ID: 1158062113

View in Genome Browser
Species Human (GRCh38)
Location 18:53357038-53357060
Sequence TTAAGTTGATCCAGGCAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158062110_1158062113 23 Left 1158062110 18:53356992-53357014 CCAAAGTCTCAAAATTACTGTTT 0: 1
1: 0
2: 2
3: 38
4: 394
Right 1158062113 18:53357038-53357060 TTAAGTTGATCCAGGCAAGCGGG 0: 1
1: 0
2: 1
3: 3
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158062113 Original CRISPR TTAAGTTGATCCAGGCAAGC GGG Intronic
901104520 1:6744824-6744846 ATAAATTGGGCCAGGCAAGCTGG - Intergenic
903052528 1:20612348-20612370 TTCAGTTGCTCCAGGCCATCTGG - Intronic
903186302 1:21631196-21631218 TTAAGCTGAGCCAGGCCAGGGGG - Intronic
906049202 1:42856771-42856793 TTCAGTTGCTCCAGGCCATCTGG - Intergenic
906049634 1:42859506-42859528 TTCAGTTGCTCCAGGCCATCTGG - Intergenic
909235132 1:73143291-73143313 TTCAGTTGCTCCAGGCCATCTGG + Intergenic
910610303 1:89134073-89134095 TTAAGTGGATGCAGCCAGGCAGG - Intronic
913592116 1:120340458-120340480 TGGGGTTGATACAGGCAAGCCGG - Intergenic
913651240 1:120914688-120914710 TGGGGTTGATACAGGCAAGCCGG + Intergenic
914169869 1:145214379-145214401 TGGGGTTGATACAGGCAAGCCGG - Intergenic
914524987 1:148458343-148458365 TGGGGTTGATACAGGCAAGCCGG - Intergenic
914598688 1:149177488-149177510 TGGGGTTGATACAGGCAAGCCGG + Intergenic
914641414 1:149608792-149608814 TGGGGTTGATACAGGCAAGCCGG + Intergenic
914720420 1:150284304-150284326 TTAAGTCGGGCCAGGCAAGGTGG - Intronic
917329322 1:173865865-173865887 TTAAGCTGGTCCAGGCAAGTTGG + Intergenic
920831760 1:209471919-209471941 TTCAGTTGCTCCAGGCCATCTGG + Intergenic
922794638 1:228333991-228334013 TGAAGTTGACCCAGGAAAGTGGG + Intronic
923789392 1:237099152-237099174 TTAAGTTAATTCAGCCCAGCTGG + Intronic
924684119 1:246269717-246269739 TTAAAATGAGCCAGGCAAGATGG - Intronic
1067214494 10:44291256-44291278 TACAGCTGATGCAGGCAAGCTGG - Intergenic
1068629213 10:59282909-59282931 GTAAGATGATCCATGCATGCAGG - Intronic
1073844883 10:107544167-107544189 TTCTGTTGCTCCAGACAAGCAGG - Intergenic
1074641800 10:115392847-115392869 TTAAGTAGATGCTGGCTAGCTGG + Intronic
1076271071 10:129152652-129152674 TTTAGAAAATCCAGGCAAGCAGG + Intergenic
1076516783 10:131050113-131050135 TTCAGTTGCTCCAGGCCATCTGG - Intergenic
1083353100 11:62045045-62045067 TTCAGTTGCTCCAGGCCATCTGG + Intergenic
1088462592 11:110097389-110097411 TTAAAATGTTCCAGGTAAGCAGG - Intronic
1097094720 12:56537210-56537232 TCAAGATGAGCCAGGCAAGGTGG - Intronic
1101856173 12:108444875-108444897 TTCAGTTGCTCCAGGCCATCTGG + Intergenic
1108920788 13:55671906-55671928 TTCAGTTGTTCCAGGCCATCTGG + Intergenic
1109045418 13:57405340-57405362 TTCAGTTGCTCCAGGCCATCTGG - Intergenic
1110303439 13:73956631-73956653 TTAATTTTGTCCAGGCATGCTGG + Intronic
1113682185 13:112252287-112252309 TCAAGTGGAGCCTGGCAAGCTGG + Intergenic
1113754364 13:112799629-112799651 TTCAGTTGCTCCAGGCCATCTGG + Intronic
1114346029 14:21796288-21796310 TTCAGTTGCTCCAGGCCATCTGG - Intergenic
1116865509 14:50028575-50028597 TTCAGTTGCTCCAGGCCATCTGG - Intergenic
1119559784 14:75580843-75580865 TTCAGTTGCTTCAGGCAATCTGG + Intronic
1122284102 14:100640660-100640682 TTAAGTGGATCCTGGCCTGCAGG + Intergenic
1124095563 15:26645600-26645622 TTAAGCTGGTCCAGACAAGTTGG - Intronic
1126811779 15:52413881-52413903 TTATGTTCATCCCAGCAAGCAGG + Intronic
1128775679 15:70318279-70318301 TTAAGTTTCTCCAGGTAATCTGG - Intergenic
1131368563 15:91860816-91860838 TTAAGTGGACTCTGGCAAGCAGG + Intronic
1135957918 16:26971797-26971819 ATATGTTGAGCCAGGCAAGGTGG + Intergenic
1136465415 16:30439859-30439881 TTAAGTTTAGCCAGGCATGGTGG - Intergenic
1137604890 16:49780736-49780758 CTAAGTGGAGCCAGGCAGGCTGG - Intronic
1139303841 16:65966813-65966835 TTGAGGTGCTCCAGTCAAGCTGG - Intergenic
1139428444 16:66897652-66897674 TTCAGTTGCTCCAGGCCATCTGG + Intergenic
1139842288 16:69891246-69891268 TTTAGGAGATCCAGGCAAGGCGG + Intronic
1140535545 16:75705889-75705911 TTCAGTTGCTCCAGGCCATCTGG + Intronic
1140994906 16:80249755-80249777 TTGAGATGATCCAGGCAAGGAGG - Intergenic
1142688320 17:1590703-1590725 TTAAGCTGAGCCGGGCCAGCCGG - Intronic
1143847456 17:9783383-9783405 TTAAATTGATCCAGTAAATCAGG + Intronic
1146814929 17:35935054-35935076 AAACGTTGATCCAGGGAAGCAGG - Intronic
1150781106 17:68122808-68122830 TTCAGTTGCTCCAGGCCACCTGG + Intergenic
1152221325 17:79069046-79069068 TTAAGTTGCACCAGGCATGGTGG - Intergenic
1153559400 18:6356402-6356424 TTATGTTGATCCAGGCAATCAGG - Intronic
1157455212 18:47821460-47821482 TTGAATTGTTCCACGCAAGCAGG + Exonic
1158062113 18:53357038-53357060 TTAAGTTGATCCAGGCAAGCGGG + Intronic
1158368189 18:56764811-56764833 TTTAATTGATAAAGGCAAGCAGG - Intronic
1158719853 18:59915183-59915205 CTAAATTGTTCCAAGCAAGCTGG - Intergenic
1159262647 18:66035468-66035490 TCAAATGAATCCAGGCAAGCAGG + Intergenic
1159605778 18:70473348-70473370 TCAAGTTAATCTAGGGAAGCAGG + Intergenic
1160311459 18:77794837-77794859 TTGAGGTGATCCTGGGAAGCAGG + Intergenic
1162261695 19:9539402-9539424 TTCAGTTGCTCCAGGCCATCTGG - Intergenic
1162889369 19:13721350-13721372 TTAAATTGAGCCAGGCAGGGTGG - Intergenic
1163124289 19:15236451-15236473 TTAGGTTGAGGCAGGCAAGGTGG + Exonic
1163540057 19:17903240-17903262 TTAAGATTAGCCAGGCATGCTGG - Intergenic
1163866929 19:19781361-19781383 TTAAGTTTAGCCAGGCATGGTGG + Intergenic
1164704526 19:30310627-30310649 AGAACTTGTTCCAGGCAAGCAGG + Intronic
1166089762 19:40501083-40501105 TTGAGTTGAGCCAGGCATGGTGG + Intronic
1166411344 19:42557413-42557435 TTCAGTTGCTCCAGGCCATCTGG - Intronic
1166905108 19:46102673-46102695 TTAAGTTGCTTCAGGCCATCTGG + Intergenic
926018853 2:9476834-9476856 TTCAGTTGCTCCAGGCCACCTGG + Intronic
927004502 2:18834093-18834115 TTAGGTTGCTCCAGGCAATATGG - Intergenic
927462917 2:23314440-23314462 CTAAGGTTATCCAGGCAAGATGG - Intergenic
928711323 2:34009390-34009412 TGAAGATGAGCCAAGCAAGCTGG - Intergenic
930643849 2:53882613-53882635 TGAATTTGATCCAGGCAGCCTGG + Intronic
931409097 2:62011894-62011916 AAAAGTTGATACAGGCAAGATGG + Intronic
934149435 2:89131210-89131232 AGAATTTGATCCTGGCAAGCTGG - Intergenic
934217861 2:90050831-90050853 AGAATTTGATCCTGGCAAGCTGG + Intergenic
938948077 2:136232174-136232196 TTGAGTTTATCCATGCAAGAAGG + Intergenic
941682446 2:168413491-168413513 AAAAGTAGATCCAGGCAAGATGG - Intergenic
944363676 2:198891254-198891276 TAAAGTTGATCCAGAGAAGTGGG - Intergenic
945610438 2:211994418-211994440 TTACGTTGAGCCAGGCATGGTGG - Intronic
947842279 2:233215471-233215493 TTCAGTTGATTCAGGCCATCTGG + Intronic
948263707 2:236622527-236622549 TTCACTTCATCCAGGCAGGCAGG - Intergenic
1169166472 20:3428621-3428643 TTAAGTTGACCCAACCAGGCCGG + Intergenic
1169671335 20:8106093-8106115 GGCTGTTGATCCAGGCAAGCAGG - Intergenic
1171071543 20:22073448-22073470 TTACTTTGCTCCAGGTAAGCTGG - Intergenic
1171987105 20:31668142-31668164 GTCAGGTGCTCCAGGCAAGCAGG - Intronic
1173141520 20:40489029-40489051 TGAAGTTGCTACAGGCTAGCAGG + Intergenic
1173972609 20:47164222-47164244 GTAACTTGATCCAGGTCAGCTGG + Intronic
1175616521 20:60404641-60404663 ATAAGTTGAACCTGGGAAGCGGG + Intergenic
949097392 3:101464-101486 TTAAATACATCCAGGCAGGCAGG + Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
951081467 3:18454980-18455002 TTAATTGGAACCAGGCATGCTGG - Intergenic
953841498 3:46393321-46393343 TTCAGTTGCTTCAGGCAATCTGG + Intergenic
958449518 3:94256652-94256674 TCAATTTCATCCAGGCAAGCAGG + Intergenic
958959399 3:100494763-100494785 GTAAATTGAACCAGGCCAGCTGG - Intronic
961889396 3:130117695-130117717 TTAAGTTAATCAAGACAGGCTGG - Intergenic
963524112 3:146394551-146394573 TTAAATTGGTCCAGGCACGGTGG - Intronic
968923331 4:3533817-3533839 TTGAGTTGTTTCAGGCAAGAGGG + Intergenic
970812854 4:20116086-20116108 TTTAGTTACTCCAGGCCAGCAGG + Intergenic
971491223 4:27214172-27214194 CTAAGTTTATCCAGGCATGGAGG + Intergenic
973559936 4:52125081-52125103 TTAAGTTATTCCAGGAAAGAGGG + Intergenic
977798172 4:101193506-101193528 TGAAGTTTATCCAGACAAGGGGG - Intronic
983359355 4:166708979-166709001 TTCAGTTGCTCCAGGCCATCTGG + Intergenic
983359498 4:166710089-166710111 TTCAGTTGCTCCAGGCCATCTGG - Intergenic
984122644 4:175765323-175765345 TTAAGATGGTCAAGGCAAGAAGG - Intronic
987797680 5:22651139-22651161 TTAAGGTCAAACAGGCAAGCTGG - Intronic
989052450 5:37334815-37334837 TTTAGTTGATCCTGGAAAGATGG - Intronic
994992065 5:107009500-107009522 TTTAGTTGATTGAGGCAGGCAGG + Intergenic
998231823 5:140365762-140365784 TGAAGTTGGTCCAGGAGAGCAGG + Intronic
1001676544 5:173522505-173522527 TGTAGTTGTTCCAGGCAAGAAGG + Intergenic
1003615825 6:7654565-7654587 TTAAAATGTTCCAGGCAGGCTGG + Intergenic
1005506709 6:26475370-26475392 TTAAGGTGATTAAGGCAAGTAGG - Intronic
1008159956 6:48065037-48065059 ACAAGGTGATCCAGACAAGCAGG - Intronic
1008792890 6:55260477-55260499 TCAAGTTGATCCTGTAAAGCAGG - Intronic
1009899868 6:69797459-69797481 TTCAGTTGCTTCAGGCCAGCTGG - Intergenic
1010042630 6:71404460-71404482 TTAAGTTGATACAGAAAAGTGGG + Intergenic
1010948414 6:82005803-82005825 GGCAGCTGATCCAGGCAAGCAGG - Intergenic
1011674732 6:89721364-89721386 TTAAGCTGGTCCAGACAAGTTGG - Intronic
1015031310 6:128599057-128599079 TTAAGCTGAACCACGCAGGCTGG - Intergenic
1017160557 6:151361735-151361757 TTAGAATAATCCAGGCAAGCTGG + Intergenic
1028924687 7:96345247-96345269 TTAAAATGAGCCAGGCAAGGTGG + Intergenic
1030194345 7:106838141-106838163 TTCAGTTGCTCCAGGCCATCTGG - Intergenic
1032139047 7:129309649-129309671 TAAAATTGATCCAGGAATGCGGG - Intronic
1033006669 7:137572496-137572518 TTAAGATGTTCCAGTCAAGAGGG + Intronic
1033659877 7:143395888-143395910 TGCAGCTGAGCCAGGCAAGCTGG - Intronic
1035303941 7:157917676-157917698 TTAAATTACTCCAGGCAACCAGG - Intronic
1047113445 8:121816208-121816230 TTCAGTTGCTTCAGGCCAGCTGG + Intergenic
1049652341 8:143776971-143776993 TTAATTTGAACCAGGCATGGTGG + Intergenic
1053475906 9:38381952-38381974 TTCAGTGAATCCAGGCAGGCTGG - Intergenic
1055077097 9:72227295-72227317 TAAAATTGATCCAAGAAAGCAGG - Intronic
1057205538 9:93170019-93170041 AAAAGTTGAGCCAGGCAAGGTGG + Intergenic
1060243159 9:121922130-121922152 TTAGGTTGAACCAGCCAAGGAGG + Intronic
1060891763 9:127193630-127193652 TTAAGATGACCCAAGCAGGCTGG + Intronic
1193026602 X:76851842-76851864 TCAAGCTGATCCAGGAAATCTGG + Intergenic
1193125660 X:77867543-77867565 TTAACTTGAGCCAGGCATGGTGG + Intronic
1193942352 X:87691316-87691338 TTCAGTTGCTCCAGGCCATCTGG - Intergenic
1198258394 X:134945092-134945114 TTCAGTTGATTCAGGCCATCTGG - Intergenic
1200007183 X:153094913-153094935 TTCAGTTGCTCCAGGCCATCTGG + Intergenic
1200008128 X:153101395-153101417 TTCAGTTGCTCCAGGCCATCTGG + Intergenic