ID: 1158067784

View in Genome Browser
Species Human (GRCh38)
Location 18:53433811-53433833
Sequence CTGTGAGTATGTAAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158067784 Original CRISPR CTGTGAGTATGTAAGGAAGT AGG (reversed) Intronic
900942165 1:5806602-5806624 CAGACAGTACGTAAGGAAGTGGG + Intergenic
906959955 1:50414208-50414230 TTGGGAGTAAGTAAGGAAGAGGG - Intergenic
907050810 1:51329137-51329159 ATGTAAGCATATAAGGAAGTGGG + Intronic
908520764 1:64939384-64939406 TTGTGTGAATGTATGGAAGTTGG - Intronic
908742450 1:67342627-67342649 GTGTGAGGATGTGAGGATGTTGG + Intronic
909368830 1:74860658-74860680 ATGTGATTATGTAGGGAAGGGGG + Intergenic
917074328 1:171188156-171188178 ATGTGAGTATGCAAGGATTTTGG - Intronic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919660621 1:200241332-200241354 ATGTGATTATGCAAGGAAGGAGG + Intergenic
921293373 1:213679274-213679296 CTGTGAGTATGGAAGGACATAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923771851 1:236944406-236944428 CTCTGATTATGTAAGTAGGTAGG - Intergenic
1064927916 10:20590454-20590476 CTTTGAGTAGATGAGGAAGTGGG - Intergenic
1066350361 10:34631487-34631509 CAGGCAGTAGGTAAGGAAGTGGG - Intronic
1067077476 10:43196434-43196456 ATGGGAGTCTGTAAGGAAGAGGG - Intronic
1067177902 10:43962948-43962970 TTGTGGTTATGTAAGGAATTTGG - Intergenic
1071820912 10:89279757-89279779 CTGTACTTAAGTAAGGAAGTGGG + Intronic
1072314407 10:94188009-94188031 CTGTGAGTACCTAGGGAAGGGGG - Intronic
1074413602 10:113248123-113248145 CTGTGACTATGGGAGTAAGTTGG + Intergenic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078153705 11:8780112-8780134 CTGTAAGTATGAATGGAAGGAGG - Intronic
1078778970 11:14419315-14419337 CAGTGAGTGTGTCAGGAAGCCGG + Intergenic
1079525830 11:21386447-21386469 CTTTGTCTATGGAAGGAAGTGGG - Intronic
1080114026 11:28601696-28601718 ATGTGATTGTGTTAGGAAGTGGG - Intergenic
1080785302 11:35469927-35469949 CTGTGATCATATTAGGAAGTAGG - Intronic
1080953877 11:37069524-37069546 CTGTAAGTATGTAGTGAAATGGG - Intergenic
1082898643 11:58220935-58220957 ATGTGAGTGTGGAAGGTAGTTGG + Intergenic
1083730671 11:64650819-64650841 CGGGGAGAATGTAAGGAAGGAGG + Intronic
1084925959 11:72511401-72511423 CTTTGAGAATGGATGGAAGTAGG - Intergenic
1085028434 11:73254612-73254634 CTCTGAGAATGAAAGGAACTTGG + Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1087022257 11:93615392-93615414 CTGTGAGTGTTTGAGGGAGTGGG - Intergenic
1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG + Intronic
1088580383 11:111310118-111310140 CTTTGTGTATATGAGGAAGTTGG - Intergenic
1088965135 11:114712624-114712646 TTGTGAGGATGTGAAGAAGTTGG + Intergenic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1091637266 12:2206586-2206608 CAGTGAGTAGGTAGGGAGGTGGG - Intronic
1092198639 12:6565942-6565964 CTGGGAGGATATAAGGCAGTAGG + Intronic
1092297909 12:7216267-7216289 GTGTGAGTGTTTAAGGAATTTGG - Intronic
1095522948 12:43089073-43089095 CTTTGAGTAAGTAGGGAAGGTGG + Intergenic
1096028432 12:48388745-48388767 ATATGAGTATGTAAGTAGGTGGG - Intergenic
1096706630 12:53425956-53425978 CTGTGTGTATGTATAGAGGTGGG + Intronic
1097408051 12:59215444-59215466 CTGACAGTCTGTAAGGAAATGGG + Intergenic
1102654714 12:114472210-114472232 CTGTGAGTAGGAAAAGAAATTGG - Intergenic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1107003530 13:35580507-35580529 TTGTCAGTATGTAGGTAAGTAGG + Intronic
1107343043 13:39430434-39430456 CTGTGAGGAGTAAAGGAAGTAGG - Intronic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1108680313 13:52774446-52774468 CTGTGTGTATATGAAGAAGTGGG + Intergenic
1109163550 13:59005421-59005443 GTGTGTGTGTGTAAGGGAGTGGG - Intergenic
1110054134 13:70943025-70943047 CTGTAAATATGTAAGACAGTGGG + Intergenic
1110468908 13:75835338-75835360 CTGTGAGTATTTGGAGAAGTAGG + Exonic
1112136282 13:96581855-96581877 CTGAGAGTTTGTACTGAAGTGGG + Intronic
1112994789 13:105560429-105560451 ATGTGATGATGTGAGGAAGTGGG - Intergenic
1113882348 13:113634448-113634470 CTGTGAGGATGTGAGGATGTGGG + Intronic
1117336766 14:54762613-54762635 CTGTGGGTCTCTCAGGAAGTAGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120033449 14:79668689-79668711 CTGTTGGTGTGTAAGGAAGGGGG + Intronic
1120526870 14:85587203-85587225 CTTTTAGTATTTCAGGAAGTGGG + Intronic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG + Intergenic
1202924124 14_KI270724v1_random:8454-8476 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
1125191942 15:37003737-37003759 ATGTGAGGATATTAGGAAGTGGG + Intronic
1125207219 15:37167377-37167399 CTGTGAGCCTGTTAGGAACTGGG + Intergenic
1125408809 15:39383429-39383451 ATGTGAGGATATTAGGAAGTGGG - Intergenic
1126882209 15:53111243-53111265 CTGAGTGTATGTGAGGCAGTGGG - Intergenic
1128894234 15:71357870-71357892 CTTTGAATAAGTAAGGCAGTTGG - Intronic
1129590035 15:76906762-76906784 TTATGAGTATGAAAGGAAGTGGG - Intergenic
1129886152 15:79038807-79038829 ATGTGAGTATGTAAGCAGTTTGG - Intronic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG + Intergenic
1131808397 15:96147381-96147403 CTGTGAGTATCTTAAGAATTGGG - Intergenic
1133663059 16:7937530-7937552 CAGTAAGTAAGGAAGGAAGTGGG - Intergenic
1135665075 16:24328899-24328921 ATGTGTGTATGTGATGAAGTCGG - Intronic
1136627675 16:31472072-31472094 CCGTGACCATGTAAGGAAGCCGG - Exonic
1139801528 16:69526870-69526892 TTGGGAGTTTGTAAGGAATTAGG - Intergenic
1140514231 16:75530599-75530621 CTGTAGGTATGTAAGTAGGTGGG - Exonic
1141321005 16:83008753-83008775 CTGTGAAGATGAAAGGAAGGAGG - Intronic
1143286853 17:5796542-5796564 AGGTGAGAATGTAAGGAAGTTGG - Intronic
1144387386 17:14761386-14761408 TTGTGAGAAAGTAAGTAAGTGGG + Intergenic
1149189861 17:54048356-54048378 ATCTGAATATGTAAGAAAGTAGG + Intergenic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153812552 18:8764766-8764788 CTGAGACTTTGTAAGGATGTTGG + Intronic
1156053911 18:32974577-32974599 CTGAGAGTCTGTCTGGAAGTTGG + Exonic
1156512996 18:37657004-37657026 CTGTGTGTATCAAAGAAAGTTGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG + Intergenic
1158895430 18:61908601-61908623 ATGTGAAAATGTAAAGAAGTAGG - Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164753976 19:30676339-30676361 CTGTGAATGTGTAAAGAAGATGG + Intronic
1165231760 19:34391677-34391699 CTGTCAGTATCTGAGGAGGTAGG + Intronic
1165231882 19:34392575-34392597 CTGTCAGTATCTGAGGAGGTAGG + Intronic
926449210 2:12981872-12981894 ATGTGAGGATATTAGGAAGTGGG - Intergenic
926968766 2:18445104-18445126 ATGTGAATATGTAAGGATGAGGG - Intergenic
927631165 2:24775345-24775367 CTATGAGCTTGTAAGGAATTTGG - Intergenic
928492904 2:31802926-31802948 CTGTAAGTATTCAAGGTAGTTGG - Intergenic
929403568 2:41613620-41613642 CGGTGATTAGGTAAGGAGGTAGG + Intergenic
929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG + Intergenic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
935597228 2:104888715-104888737 CTGAGAGTGGGGAAGGAAGTGGG - Intergenic
937092328 2:119214694-119214716 CTGTGTGGAGGTAAGGCAGTGGG + Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
939654141 2:144801841-144801863 GGGTGGGTATATAAGGAAGTAGG + Intergenic
939977837 2:148739626-148739648 TTCTGTGTAGGTAAGGAAGTGGG - Intronic
940807146 2:158200481-158200503 CTGTCAATATGTAAGCAAATGGG - Intronic
940846747 2:158650630-158650652 CTGTGTGGAAGTAAGGAACTGGG - Intronic
943843864 2:192615495-192615517 TTCTGGATATGTAAGGAAGTAGG + Intergenic
944559780 2:200924642-200924664 ATGTGAGTATGTCAGAAAATTGG - Intronic
946966090 2:225039973-225039995 CTATGAGTCTGTACTGAAGTCGG + Intronic
946978121 2:225175751-225175773 CTGTAAGTAGGGAAGGTAGTAGG + Intergenic
947077377 2:226360053-226360075 CTGTGAGTATGTGAATATGTTGG + Intergenic
947329120 2:229009714-229009736 GTGTGAGTATATGAGGAACTAGG + Intronic
947470027 2:230392868-230392890 CAGTGAATATTTAAGGAAGAGGG - Intronic
948554326 2:238796793-238796815 ATGTGAGAATGTCAGGAAGAAGG - Intergenic
1168868529 20:1109296-1109318 CTGTGTGTATGTAGGGTGGTGGG - Intergenic
1170499029 20:16955780-16955802 CTGTGAGAAGGTGACGAAGTCGG + Intergenic
1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG + Intergenic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1172606148 20:36215460-36215482 CTATGTGTATGTCAGGAGGTTGG - Intronic
1173175445 20:40761682-40761704 ATGTGAGAAGGGAAGGAAGTGGG - Intergenic
1181677063 22:24462168-24462190 CTGTCAGAATATAAGTAAGTTGG + Intergenic
1181992663 22:26849356-26849378 CTAGGAGTATGTGTGGAAGTGGG + Intergenic
1183310190 22:37105388-37105410 CTGTGAACATTTGAGGAAGTGGG - Intronic
1184371745 22:44086815-44086837 CTCTGAGTACGGATGGAAGTTGG + Intronic
1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG + Intergenic
950766052 3:15273884-15273906 ATGTGATTATATTAGGAAGTGGG + Intronic
952696230 3:36267801-36267823 TTGGGAGTATGAAAGGAGGTGGG + Intergenic
952726505 3:36591998-36592020 ATGTGATGATGTTAGGAAGTGGG - Intergenic
953060214 3:39421728-39421750 CTGTTAGTATGGAAGAAAGGAGG - Intergenic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
956118279 3:65940572-65940594 ATGTGATGGTGTAAGGAAGTGGG - Intronic
956857245 3:73287257-73287279 CTGGGAGCATGAAATGAAGTGGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957080746 3:75633837-75633859 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
957220859 3:77380721-77380743 CTGTGATGATGGAAGGAAGGAGG - Intronic
959365274 3:105450424-105450446 GTGTGTGTATGTGAGGTAGTGGG - Intronic
960627929 3:119699625-119699647 CTGTGAGAAGATAAGGAGGTGGG + Intergenic
961616813 3:128188948-128188970 TTGTGAGTCTGTAGGGGAGTTGG + Intronic
961781255 3:129321701-129321723 GTGTGAATGTGTAAGAAAGTGGG - Intergenic
963291745 3:143497316-143497338 CTGAGAGTAGGGAATGAAGTGGG - Intronic
964140097 3:153388129-153388151 CTGTGATTCTGTAAGCAAGAAGG + Intergenic
964364750 3:155937981-155938003 CTGTGAATATGTATGAAGGTGGG + Exonic
970898676 4:21133227-21133249 CATTGTGTATGTGAGGAAGTAGG - Intronic
971128543 4:23780494-23780516 CTTTGAGTTTGTAAGGATGCTGG - Intronic
971562995 4:28105380-28105402 CTCTGAGGATGTAAGGCATTTGG + Intergenic
972388470 4:38590277-38590299 TTGAGAGGATGTAAGGAAGGAGG - Intergenic
972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG + Intergenic
973639773 4:52891352-52891374 CAGTGGGTAAGTAAGGAAGGTGG + Intronic
976063871 4:81161610-81161632 CTGTCAGTCAGTAAGGAAATGGG - Intronic
977246726 4:94640100-94640122 CTGTGACTATGTAGGTAAATGGG - Intronic
977546614 4:98389527-98389549 ATGTGAGTATATAATGAATTTGG + Intronic
977777225 4:100935430-100935452 CTGAGAGTATGTAAGGCCCTAGG + Intergenic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978497636 4:109377320-109377342 CTGTGAGTATGTAGAGAGATGGG + Intergenic
980843058 4:138290076-138290098 ATGTGATTATATAATGAAGTTGG + Intergenic
987287553 5:16472781-16472803 GTGTGAGGATGGGAGGAAGTTGG - Intergenic
988001512 5:25355484-25355506 GTTTGTGTATGTTAGGAAGTGGG + Intergenic
988494167 5:31730599-31730621 GTGTGTGTGTGTAAGGGAGTTGG + Intronic
988662459 5:33286516-33286538 CAGTGAGTATCTAAGGAATCTGG - Intergenic
989451309 5:41589290-41589312 CTGAGAGAATTTAAGGAATTGGG - Intergenic
989651250 5:43692947-43692969 CTTTGAGTATGTGAGAAAGAAGG - Intronic
990587162 5:57223620-57223642 GTGTGAGGAGGTAAGGAAGGTGG - Intronic
990637445 5:57745005-57745027 GTGTGTGTATGTAAGAAAGGAGG - Intergenic
991939304 5:71835069-71835091 ATCTGAATATGTAAAGAAGTTGG + Intergenic
992093748 5:73341485-73341507 ATGTGAGGATGCAAAGAAGTTGG - Intergenic
992982887 5:82195013-82195035 CTGTGAATAAGCAAGGAAGATGG - Intronic
994643150 5:102435508-102435530 CTTTGAGTATATAAGGTAGCAGG + Intronic
995226651 5:109708369-109708391 ATGGGAGTTTGTAAGGAAGGGGG + Intronic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
998128521 5:139639525-139639547 CTGGGAGTATGGAAGGTAGCAGG - Intergenic
998374817 5:141683200-141683222 CTGTTTGTATGAGAGGAAGTTGG + Intergenic
998779986 5:145646130-145646152 CTGGGAGTATGGAACCAAGTTGG - Intronic
999285128 5:150390070-150390092 ATGTGGGTAAGTATGGAAGTAGG - Intronic
999514203 5:152284642-152284664 CTGTGAGGCAGTAAGGAAGCAGG + Intergenic
1000115511 5:158149911-158149933 CTGTGAGGATGTGAGGATGCAGG + Intergenic
1003172036 6:3727458-3727480 CTGTTCTTATGGAAGGAAGTGGG - Intronic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1005036296 6:21558136-21558158 ATGTGATGATGTTAGGAAGTGGG + Intergenic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009727707 6:67556953-67556975 CTGGGAGAATGGAAGCAAGTTGG - Intergenic
1010046005 6:71444359-71444381 GTGTTATTTTGTAAGGAAGTAGG - Intergenic
1010366138 6:75053690-75053712 CTGTGAGTATTTAACAAACTGGG + Intergenic
1010515271 6:76765538-76765560 CTATGAGGATGGAAGAAAGTCGG + Intergenic
1010615502 6:78007080-78007102 CGGGGAGAATGGAAGGAAGTTGG + Intergenic
1011726314 6:90213750-90213772 CTGTATGTATGTAAGGCAGCGGG - Intronic
1014269003 6:119314802-119314824 CTGTGAGAATTGAAGGATGTAGG - Intronic
1014796427 6:125730269-125730291 CACTTAGTATGTAGGGAAGTTGG - Intergenic
1017349523 6:153423254-153423276 CTGTCAGTAAGAAAGGAAGATGG - Intergenic
1017442216 6:154474897-154474919 CTGTGAGTGAGTCAGAAAGTTGG + Intronic
1017766337 6:157610087-157610109 CTGTGAATATTTAAGGTGGTTGG - Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1021292128 7:18858867-18858889 CTGTGAGTTAGAAGGGAAGTAGG - Intronic
1021496986 7:21286115-21286137 CTGTGAGGATGTGAAGAAATTGG + Intergenic
1023714881 7:43033757-43033779 CAGTGAGAATGTAAAGAAATTGG + Intergenic
1024779924 7:52836129-52836151 CAGTTAGTATGTGAGGATGTGGG - Intergenic
1028727063 7:94100209-94100231 ATGTGAGTATGTAGGAAAATGGG + Intergenic
1030288526 7:107849496-107849518 CTGTGACTATCAAAAGAAGTGGG - Intergenic
1031986923 7:128169252-128169274 CTGTGAGAATGTCTGGAAGGGGG - Intergenic
1032491966 7:132330544-132330566 ATGTGAAAATGTAAAGAAGTTGG + Intronic
1037855866 8:22370253-22370275 GTGTGAGCAGGTAAGGAAGGAGG - Intronic
1038079218 8:24114156-24114178 CTTTGAGTATGGAATAAAGTGGG + Intergenic
1044542386 8:93422367-93422389 CTTAGAATATGTCAGGAAGTGGG + Intergenic
1046071871 8:109265501-109265523 ATGTCATTATGAAAGGAAGTAGG - Intronic
1047054711 8:121151276-121151298 CAGTCAGTATGTAAGGAACCAGG - Intergenic
1047686519 8:127310294-127310316 CTGTGAGTATGTGATGAGATGGG + Intergenic
1047980988 8:130181939-130181961 CTGTGTATAGGTAAGGATGTTGG - Intronic
1049499631 8:142955022-142955044 CTGTGAGGGTGTAAGGAAGGGGG - Intergenic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1055716978 9:79128512-79128534 ATGTTAGTATGGAAGGAAGCTGG - Intergenic
1057581189 9:96289221-96289243 ATGTGTGTGTGTATGGAAGTGGG + Intronic
1057958069 9:99427552-99427574 ATGTGATTATGTTAGGAAGATGG + Intergenic
1059113269 9:111577318-111577340 TGGTGAGTATGTAGAGAAGTTGG + Intronic
1062187500 9:135225947-135225969 CTGTGAGTGTGTGAGCACGTGGG - Intergenic
1185913313 X:4006511-4006533 CTGTGTGTATGTCAGGAGGCAGG + Intergenic
1187744244 X:22390877-22390899 CTGTGAGGATTTAAAGAAATAGG - Intergenic
1187777450 X:22778105-22778127 CTGTGAATATGTGAAGAAATTGG - Intergenic
1190434413 X:50409040-50409062 CTGTGATTCTATATGGAAGTAGG + Intronic
1194240670 X:91443478-91443500 CTTTGTGTTTGTAAGGAAATTGG + Intergenic
1195976758 X:110535353-110535375 ATCTGAGTAAGTAGGGAAGTTGG + Intergenic
1197407999 X:126077725-126077747 CTGGTATTATGTAAGGACGTAGG - Intergenic
1197724196 X:129765510-129765532 TAGTGAGTATGTGAGGAAATGGG - Intronic
1198435912 X:136616788-136616810 GTGTGGGTATGTGAGGGAGTGGG - Intergenic