ID: 1158068028

View in Genome Browser
Species Human (GRCh38)
Location 18:53437047-53437069
Sequence AAACCTAATCCCTGTTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158068028_1158068032 -2 Left 1158068028 18:53437047-53437069 CCTCCCTAACAGGGATTAGGTTT 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1158068032 18:53437068-53437090 TTCAACATAAGAATTTTGGAAGG 0: 10
1: 179
2: 811
3: 1973
4: 3290
1158068028_1158068031 -6 Left 1158068028 18:53437047-53437069 CCTCCCTAACAGGGATTAGGTTT 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1158068031 18:53437064-53437086 AGGTTTCAACATAAGAATTTTGG 0: 10
1: 208
2: 847
3: 2390
4: 3998

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158068028 Original CRISPR AAACCTAATCCCTGTTAGGG AGG (reversed) Intronic
907052048 1:51336144-51336166 AAACCTGTAACCTGTTAGGGTGG - Intronic
908016609 1:59845280-59845302 AAACCTAATCCCCATTGTGGTGG - Intronic
913005904 1:114630975-114630997 CAACTTAATCCTTGTTAGGGTGG - Intronic
915633210 1:157167992-157168014 AAACCTAATCCCTGATGAGATGG + Intergenic
919408329 1:197211641-197211663 AAACCTAATCCCCTTTGTGGTGG - Intergenic
924474467 1:244371132-244371154 AAACCTGTTCCCTGGGAGGGTGG - Intronic
1064909564 10:20385123-20385145 ACACCTAATCCCTTTCATGGGGG - Intergenic
1065243399 10:23731578-23731600 AAGCCTAAGCCCGGTTAGGGAGG + Intronic
1066198117 10:33121529-33121551 TCACCTCATCCCTGTTAGGATGG + Intergenic
1070923591 10:80204399-80204421 AAACCTAGTCCCTGTTGCGTGGG + Intronic
1072474681 10:95748941-95748963 AAACCTAATACCAGTTTGTGGGG - Intronic
1077440177 11:2564936-2564958 AATCCTATTCCGTGGTAGGGAGG + Intronic
1078922530 11:15843791-15843813 AAACCAAATCACTGTTAGCCAGG + Intergenic
1081150475 11:39623076-39623098 AAACCTAATCCCTATTGTGGGGG - Intergenic
1082120128 11:48371235-48371257 ACACCTAGTCCCTGTGAGGAAGG + Intergenic
1082254161 11:50013990-50014012 ACACCTAGTCCCTGTGAGGAAGG - Intergenic
1082873434 11:57964654-57964676 AAAACAAAGCCCTGTTAGGCAGG + Intergenic
1083043268 11:59708599-59708621 AAACTTAATCCCCATTAGAGTGG - Intergenic
1085034297 11:73290946-73290968 AAACCTAGACTCTGTTAGGAAGG + Intronic
1085586804 11:77716070-77716092 TCACCTAACGCCTGTTAGGGTGG + Intronic
1088697938 11:112384528-112384550 AAACGTAATCCCCATTATGGTGG - Intergenic
1089001577 11:115056341-115056363 AAACCTAATCCCTGATGTTGTGG + Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1091123455 11:133075933-133075955 AAACCTAATACCTGTTATTTGGG + Intronic
1094640046 12:32265191-32265213 AAGACTAATCTCTGTTAGAGGGG - Intronic
1095894849 12:47269849-47269871 AACCCTTATCCCTCTTAGTGCGG - Intergenic
1098812949 12:75119337-75119359 AAAACTAATCACTGCTAGGAAGG + Intronic
1102657776 12:114497508-114497530 AAACCGAATTCCTGTAAGAGTGG + Intergenic
1104492517 12:129207313-129207335 GAACCTAAGCTCTGTGAGGGCGG - Intronic
1108538641 13:51413987-51414009 GAAACTAATCCCTGCTTGGGTGG - Intronic
1110521528 13:76484546-76484568 AAATTTAATCCCTGTTTCGGTGG - Intergenic
1116429420 14:44828782-44828804 AAACCTAATCCCTAATATGACGG + Intergenic
1116939845 14:50780188-50780210 AAAACTAATCACTGTTATGGGGG + Intronic
1117393547 14:55285643-55285665 AAAACTAATACCTTTTAAGGAGG - Intronic
1119599437 14:75965182-75965204 AAACTTAATTTCTTTTAGGGAGG + Intronic
1122542042 14:102504136-102504158 ACCCCAAATGCCTGTTAGGGAGG - Exonic
1123631631 15:22264802-22264824 AAATCTAATCCCTCTAAGGTGGG - Intergenic
1123675400 15:22706297-22706319 GAACCTATTCCCTGTCATGGTGG - Intergenic
1124327392 15:28779253-28779275 GAACCTATTCCCTGTCATGGTGG - Intergenic
1124529403 15:30491256-30491278 GAACCTATTCCCTGTCATGGTGG - Intergenic
1124769252 15:32516434-32516456 GAACCTATTCCCTGTCATGGTGG + Intergenic
1135574407 16:23574244-23574266 AAATCAAATGCCTGTTTGGGAGG + Exonic
1135846360 16:25922217-25922239 AAACCTAATCCCTGGTGTGATGG + Intronic
1140958961 16:79894391-79894413 AAACCTGAGCCCTGTGAAGGGGG - Intergenic
1141162369 16:81638029-81638051 AAACCTAATCCCCAGTGGGGGGG - Intronic
1141260053 16:82444555-82444577 AAACATCACCCCTGTTAGGCAGG - Intergenic
1141971366 16:87485627-87485649 AAATCTAATCCCTCTAAGGTGGG + Intronic
1147249021 17:39141845-39141867 TAACCTCATACCTGTTAGGATGG - Intronic
1149156282 17:53633384-53633406 AAACCTAACTGCTGTTAGGCGGG - Intergenic
1158068028 18:53437047-53437069 AAACCTAATCCCTGTTAGGGAGG - Intronic
1159554093 18:69927041-69927063 AAACCTAATCCCCATTGTGGTGG + Intronic
1160191178 18:76715058-76715080 CAACCTAATCCCTGTTCTGCTGG + Intergenic
1161409625 19:4109770-4109792 AAAACTGATCCCTATTAGGCCGG - Intronic
1164174005 19:22751707-22751729 AAACCCAAGTCCTGTTGGGGAGG - Intergenic
1164760860 19:30727308-30727330 AAACCTAATCTCCAGTAGGGTGG - Intergenic
1166940217 19:46358405-46358427 ATACCTAATGCCTGAAAGGGGGG - Intronic
926153272 2:10436129-10436151 AATCCTATTCCCTGCCAGGGTGG - Intergenic
926415968 2:12650057-12650079 AATCCTGAACCCTGTGAGGGAGG - Intergenic
926815966 2:16797809-16797831 AAACCTAATGGCAGTTAGGGCGG + Intergenic
928122591 2:28593787-28593809 ACACCTAATCTCTGTTGTGGGGG - Intronic
928619714 2:33076482-33076504 AAACCTAATGACTGTTAGCGAGG + Intronic
929018902 2:37530840-37530862 AAACCTAATCCCCATTGTGGTGG + Intergenic
936045174 2:109181851-109181873 AAACCTAATTCCTGCCAGGATGG - Intronic
936608165 2:113977900-113977922 AAACCTAATTTCTGGTAGGAAGG - Intergenic
938645754 2:133328422-133328444 AAACTTAATACATTTTAGGGGGG + Intronic
943718119 2:191174460-191174482 AAACCTAATCCCTCCTAAAGGGG + Intergenic
943767207 2:191676153-191676175 CAACCTAATCCCTTTTCTGGGGG + Intergenic
947354947 2:229282439-229282461 AAACGTAATAGCTGTTAGGTTGG - Intergenic
1170743548 20:19078772-19078794 AATCCTAACCCCTGATGGGGTGG + Intergenic
1173082347 20:39880199-39880221 AAATCTAGTTCCTGCTAGGGTGG + Intergenic
1173158140 20:40632278-40632300 AAACATAAGGCCTGTTAGGGAGG - Intergenic
1181591310 22:23886657-23886679 AAACCTAATCCCTCATATGATGG - Intronic
1183331448 22:37224228-37224250 GCACCTAATCCCTTTTAAGGGGG + Intergenic
952585294 3:34885627-34885649 AAACCGAATCCCGGTTGTGGTGG + Intergenic
953578682 3:44134042-44134064 AAACCTAATCCTTCTTTGGGAGG - Intergenic
955154427 3:56402577-56402599 GACCCTAATCACTGTTAGTGGGG - Intronic
956899341 3:73698094-73698116 ACACCTTATACCTGTTAGGATGG + Intergenic
957846902 3:85748662-85748684 CATCCTAATCCCATTTAGGGGGG + Intronic
958521701 3:95197979-95198001 GAACCTAATCCCCATTATGGTGG - Intergenic
958557772 3:95702529-95702551 TAACCTCATACCTGTTAGGAAGG - Intergenic
958570160 3:95870021-95870043 AAAATTAATCCCTGTTTGGTAGG - Intergenic
959145767 3:102542512-102542534 AAACAAAATCCCTGTTAGGCTGG + Intergenic
960307020 3:116074294-116074316 AAACCTCTTCCCTGTTTTGGGGG - Intronic
960726212 3:120672940-120672962 AAAATTAATCCCTGATAGGTAGG + Intronic
963146502 3:142000475-142000497 AAACCTAATCCCTACTGTGGTGG - Intronic
963188473 3:142443287-142443309 AAACCTAAGTGCTGTTGGGGAGG - Intronic
963857050 3:150265615-150265637 ACACATAATCCCTATTAGAGTGG - Intergenic
966098925 3:176242647-176242669 AAGCCTAATGACAGTTAGGGAGG - Intergenic
967807481 3:193728588-193728610 AAAGCTACTCCTTGTTTGGGAGG - Intergenic
971032984 4:22661077-22661099 ATCCCTAATCCCTTTTTGGGGGG + Intergenic
973578182 4:52313899-52313921 GAACCTAACCCCAGTTAGAGTGG - Intergenic
974790528 4:66682697-66682719 AAACCTAATCCCCATTATGGTGG + Intergenic
976186587 4:82448562-82448584 AAACTTAAGCCCTTTTTGGGTGG - Intronic
976190109 4:82479296-82479318 AAACCTAAGTGCTGTTGGGGAGG - Intergenic
976282175 4:83336098-83336120 AAACTTAATCTCTGTTTTGGTGG - Intergenic
978816313 4:112910511-112910533 AAACCTAATATCTGTAAAGGGGG + Intronic
979610519 4:122684226-122684248 AAAGCCAAACCCTGGTAGGGGGG - Intergenic
981102698 4:140847573-140847595 AACCCTAATCCCTATTTTGGTGG - Intergenic
983925597 4:173398291-173398313 AAGCCTGATCACTTTTAGGGAGG - Intronic
985096148 4:186415038-186415060 AAACCCAAACCCTGTCACGGGGG - Intergenic
989443477 5:41501009-41501031 TCACCTAATACCTGTTAGGATGG + Intronic
990301991 5:54458568-54458590 AACCCTAAGCCCTGTGAGAGTGG - Intergenic
990744473 5:58944947-58944969 AAACCTAACGACTGTTAGCGAGG + Intergenic
992019227 5:72605904-72605926 AAATCTAATCCCTTGTATGGAGG - Intergenic
992419074 5:76583356-76583378 ACACCTAATCTCTGTGTGGGAGG - Intronic
993116289 5:83722874-83722896 AAACCTGTTCCCTGTGCGGGAGG - Intergenic
993701446 5:91123562-91123584 AAACCTAATCCCCATTGTGGTGG - Intronic
994950401 5:106454225-106454247 AAACTTATCCCCTGTAAGGGTGG - Intergenic
995125648 5:108574903-108574925 AAACCTAAGTGCTGTTGGGGAGG + Intergenic
997103192 5:130990896-130990918 AGAATTAATCCCTGTTAGGGAGG - Intergenic
998210409 5:140192910-140192932 AAACCTGACTCCTGTTAGGAAGG + Intronic
1000678822 5:164157944-164157966 AAACCTAATCCCTGCTGTGATGG - Intergenic
1003331415 6:5132127-5132149 AAACTTAATCCCTGAGAGGCAGG - Intronic
1004223405 6:13766138-13766160 AAACCTAATAGCTGTTATAGAGG + Intergenic
1004485459 6:16062368-16062390 AAACATAAACTCTGTAAGGGTGG - Intergenic
1004814314 6:19296160-19296182 ACACATAATCCCGGGTAGGGTGG - Intergenic
1008788719 6:55202730-55202752 AAACCTAATCCCTAATATGATGG - Intronic
1009386479 6:63088951-63088973 CAACGTAACACCTGTTAGGGAGG + Intergenic
1012370602 6:98501728-98501750 AAACATATTCCCTTTGAGGGTGG + Intergenic
1012969115 6:105707627-105707649 AAACCTAATCCATGTGATGAGGG - Intergenic
1015234321 6:130953392-130953414 AAACCTAATCCCTATGGTGGTGG + Intronic
1018778788 6:167043935-167043957 AAACCTAATCCCACATAGGATGG + Exonic
1020565767 7:9793679-9793701 AAACTTAATCTCTATTATGGTGG - Intergenic
1023898252 7:44452982-44453004 AAACCCAATTACTGTTATGGAGG + Intronic
1024595903 7:50937216-50937238 AAACCTGACCCTTGTTAGGCAGG - Intergenic
1025014817 7:55430644-55430666 AAACAAAAACCCTGTAAGGGAGG + Intronic
1028587789 7:92468726-92468748 AAACCTAAGTGCTGTTGGGGAGG + Exonic
1040407909 8:47126475-47126497 AAACAGAATCCCTTTTAGTGGGG - Intergenic
1040862032 8:52008812-52008834 AAACCTAATCCCTGCTGTGAGGG + Intergenic
1043929349 8:86073034-86073056 AAAATTAATCCCTGTAGGGGGGG - Intronic
1044157453 8:88865564-88865586 TAACCTCATACCTGTTAGGTTGG - Intergenic
1049954898 9:683684-683706 CAACATAATCCCTATCAGGGAGG - Intronic
1050773961 9:9237163-9237185 AAACCTGATTCCTGATAGGAAGG + Intronic
1050907689 9:11026580-11026602 AAAGGTAATCCCTGTTTTGGAGG - Intergenic
1053031675 9:34785370-34785392 CAACTTAATCCCCGTTATGGTGG - Intergenic
1054767839 9:69057121-69057143 AAAACTAATGGCAGTTAGGGAGG + Intronic
1060307819 9:122432356-122432378 AAAAGTAACCACTGTTAGGGAGG - Intergenic
1060805458 9:126573003-126573025 AAACTTAATCCCTATTATGGTGG - Intergenic
1187207396 X:17196380-17196402 AAACCTAATCCCTAATATGATGG + Intergenic
1191222879 X:58009186-58009208 AAACCTAATACTTGTTGGCGTGG - Intergenic
1194257729 X:91654823-91654845 AAACATAAGACCTATTAGGGAGG - Intergenic
1200576386 Y:4893766-4893788 AAACATAAGACCTATTAGGGAGG - Intergenic
1201667192 Y:16471764-16471786 AAACATAATCCCTGTTAATGGGG + Intergenic
1201906716 Y:19093001-19093023 ACAGCTAATCCATATTAGGGAGG - Intergenic