ID: 1158062369

View in Genome Browser
Species Human (GRCh38)
Location 18:53360967-53360989
Sequence CTGTGACCTTAGATGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2075
Summary {0: 1, 1: 0, 2: 19, 3: 216, 4: 1839}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158062363_1158062369 21 Left 1158062363 18:53360923-53360945 CCTCTAAGACGGTATGTGCATGT 0: 1
1: 0
2: 0
3: 0
4: 68
Right 1158062369 18:53360967-53360989 CTGTGACCTTAGATGGAAAAGGG 0: 1
1: 0
2: 19
3: 216
4: 1839
1158062365_1158062369 -10 Left 1158062365 18:53360954-53360976 CCAGAACCTGTGACTGTGACCTT 0: 2
1: 40
2: 197
3: 574
4: 1224
Right 1158062369 18:53360967-53360989 CTGTGACCTTAGATGGAAAAGGG 0: 1
1: 0
2: 19
3: 216
4: 1839
1158062364_1158062369 -7 Left 1158062364 18:53360951-53360973 CCTCCAGAACCTGTGACTGTGAC 0: 1
1: 15
2: 69
3: 274
4: 960
Right 1158062369 18:53360967-53360989 CTGTGACCTTAGATGGAAAAGGG 0: 1
1: 0
2: 19
3: 216
4: 1839

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158062369 Original CRISPR CTGTGACCTTAGATGGAAAA GGG Intronic
Too many off-targets to display for this crispr