ID: 1158069671

View in Genome Browser
Species Human (GRCh38)
Location 18:53456077-53456099
Sequence GTGATCAATGCCAAGGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158069671 Original CRISPR GTGATCAATGCCAAGGTGAG TGG Intronic
901268865 1:7934760-7934782 TTTATCAATGCCAAGGAAAGGGG - Intronic
902151327 1:14445771-14445793 GTGATCCCAGCCAAGATGAGAGG + Intergenic
902808872 1:18877200-18877222 GTGATTGATGCCAAGGTACGGGG - Exonic
902886608 1:19409278-19409300 AGACTCAATGCCAAGGTGAGGGG + Intronic
905207864 1:36353195-36353217 CTGCTCAATGCCGAGTTGAGAGG + Intronic
907286961 1:53386877-53386899 CTGATCAATGCCTGTGTGAGAGG + Intergenic
910927218 1:92409844-92409866 CTGCTCAATGTCAAGGTGACTGG + Intergenic
911110363 1:94177530-94177552 GTGATTAAAACCAAGGTGAGGGG - Intronic
912870028 1:113295150-113295172 ATGACCAAAGCCAAGGTCAGAGG + Intergenic
913187382 1:116381143-116381165 GTGCCCAATGCCCAGATGAGTGG + Intronic
915167241 1:153954959-153954981 GAGATGAATCCAAAGGTGAGTGG + Exonic
916824592 1:168431357-168431379 GGGATTAATGCCAAGGAGACTGG - Intergenic
921720420 1:218464837-218464859 GTGAACAATGCTCAGGGGAGAGG - Intergenic
924500237 1:244630723-244630745 GTTCTCAATGCCATGGTGAAAGG + Intronic
924797110 1:247300456-247300478 CTGATCAGTACCAAGGTGAGGGG + Exonic
1063139729 10:3245429-3245451 ATGATCAAGGCCAAGGAGAAGGG + Intergenic
1064381688 10:14847854-14847876 GTGATCATTTACAAGATGAGTGG + Intronic
1065943140 10:30583167-30583189 GGGAGCAATGCCAAGGTTGGAGG - Intergenic
1066243117 10:33556841-33556863 GGGATCGATGACAGGGTGAGCGG + Intergenic
1067151822 10:43742187-43742209 GTGATAAAAGCCATGCTGAGTGG - Intergenic
1070564595 10:77594143-77594165 ATGGTCAAAGTCAAGGTGAGGGG + Intronic
1071093895 10:81951178-81951200 CTGATCAATGCCAATTTGAACGG - Intronic
1071429763 10:85597712-85597734 GTGCTCAATGTCAAGTTCAGAGG + Intergenic
1073734011 10:106325709-106325731 GGGCTCAATACCAAGGTGATGGG - Intergenic
1074383162 10:112996507-112996529 ATGCTGAAGGCCAAGGTGAGGGG - Intronic
1076821001 10:132939534-132939556 CTGCTCAATGCCCAGGTGGGAGG + Intronic
1081969021 11:47185898-47185920 CTGATCACCGCCAAGGGGAGGGG + Intronic
1085601372 11:77859037-77859059 GTTATCAATGCCTAAGTGAAAGG + Intronic
1088567616 11:111189148-111189170 GTGCTTAATGCCAGGGTGATGGG + Intergenic
1096058357 12:48674680-48674702 GTGCACAAGGCCAAGGTGGGTGG + Intronic
1101820199 12:108178191-108178213 GCCATCTATGCCAAGGAGAGGGG - Intronic
1103803515 12:123555143-123555165 GTTATCAATGCCTAAGTGAAAGG - Intergenic
1107420810 13:40244756-40244778 GTGATCCATGCCAATATCAGAGG + Intergenic
1108617872 13:52152601-52152623 GATATCAAGTCCAAGGTGAGTGG - Exonic
1108877095 13:55060509-55060531 GCTATCAATGCCAAAGTGAAAGG - Intergenic
1112206027 13:97324215-97324237 GTGATCAATGCCATGATAGGCGG - Intronic
1113157936 13:107346591-107346613 GTGATGATTGCCAGGGTGTGGGG + Intronic
1114420049 14:22574365-22574387 GTGATGAAGGCCAAGCAGAGAGG + Intronic
1114547440 14:23513137-23513159 GAGATCAGTGCCAAGCTGGGGGG - Intergenic
1115651022 14:35403335-35403357 GTGATCACAGCCAAGTGGAGTGG + Exonic
1116247609 14:42436210-42436232 ATGATAAATGCCATGGTGAAGGG + Intergenic
1116302032 14:43195187-43195209 GTGCTTAATGCCTAGGTGATGGG + Intergenic
1117809415 14:59530674-59530696 GTGATTATTGCCAAGGAGGGTGG - Intronic
1118504153 14:66392228-66392250 ATGATCAGTGCAAAGGTGATAGG + Intergenic
1120951505 14:90046059-90046081 GTGCCCCTTGCCAAGGTGAGGGG + Intergenic
1121102957 14:91262846-91262868 GTGGTCAATTCCAAGGCAAGGGG - Intergenic
1122480237 14:102042493-102042515 GAGATCAACCCCAAGGTGGGTGG + Exonic
1122943292 14:104993050-104993072 CTGATCCAGACCAAGGTGAGTGG + Exonic
1127613231 15:60657426-60657448 ATGAACAAAGCCAAGGTAAGTGG + Intronic
1127830607 15:62747663-62747685 TTGACCAATGCAAAGGTTAGGGG + Intronic
1128079048 15:64845419-64845441 GTGAACCCTGCCAAGGGGAGGGG + Intronic
1130764427 15:86855767-86855789 CTGCTCAATTCCAAGGGGAGGGG + Intronic
1133782753 16:8952563-8952585 GTCATCAGTGCCAGAGTGAGGGG - Intronic
1134880773 16:17743754-17743776 CTGATTACCGCCAAGGTGAGAGG + Intergenic
1135375544 16:21943941-21943963 GGGATCCCTGGCAAGGTGAGAGG - Intergenic
1135618880 16:23935916-23935938 GTGCTCACTGCCAGGGTGACGGG + Intronic
1136127338 16:28193686-28193708 GTGAGCAAGGCCAAGGTTATTGG - Intronic
1136233410 16:28900902-28900924 GAGATCACAGCCATGGTGAGAGG + Exonic
1137949239 16:52766974-52766996 GTTATCTGTCCCAAGGTGAGGGG + Intergenic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1143026276 17:3943711-3943733 GCGATCAATGCCAGTGTGGGGGG - Intronic
1143595211 17:7909833-7909855 TCTATCAATGGCAAGGTGAGAGG - Intronic
1144621735 17:16822613-16822635 GTGATGAAAGCCAAGGGGAATGG - Intergenic
1144884686 17:18450101-18450123 GTGATGAAAGCCAAGGGGAATGG + Intergenic
1145147540 17:20494276-20494298 GTGATGAAAGCCAAGGGGAATGG - Intergenic
1147573721 17:41586955-41586977 GTGATGAAAGCCAAGGGGAATGG - Intergenic
1149555840 17:57572917-57572939 GTGACCAATGCAAAGGTAACAGG + Intronic
1150977822 17:70108827-70108849 GTTATCAATGTCAAGCTCAGAGG - Intronic
1151193486 17:72415543-72415565 GGCATCTGTGCCAAGGTGAGCGG + Intergenic
1151519951 17:74620806-74620828 AAGATAAAGGCCAAGGTGAGCGG + Intronic
1152316476 17:79583573-79583595 GGGATCAATGACAAGGTCAAGGG + Intergenic
1153264720 18:3258867-3258889 GTGAATAATGCCTAGGTGTGGGG + Intergenic
1153345724 18:4023988-4024010 GAGATAAATGCCAATGAGAGAGG - Intronic
1153397368 18:4639779-4639801 GTGGTCAATGCCAAACTGGGAGG + Intergenic
1153448973 18:5205486-5205508 TTCATAAATGCCAGGGTGAGGGG + Intergenic
1154360575 18:13657072-13657094 GTTATCAATGCCTAAGTGAAAGG - Intergenic
1158069671 18:53456077-53456099 GTGATCAATGCCAAGGTGAGTGG + Intronic
1158497565 18:57970279-57970301 GAGCTCAATGGCAAAGTGAGTGG + Intergenic
1159767460 18:72507920-72507942 GGTATCAATGCCAAGCTGAAGGG - Intergenic
1160836952 19:1129386-1129408 GTGATCAGTGCCCAGGTGCTTGG - Intronic
1164822768 19:31263398-31263420 GTTATGAATGCCAAGAGGAGAGG - Intergenic
1166590705 19:43995620-43995642 GTGATCAATCCCAAAGTGCTGGG + Intronic
1166854606 19:45777334-45777356 GGGCTCACTGCCATGGTGAGCGG - Exonic
1167742054 19:51329637-51329659 GAAATCAAGGCCAAGGGGAGTGG - Exonic
924998464 2:385259-385281 ATGCTGAATGCCAGGGTGAGAGG - Intergenic
925305998 2:2848810-2848832 CTGAGCAAGGCCAAGGAGAGAGG + Intergenic
925525055 2:4790688-4790710 GTGAGCAATGCGAAGGAGATGGG - Intergenic
929713373 2:44287207-44287229 GTGGTGAATGCCAAGGGGAAGGG + Intronic
930653918 2:53989702-53989724 GTAAGCAATGCCAAGATGAAGGG + Intronic
932148279 2:69344082-69344104 GTAATTAATGCCAAGGTCTGTGG - Intronic
932200307 2:69820870-69820892 GTGCTAAATGCCAAGGTCAGAGG - Intronic
933691387 2:85181863-85181885 GTGTTCAGTGCCAAGGCCAGGGG + Intronic
933730975 2:85456100-85456122 GAGATCACTCCCAAGGTGAGTGG + Intergenic
936373167 2:111919732-111919754 GTGTTCAAGGCCAAGCAGAGAGG + Intronic
936534321 2:113300181-113300203 GTCATCAATGCCAAGCTCAATGG + Intergenic
937628765 2:124074610-124074632 CTGATAAATGCCAAAGGGAGAGG - Intronic
939119869 2:138103464-138103486 TTGATCAATGGCAAGGTTGGAGG + Intergenic
941717208 2:168776826-168776848 CACATCAAGGCCAAGGTGAGAGG - Intergenic
942126686 2:172832958-172832980 GTGATCCCAGCCAAGGTGGGCGG + Intronic
944500000 2:200349683-200349705 GTTCTCAATGCCCAGGTCAGGGG + Intronic
945090773 2:206173762-206173784 GTGCTCACTACCAGGGTGAGAGG - Intergenic
946174015 2:217911772-217911794 GAGATCATTGCCAGGGAGAGGGG - Intronic
946459929 2:219859861-219859883 GTATTAAATGCCAAGGTGGGAGG - Intergenic
1169657855 20:7945052-7945074 GTGATCACTACCTAGGTGACAGG - Intergenic
1171033707 20:21699720-21699742 ATGATTTATGCCAAGGTGGGTGG + Intergenic
1171528771 20:25837395-25837417 CTAATCAAAGCTAAGGTGAGAGG - Intronic
1171548055 20:26018491-26018513 CTAATCAAAGCTAAGGTGAGAGG + Intergenic
1175435545 20:58944981-58945003 TTTCTCAAGGCCAAGGTGAGTGG - Intergenic
1175718688 20:61272618-61272640 GTGATAAATGCCCAGTTTAGGGG + Intronic
1176043954 20:63082931-63082953 ATAATCAATGCCAGGGTGAGTGG + Intergenic
1177755238 21:25338675-25338697 GTGATCAAAGGCAAGGCTAGTGG - Intergenic
1178104812 21:29306052-29306074 GTGATGAATGCATAGGTTAGTGG + Intronic
1178364926 21:31982005-31982027 GGGATTAATGCCTAGGTGATGGG - Intronic
1182017410 22:27052339-27052361 GAGATCAATGCGGGGGTGAGTGG - Intergenic
1182738787 22:32551185-32551207 CTGATCAATGCCAAGGCCACTGG + Intronic
1184017685 22:41798621-41798643 GTAATCCCAGCCAAGGTGAGTGG + Intronic
955022316 3:55133041-55133063 GAGGCCAAGGCCAAGGTGAGTGG + Intergenic
959760836 3:109962705-109962727 GTGATCAATTCCAAAATGAAAGG - Intergenic
961490884 3:127256076-127256098 CAGATCCATGCCCAGGTGAGGGG - Intergenic
964287879 3:155140278-155140300 GAGATCAATGGGAAGGTAAGTGG + Exonic
968547896 4:1207946-1207968 GTGCTTGATGCCAAGGGGAGCGG + Intronic
969527939 4:7713548-7713570 GAGTTCAAAGCCAAGGTCAGTGG + Intronic
969683121 4:8654117-8654139 GGGCTCAATGCCTAGGTGATGGG - Intergenic
970875838 4:20868871-20868893 ATGCTCACTGCCAAGGTGACAGG + Intronic
972648100 4:40989279-40989301 GTGATCAGTGACCAGTTGAGGGG - Intronic
973850935 4:54960916-54960938 ACTATCAATGCCAGGGTGAGGGG - Intergenic
977850151 4:101817583-101817605 GTGATTAATGCCTGGGTGATTGG + Intronic
978790847 4:112662379-112662401 CTCTTGAATGCCAAGGTGAGAGG - Intergenic
981923849 4:150116787-150116809 GTGATGAAGGCCATGGTGATAGG + Intronic
982557197 4:156882218-156882240 GTAATGAATGCCAAGCTTAGTGG - Intronic
985552319 5:539953-539975 GTGATCGATGCCAAGGTCACGGG - Intergenic
985925177 5:3010449-3010471 GTCATCATTCCCAAGTTGAGAGG + Intergenic
986157835 5:5194297-5194319 GTGCTAAATGCCAAAATGAGTGG + Intronic
986485864 5:8236299-8236321 GGGATTAATGCCTAGGTGATGGG - Intergenic
986588710 5:9346314-9346336 GTGATAAATGCCAATGAAAGTGG - Intronic
986899834 5:12417953-12417975 GTGCTCACTGCCAGGGTGACAGG + Intergenic
987288650 5:16487070-16487092 GTGATCAGTGCCAAGGATGGTGG - Intronic
993040770 5:82812219-82812241 GTGCTTAATGCCTAGGTGATGGG - Intergenic
993124675 5:83819030-83819052 ATGATCAATACCAGGGTGATAGG - Intergenic
996495684 5:124152513-124152535 GTAAACACTGCCTAGGTGAGAGG + Intergenic
996983049 5:129523456-129523478 ATGATAAATGACAAGGAGAGGGG + Intronic
998667278 5:144312310-144312332 GTGATGAATGCCAAGGATAAAGG - Intronic
1001534098 5:172486512-172486534 CTGATCAACGCCAAGGGGCGGGG - Intergenic
1004702332 6:18091045-18091067 GTGAGCAATGGCAAGGAGGGAGG - Intergenic
1004992197 6:21150612-21150634 CTGATCAATCCCAAGGTCACTGG - Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007136782 6:39530106-39530128 GTAGGCAATGCCAAGGTGAACGG - Intronic
1007293386 6:40803382-40803404 GTGCTCAAGCCCAAGGGGAGGGG + Intergenic
1007679088 6:43621995-43622017 AAGATCCATGCCAAGGTGAGAGG - Exonic
1010563207 6:77376343-77376365 GTGATAAACACCAAGGAGAGAGG + Intergenic
1017145119 6:151227785-151227807 GTAATCCCAGCCAAGGTGAGTGG + Intergenic
1017865711 6:158441569-158441591 ATATTCAATGCCAAGGTCAGGGG - Intronic
1018503716 6:164441761-164441783 GTCACCAGTGCCATGGTGAGAGG + Intergenic
1019382866 7:735130-735152 GTGAGCAATGACATCGTGAGTGG - Intronic
1019382875 7:735289-735311 GTGAGCAATGACATCGTGAGCGG - Intronic
1019818253 7:3217413-3217435 GAGGGCAAAGCCAAGGTGAGGGG - Intergenic
1021115695 7:16744505-16744527 CTGAGCAAGGCCCAGGTGAGGGG - Intergenic
1021490008 7:21209402-21209424 GTGATCACTGAAAAGGTCAGTGG - Intergenic
1022868447 7:34448098-34448120 GTGATCACTACCTGGGTGAGGGG - Intergenic
1025776907 7:64568529-64568551 GAAATCAAGGCCAAGGGGAGTGG + Intergenic
1027361144 7:77411816-77411838 GTGAAGAATACTAAGGTGAGGGG + Intronic
1029105820 7:98174790-98174812 GAGTTCAATGACAAGGTGAGAGG + Intronic
1029165481 7:98586526-98586548 TTGAACAATGCCAAGGTTAGGGG + Intergenic
1031471716 7:122175241-122175263 GCTATCAATGCCAAAGTGAAAGG - Intergenic
1032191415 7:129767879-129767901 GTGTTTATAGCCAAGGTGAGTGG - Intergenic
1034445047 7:151109741-151109763 GGAATCAAAGCCAAGCTGAGGGG + Intronic
1039628956 8:39087799-39087821 TTGAACAATGCAAAGGTTAGGGG + Intronic
1041876624 8:62695092-62695114 GGGATCAAGGCTAAGGTGAGAGG - Intronic
1044861051 8:96524367-96524389 GTAATCAAAGCCAAGCTGATCGG - Intronic
1047799293 8:128292261-128292283 CTGATCAAGGTCAAGGTGTGAGG - Intergenic
1062249029 9:135584885-135584907 GTGCTCATTACCAAGGTGAGTGG - Intergenic
1189083848 X:37999981-38000003 GTGTTCAATGCCAAGATGTTGGG + Intronic
1194869976 X:99117383-99117405 GTAAACAATTGCAAGGTGAGGGG + Intergenic
1194937885 X:99972948-99972970 ATGACCAAGGCCAAGGAGAGAGG - Intergenic
1196043109 X:111227394-111227416 ATGGTCAATGCCAAGGGGGGTGG - Intergenic
1197115207 X:122823883-122823905 GTGCTCAATACCTAGGTGATGGG + Intergenic
1197521600 X:127505428-127505450 GTGTTCAATACCAGGGTGATGGG - Intergenic
1198654724 X:138900886-138900908 GTGATCCAGGCCAAGGGCAGAGG - Intronic
1201482641 Y:14456533-14456555 GAGATTGATGCCAAGGTTAGTGG - Intergenic