10858535-10858557 ATAATTATATATATGTATTGGGG + Intergenic
1186932385 X:14408651-14408673 AAGAATATATATATATATTGTGG - Intergenic
1187065616 X:15834435-15834457 ATATATATATATATATATTTTGG - Intronic
1187107197 X:16255745-16255767 ATAGATAGATAGATATATTGGGG + Intergenic
1187265094 X:17725140-17725162 ATGTATATATACATATATGAGGG + Intronic
1187641362 X:21294008-21294030 TTGTATAAATAGATTTATTCTGG - Intergenic
1187668333 X:21641225-21641247 ATGTACATATACAAGTATAGTGG + Intronic
1188026125 X:25211160-25211182 ATATATATATATATATATAGTGG - Intergenic
1188280631 X:28263607-28263629 ATGTATATATATATATAATCCGG + Intergenic
1188472557 X:30557092-30557114 ATGGATATATATATATATTTTGG - Intergenic
1188771599 X:34160600-34160622 ATGCATATATATGTTTATTGTGG + Intergenic
1188825924 X:34834595-34834617 ATATATATATATATTTATTCTGG - Intergenic
1188913817 X:35885079-35885101 ATTTATATATACATGTGTTTGGG - Intergenic
1188922244 X:35991055-35991077 ATATATTTATACATGTTTTGTGG + Intergenic
1189024387 X:37376559-37376581 ATATATATATATATGTGCTGAGG + Intronic
1189376417 X:40469871-40469893 ATATATATATATATATATTCTGG - Intergenic
1189485998 X:41432532-41432554 GTGTATATATATATTTTTTGAGG - Intergenic
1189905659 X:45756538-45756560 ATGTATTTCCAGCTGTATTGAGG - Intergenic
1189970777 X:46416037-46416059 ATATATATATATATATATGGTGG - Intergenic
1190946406 X:55098340-55098362 ATGTATATATACATATATAAGGG + Intronic
1191659222 X:63633336-63633358 ATATATATATATATGTAAAGGGG + Intergenic
1191692562 X:63955983-63956005 ATATATATATATATGTATGATGG + Intergenic
1191692564 X:63956057-63956079 ATATATATATATATGTATGATGG + Intergenic
1191768220 X:64725234-64725256 ATAGATCTATAGATGAATTGGGG - Intergenic
1192155435 X:68742887-68742909 ATGTATATATATATATATAATGG + Intergenic
1192334665 X:70207620-70207642 ATGAATGGATAAATGTATTGGGG + Intergenic
1192666401 X:73092161-73092183 ATATATATATATATATAATGTGG + Intergenic
1193353381 X:80488031-80488053 ATGAATATAAATATGTATTTTGG + Intergenic
1193357987 X:80544662-80544684 ATGTATATGTTGCTGTATTTAGG - Intergenic
1193361127 X:80580253-80580275 ATGTTTTTATAAATGTTTTGTGG + Intergenic
1193538902 X:82746675-82746697 ATAAATATATAGATGTATTTAGG + Intergenic
1193687408 X:84594156-84594178 ATGTATATTTTGTTGTTTTGGGG - Intergenic
1193759530 X:85447362-85447384 ATGTAAAAATAGTTTTATTGAGG + Intergenic
1194334027 X:92622993-92623015 ATGTATTTATGTTTGTATTGTGG + Exonic
1194402195 X:93452182-93452204 ATATATATATATATATATTTAGG + Intergenic
1194488946 X:94523025-94523047 ATATATATATATATATGTTGTGG + Intergenic
1194584450 X:95715784-95715806 ATGTACATATATATGTATATGGG - Intergenic
1194608950 X:96017066-96017088 ATATACATATATATGCATTGTGG - Intergenic
1194656815 X:96583243-96583265 ATATATATATAAATATATGGTGG - Intergenic
1194891720 X:99386829-99386851 ATATATATATATATATATTTTGG - Intergenic
1194900240 X:99500569-99500591 ATGTATATTTTGTTGTCTTGGGG - Intergenic
1195307401 X:103597666-103597688 ATTTCTGTATAGGTGTATTGAGG + Intergenic
1195592173 X:106642135-106642157 AGGTATATATATATTTATGGGGG + Intronic
1195901873 X:109807466-109807488 ATATATATATATATATATAGGGG - Intergenic
1196145359 X:112310361-112310383 ATATATATATATATGTATAAAGG - Intergenic
1196152421 X:112390143-112390165 ATATATATATATATATATTTAGG + Intergenic
1196219353 X:113093895-113093917 GTGTATATATATATATATAGTGG + Intergenic
1196290778 X:113938340-113938362 ATATATATATATATATAGTGAGG + Intergenic
1196409746 X:115403796-115403818 ATGTATATATACATATATGTAGG - Intergenic
1196409747 X:115403822-115403844 ATGTATATATACATATATGTAGG - Intergenic
1196409748 X:115403848-115403870 ATGTATATATACATATATGTAGG - Intergenic
1196473479 X:116055932-116055954 ATGTATATTTTGTTGTTTTGGGG + Intergenic
1196502953 X:116406999-116407021 ATGTTTATATACATACATTGTGG + Intergenic
1196865076 X:120063770-120063792 ATATATATATATATATATGGAGG + Intergenic
1196878025 X:120172564-120172586 ATATATATATATATATATGGAGG - Intergenic
1196878027 X:120172587-120172609 ATATATATATATATATATGGAGG - Intergenic
1196961140 X:121003289-121003311 ATTTATATGTATATGTATTTAGG - Intergenic
1197002622 X:121455664-121455686 ATATATATATATATGTAAAGGGG - Intergenic
1197213186 X:123845121-123845143 ATCTATATATATATTTTTTGAGG - Intergenic
1197388539 X:125830695-125830717 ATGTATATTCTGTTGTATTGGGG - Intergenic
1197393928 X:125902972-125902994 ATATATATATATATGTATATAGG - Intergenic
1197394754 X:125912868-125912890 ATGTATATATATATAAAGTGAGG - Intergenic
1197477040 X:126938838-126938860 ATATATATATATATGTATAAAGG + Intergenic
1197665638 X:129220549-129220571 ATGTATGTATATATGTATGTGGG - Intergenic
1198118707 X:133569866-133569888 TTTTCTATATAGATGTATTAAGG - Intronic
1198205180 X:134459232-134459254 ATGTATATATATATGCACTTAGG - Intergenic
1198763668 X:140059922-140059944 ATATATATATATATATATGGTGG - Intergenic
1198846731 X:140920197-140920219 ATGGACATTTAGATGTTTTGAGG + Intergenic
1198914769 X:141657423-141657445 ATATATATATATATGCAATGAGG + Intronic
1199150317 X:144476372-144476394 ATATATAAATAGATATATTCAGG + Intergenic
1199150319 X:144476403-144476425 ATATATAAATAGATATATTCAGG + Intergenic
1199150322 X:144476466-144476488 ATATATAAATAGATATATTCAGG + Intergenic
1199150327 X:144476652-144476674 ATATATAAATAGATATATTCAGG + Intergenic
1199210281 X:145200440-145200462 ATATATATATATATGCATTGTGG - Intergenic
1199360540 X:146912671-146912693 ATAGATATATAGATAAATTGTGG - Intergenic
1199365785 X:146980911-146980933 ATGTATATTCTGATGTTTTGGGG + Intergenic
1199406669 X:147470074-147470096 ATGTATATTTACAAATATTGAGG + Intergenic
1199409893 X:147509345-147509367 ATATATATATATATATATTTTGG - Intergenic
1199491419 X:148404454-148404476 ATGTATTTATGGATGGAATGAGG + Intergenic
1199535426 X:148897218-148897240 ATATATATATATATATATAGTGG - Intronic
1199786336 X:151109418-151109440 ATGTATATTTTGTTGTTTTGGGG + Intergenic
1200434946 Y:3139739-3139761 ATGTATATTTTGTTGTTTTGGGG - Intergenic
1200642710 Y:5741987-5742009 ATGTATTTATGTTTGTATTGTGG + Intronic
1200811191 Y:7486954-7486976 ATGTATGTATGTATGTATGGAGG - Intergenic
1201052917 Y:9957963-9957985 ATGTATATATAGAAATACTGTGG - Intergenic
1201241317 Y:11959370-11959392 ATATATATATATATATATGGCGG + Intergenic
1201343833 Y:12961038-12961060 ATGGATATATAGATGTAACCAGG + Intergenic
1201491134 Y:14542674-14542696 ATGCACACATATATGTATTGCGG + Intronic
1201702104 Y:16894908-16894930 CTTTATATATGTATGTATTGTGG + Intergenic
1201714215 Y:17026175-17026197 ATATATATATATATATATAGTGG - Intergenic
1201714216 Y:17026201-17026223 ATATATATATATATATATAGTGG - Intergenic
1201714217 Y:17026227-17026249 ATATATATATATATATATAGTGG - Intergenic
1201714232 Y:17026473-17026495 ATATATATATATATATATAGTGG + Intergenic
1201796372 Y:17900887-17900909 ATGTATATATAAATATTTAGGGG + Intergenic
1201805183 Y:18005098-18005120 ATGTATATATAAATATTTAGGGG - Intergenic
1201990750 Y:20022461-20022483 ATGATTATATATATGTTTTGTGG - Intergenic
1202240634 Y:22764289-22764311 ATGTGTATATAGAAATACTGTGG + Intergenic
1202330414 Y:23746168-23746190 ATGTATATATATATGTATATTGG + Intergenic
1202393620 Y:24398042-24398064 ATGTGTATATAGAAATACTGTGG + Intergenic
1202477165 Y:25272058-25272080 ATGTGTATATAGAAATACTGTGG - Intergenic
1202540355 Y:25923893-25923915 ATGTATATATATATGTATATTGG - Intergenic