ID: 1158070386

View in Genome Browser
Species Human (GRCh38)
Location 18:53463056-53463078
Sequence AATATGGAGGTTCCTGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 173}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158070386_1158070393 28 Left 1158070386 18:53463056-53463078 CCTTTTGCAGGAACCTCCATATT 0: 1
1: 0
2: 2
3: 13
4: 173
Right 1158070393 18:53463107-53463129 TCTTGACTGGATATCAGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 136
1158070386_1158070394 29 Left 1158070386 18:53463056-53463078 CCTTTTGCAGGAACCTCCATATT 0: 1
1: 0
2: 2
3: 13
4: 173
Right 1158070394 18:53463108-53463130 CTTGACTGGATATCAGGGAGGGG 0: 1
1: 0
2: 0
3: 14
4: 145
1158070386_1158070392 27 Left 1158070386 18:53463056-53463078 CCTTTTGCAGGAACCTCCATATT 0: 1
1: 0
2: 2
3: 13
4: 173
Right 1158070392 18:53463106-53463128 TTCTTGACTGGATATCAGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 131
1158070386_1158070391 24 Left 1158070386 18:53463056-53463078 CCTTTTGCAGGAACCTCCATATT 0: 1
1: 0
2: 2
3: 13
4: 173
Right 1158070391 18:53463103-53463125 TTGTTCTTGACTGGATATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 165
1158070386_1158070389 15 Left 1158070386 18:53463056-53463078 CCTTTTGCAGGAACCTCCATATT 0: 1
1: 0
2: 2
3: 13
4: 173
Right 1158070389 18:53463094-53463116 CTTCTAGCTTTGTTCTTGACTGG 0: 1
1: 0
2: 0
3: 7
4: 137
1158070386_1158070390 23 Left 1158070386 18:53463056-53463078 CCTTTTGCAGGAACCTCCATATT 0: 1
1: 0
2: 2
3: 13
4: 173
Right 1158070390 18:53463102-53463124 TTTGTTCTTGACTGGATATCAGG 0: 1
1: 0
2: 0
3: 22
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158070386 Original CRISPR AATATGGAGGTTCCTGCAAA AGG (reversed) Intronic
908668557 1:66519885-66519907 AATATGGGGGATGCAGCAAATGG - Intergenic
908959561 1:69679271-69679293 AAAATGTAAGTTCCTGTAAAAGG - Intronic
912539040 1:110398491-110398513 AATATGGGGTTTCCAGCAAGAGG - Intergenic
913038304 1:114996901-114996923 AATAGGGAAGTTACTGGAAAGGG + Intergenic
913429468 1:118775026-118775048 AGTATGGAAGTTACTGAAAATGG - Intergenic
913431377 1:118796185-118796207 AGTATGGAGCTTCCTAAAAATGG - Intergenic
915634448 1:157176543-157176565 AATGGGGAAGTTACTGCAAAAGG - Intergenic
915651184 1:157312007-157312029 AATGAGGAAGTTACTGCAAAAGG + Intergenic
917035164 1:170740730-170740752 AATATAGAGATTGCTGCAAGGGG + Intergenic
917401916 1:174659022-174659044 AATATGGAGCTGCCTGGATAGGG - Intronic
918122635 1:181552791-181552813 AATATCCATGTCCCTGCAAAGGG - Intronic
918477017 1:184935838-184935860 GCTATGTAGGTTCCTGGAAAAGG - Intronic
923164277 1:231344693-231344715 ATTATGGAGGATCATGAAAAAGG + Intronic
1064310101 10:14204642-14204664 AAAAGAGAGGGTCCTGCAAAAGG - Intronic
1064490346 10:15849323-15849345 AGGATGGAGGTGCCAGCAAATGG + Intronic
1065887752 10:30093838-30093860 AATTTGGAGACTCTTGCAAAAGG - Intronic
1066370398 10:34814796-34814818 AATATGGCGCTTCCTGGAAGGGG - Intronic
1068464163 10:57366309-57366331 AATATTTACTTTCCTGCAAATGG + Intergenic
1070252473 10:74784960-74784982 CACATGGAGGTTCCTGGAGAGGG + Intergenic
1070264954 10:74893147-74893169 AGCATGGAGGTCCCAGCAAAGGG + Intronic
1074153518 10:110779348-110779370 CATGTGGAGGTTCCTGGAGAGGG + Intronic
1074392127 10:113066957-113066979 AATATGGAGGTTTCTTCAGAAGG + Intronic
1077453424 11:2664261-2664283 AACAAGGAGGTTGCTGCAAAGGG + Intronic
1081180419 11:39979476-39979498 AATATGGAGGTTATTGTCAATGG - Intergenic
1082836012 11:57650450-57650472 AATATGGAGGTAGCTGTTAAGGG - Intronic
1084013508 11:66365661-66365683 TACATGGAGGTTCCTGCACCAGG - Intronic
1084344105 11:68532411-68532433 AAAATGGAGTTTCCTCCAAAAGG - Intronic
1086432616 11:86749747-86749769 AATATGAATGTTCCTGCCTATGG - Intergenic
1087304235 11:96470348-96470370 AATGTGGAAGTACCTGCTAAAGG - Intronic
1088722773 11:112609042-112609064 ACCATGGAGATGCCTGCAAAGGG + Intergenic
1089402516 11:118172535-118172557 TGTATGGAGGTTCCTTTAAATGG - Intronic
1089918543 11:122184275-122184297 ACTCTTGAGGTTCCTGCAAAGGG - Intergenic
1089977874 11:122748070-122748092 CAAAAGGAGGATCCTGCAAAAGG + Intronic
1090822075 11:130351904-130351926 AGTATGGTGGTTCCTCAAAAAGG - Intergenic
1090843821 11:130514797-130514819 AATCTGCAGGTTCCTGAACAGGG + Intergenic
1091357732 11:134950662-134950684 AATATGGAGCATCTTACAAAAGG + Intergenic
1092172919 12:6384578-6384600 CATATGGAGGCACCTTCAAAGGG - Exonic
1092857941 12:12692622-12692644 AATATGAAAGTTTCTGAAAAAGG + Intronic
1093865588 12:24223302-24223324 AACATGAAGTTTCCTCCAAAAGG + Intergenic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097242527 12:57585437-57585459 AGTATGGAGGGTGCTGCATATGG - Exonic
1097607668 12:61775884-61775906 AGTATGGAAGTTCCTGCCAAAGG - Intronic
1098626049 12:72670583-72670605 ATTATAGAGGTCCATGCAAATGG + Exonic
1100428893 12:94512741-94512763 CATGTGGAGGTTCCTGGAGAGGG + Intergenic
1102830737 12:115996623-115996645 AACATGGAGGATCCCACAAAAGG + Exonic
1105643463 13:22290643-22290665 AGTTTGGTGGTTCCTTCAAAAGG + Intergenic
1105780676 13:23702828-23702850 AATGTGAAGGTTCTTGCAGAAGG + Intergenic
1106076216 13:26463709-26463731 AATATGATGGTTCATGCATAAGG - Intergenic
1108576910 13:51798789-51798811 AAAATGGATGTTCCAGCAGAAGG - Intronic
1111491563 13:88983088-88983110 AATATGGAACTTCATGGAAATGG + Intergenic
1117640931 14:57799101-57799123 AATATCGAGGTTCTTGCATTGGG + Intronic
1118174470 14:63424214-63424236 AAGATGGAGATTACTGGAAAAGG + Intronic
1119011766 14:71000020-71000042 AAAATCAAGGTTGCTGCAAAAGG - Intronic
1126122240 15:45263960-45263982 AACATGCAGATTCCTGCAAAGGG - Exonic
1128663504 15:69521334-69521356 AGTCTGGAGGCTCCTGCAGAAGG + Intergenic
1130782129 15:87051480-87051502 GACATGGAGGCTCCTGAAAATGG + Intergenic
1131469158 15:92681278-92681300 AATATGCAATTTCCTGAAAATGG - Intronic
1132209622 15:100010351-100010373 AATCAGGAGGTGCCTGCACAGGG + Intronic
1133512105 16:6469745-6469767 AACTTTGAGCTTCCTGCAAAAGG + Intronic
1141968471 16:87463426-87463448 AATGTGGAGGTTCATGCATCAGG - Intronic
1143180671 17:4982226-4982248 AAGATTGGGATTCCTGCAAAGGG - Intronic
1143742858 17:8966552-8966574 TCTATGAAGGTTCCTGCAGAAGG - Intergenic
1146314958 17:31799621-31799643 AATATGCATGTGCCTGCAAATGG - Intergenic
1149930468 17:60749163-60749185 AATATGTAGCTTTCTGAAAAAGG + Intronic
1153915447 18:9740847-9740869 CATATGGAAGTTGCTGCACAGGG + Intronic
1154497177 18:14970492-14970514 AATATGGAGCATCTTACAAAAGG - Intergenic
1157527813 18:48398377-48398399 CATATGCAGGGTCCTCCAAAGGG - Intronic
1158070386 18:53463056-53463078 AATATGGAGGTTCCTGCAAAAGG - Intronic
1166782160 19:45348491-45348513 AATATGGAGGGGCCCACAAAAGG + Intronic
1167919431 19:52770738-52770760 AATAAGGATGTTCCTGCAGTTGG + Intronic
926079483 2:9972847-9972869 ACTCTGGAGGTACCTGCACACGG - Intronic
929750493 2:44707186-44707208 AAGATAGAGGCTCCCGCAAATGG + Intronic
930589058 2:53305390-53305412 AATATAAAGGTTCCTACTAAAGG + Intergenic
932982464 2:76686484-76686506 GTTATAGAGGTTTCTGCAAACGG - Intergenic
934141809 2:89054174-89054196 AATGGGGAGGGTCCTGCAGATGG - Intergenic
934227432 2:90146372-90146394 AATGGGGAGGGTCCTGCAGATGG + Intergenic
936540685 2:113348382-113348404 AAGATTGATGTGCCTGCAAAGGG - Intergenic
937334707 2:121054994-121055016 AATATGCAAGATCCTCCAAAGGG + Intergenic
939836620 2:147137024-147137046 AATATGAGGGTTATTGCAAATGG - Intergenic
941052282 2:160748606-160748628 AATCTGGAAGTTGCTGCATAAGG + Intergenic
941236754 2:162984609-162984631 GAGACAGAGGTTCCTGCAAAGGG + Intergenic
941658206 2:168167233-168167255 AATATGCTGGTTCCAACAAAAGG + Intronic
943968926 2:194377999-194378021 AATATGGTGGTACCTCCAAATGG + Intergenic
944116920 2:196197216-196197238 AATACGGAGTTTCCTGAATAAGG + Exonic
945009147 2:205443250-205443272 AATTTGTAGGTTCCTGCTTACGG - Intronic
946597410 2:221321452-221321474 AATAAGCAGGTGCCTGCATAAGG - Intergenic
947272314 2:228351001-228351023 ATTATGGTGGTTACTGAAAAGGG - Intergenic
947671087 2:231935824-231935846 ACTATGAAGGTTCATGGAAAAGG - Intergenic
948816411 2:240512506-240512528 GAGATGGAGTTACCTGCAAAAGG + Intronic
1171429776 20:25075214-25075236 AATATGGTGCTTCCTGAAGAAGG - Intronic
1171935861 20:31274435-31274457 AATATGGAGGTGGCTGGAGAGGG - Intergenic
1172366341 20:34352775-34352797 AAGATGGAGCTGGCTGCAAATGG + Intergenic
1173433159 20:43009471-43009493 AAAAAGGAGGTTCCAGGAAAGGG + Intronic
1173885597 20:46455945-46455967 AAGATGCAGGTTTCTGCACATGG + Intergenic
1173929863 20:46809567-46809589 AGTATGGAGGATCCTGCAGGAGG + Intergenic
1176652104 21:9558830-9558852 AATATGAAAGTTACTGCTAAAGG + Intergenic
1177403722 21:20639189-20639211 ATTATGCTGGTTTCTGCAAAGGG + Intergenic
1177499369 21:21932318-21932340 AATTTGGAGGTTTATTCAAATGG + Intergenic
1177564895 21:22807736-22807758 AATAAGCAGTTACCTGCAAATGG - Intergenic
1180884259 22:19229018-19229040 AGTATGGTGGTTCCTCAAAAAGG + Intronic
1183823454 22:40366014-40366036 AATAAGGAGGCTACTGCAACGGG + Intronic
1184967650 22:47992756-47992778 AATGAGGAAATTCCTGCAAAGGG + Intergenic
949643964 3:6071676-6071698 ATTATGAAGTTTCCTGCAACTGG - Intergenic
950628459 3:14265636-14265658 GTTATGGAGGCTCCTGCACACGG - Intergenic
951088456 3:18542715-18542737 ATTTTGGAGTTTCCAGCAAATGG + Intergenic
951668300 3:25151207-25151229 AAGATGGAGCCTCCTGGAAATGG + Intergenic
951680208 3:25286626-25286648 ATTTTGGAGTTTCCTCCAAAGGG - Intronic
955520756 3:59773271-59773293 AATAAGCAGGCACCTGCAAAAGG + Intronic
957388720 3:79533142-79533164 AATATGGAGGCTGCAGAAAAGGG + Intronic
959318552 3:104841470-104841492 AACATGTAGGTTCATGAAAAAGG - Intergenic
959457697 3:106583656-106583678 AATATGTACGTTTCTGCTAAGGG - Intergenic
959639821 3:108620105-108620127 AATATGGAGGAACCTGCAGATGG - Intronic
961907473 3:130277375-130277397 AATATGGCGTTTCCAGGAAATGG - Intergenic
962264868 3:133937641-133937663 AATATGGAGACTCCAGCAAGAGG - Intronic
964388158 3:156171266-156171288 ACAATGGATGTTCCTGCAAGGGG - Intronic
964619279 3:158704647-158704669 AATATGTGAGTTCCTGCAATGGG - Intronic
971071167 4:23093859-23093881 AATAAAGAGGCCCCTGCAAATGG - Intergenic
971219458 4:24691655-24691677 AATATGGAGCTGCCTTGAAAAGG - Intergenic
972224367 4:36995549-36995571 TATGTGGAGGTTCCTGGAGATGG - Intergenic
972600620 4:40569279-40569301 AAAATGGAGTTTTCTTCAAAGGG + Intronic
973056100 4:45660073-45660095 AAAATGGTGGTTTCTGCAACAGG + Intergenic
977718357 4:100209426-100209448 CACATGGAGGTTCCTGGAAGGGG + Intergenic
983305726 4:165983692-165983714 AATTTAGAAGTTCCTTCAAAGGG - Intronic
983709124 4:170692987-170693009 CACATGGAGGTTCCTGGAGAGGG - Intergenic
983760225 4:171396021-171396043 AAAACAGAGGTTCCTCCAAATGG - Intergenic
984562764 4:181290442-181290464 ATTATGGAGGTGTTTGCAAAAGG + Intergenic
984711441 4:182888636-182888658 AATATTTAGGTTGTTGCAAAAGG - Intergenic
987879380 5:23722498-23722520 AAGATGGAGGATCCAGCAGAAGG - Intergenic
989660312 5:43790946-43790968 AATGGGGAGGGTCCTGCAGACGG - Intergenic
990198125 5:53342026-53342048 AAGATTGAGATACCTGCAAATGG - Intergenic
990483012 5:56229793-56229815 AATAGGAAGCTTCCTGCACATGG - Intronic
991024244 5:62012764-62012786 AATATAGAGGTTCCTGACATAGG - Intergenic
991186643 5:63816068-63816090 AAAATGAAGGTACCTGCAATAGG - Intergenic
991640867 5:68750783-68750805 AAAATGGAGTTTTCTGTAAATGG - Intergenic
993574936 5:89589253-89589275 AATATGGAGCTTCCTCTGAAAGG - Intergenic
996010208 5:118474027-118474049 AAAGTGGAGGTTGGTGCAAAAGG - Intergenic
997176211 5:131780773-131780795 AATAGGGAGGCTCCAGGAAAGGG - Intronic
997788274 5:136733687-136733709 AATCTGGAGGTTGCTAGAAAGGG - Intergenic
999700611 5:154224520-154224542 AATGAGGTGGTTCCTGGAAAAGG + Intronic
1000760859 5:165222757-165222779 AATATGGAGGTTCCTGAACAGGG - Intergenic
1002553167 5:180012733-180012755 ACTTTGGATGTTTCTGCAAATGG - Intronic
1004030958 6:11869176-11869198 AAAATAGATTTTCCTGCAAATGG + Intergenic
1006835948 6:36998968-36998990 TATAGGGAGGTTCCTGGAAAAGG + Intergenic
1013378966 6:109547201-109547223 AAAATTGAGGTTCATGAAAATGG + Intronic
1014302241 6:119696233-119696255 AAAATGGAGATAGCTGCAAATGG - Intergenic
1015137727 6:129892308-129892330 AAAATGGAGGTTAACGCAAAAGG + Intergenic
1016837091 6:148488555-148488577 CATATGGCGGTTCCTCAAAAAGG - Intronic
1018362404 6:163085469-163085491 AGTATGGAGGTGCATACAAAAGG - Intronic
1020081973 7:5291114-5291136 ACGATGGAGGTCCCTGCAGAGGG - Exonic
1021380495 7:19960105-19960127 AATATCGGGGTTCCTACCAAAGG + Intergenic
1021477747 7:21081794-21081816 GCTATGGAGCTGCCTGCAAAAGG + Intergenic
1021583591 7:22183742-22183764 AATCTGGAGGTTCCTGCACACGG - Intronic
1022767884 7:33435685-33435707 ATTATTGTGATTCCTGCAAATGG - Intronic
1023266632 7:38412858-38412880 AGTATGAAGGTGCCTGGAAAAGG + Intronic
1023840468 7:44094361-44094383 AATAATGAGGCTCCTGCAAAGGG + Intergenic
1024753716 7:52502999-52503021 AATATGGAGGCTGCTCCAAGGGG - Intergenic
1029788949 7:102822370-102822392 AAGATAGAGGTACCTGCAATTGG + Intronic
1030343440 7:108406586-108406608 AATAAGCAGGTTGCTGCATATGG - Intronic
1030918983 7:115356135-115356157 AATATGAAGGTAACTGCAAAAGG + Intergenic
1033067868 7:138173217-138173239 ATTATGGAGGTTCTTACAAAGGG - Intergenic
1033490398 7:141837797-141837819 GATATGGATGTTCCTCCTAAAGG + Intronic
1037695201 8:21217459-21217481 CATGTGGAGGTTCCTGGAGAGGG - Intergenic
1038224669 8:25644933-25644955 ATGATGGAGGGACCTGCAAAAGG + Intergenic
1039816745 8:41101033-41101055 AATTTGGAGGCTCTTGGAAAAGG - Intergenic
1041950487 8:63495559-63495581 ATTATGGAGGCTATTGCAAACGG - Intergenic
1043721308 8:83549013-83549035 AATGGGGAGGGTCCTGCAGATGG - Intergenic
1044957511 8:97496551-97496573 AGTTTGGAGGTTCCTCAAAAAGG + Intergenic
1049181027 8:141222286-141222308 ACCATGGAGGGTCCTGCAGAGGG + Intronic
1053084379 9:35205553-35205575 ACTAGGGAGGTTCCTCCAACTGG + Intronic
1055019363 9:71652707-71652729 AAGATGGAGGTCCCTGGAAGAGG + Intergenic
1056719735 9:89061391-89061413 AATATGGTGGTTTCAACAAAAGG - Intronic
1057330080 9:94106013-94106035 AATAAGGAGTTTTTTGCAAAGGG + Intronic
1203629832 Un_KI270750v1:62375-62397 AATATGAAAGTTACTGCTAAAGG + Intergenic
1186235194 X:7500330-7500352 ACTATGCATGTTGCTGCAAAGGG + Intergenic
1186874627 X:13804649-13804671 AATAAGGAAGTTCCTGGAGAAGG + Intronic
1186890022 X:13950794-13950816 AGTATGGTGGTTCCTCAAAAAGG - Intergenic
1189047445 X:37608497-37608519 AATGTGGAATTTCCTGCAGAAGG + Intronic
1191044012 X:56116475-56116497 AATTTGCAAGTTCCTGAAAAGGG + Intergenic
1191901766 X:66047921-66047943 AATAAGGAGGTTGTTCCAAATGG + Intergenic
1193040654 X:77000424-77000446 AAGATCCATGTTCCTGCAAAGGG - Intergenic
1194358877 X:92922342-92922364 CATATCGAGGTTCCAACAAAAGG - Intergenic
1195554484 X:106206264-106206286 AATATTGAGGATCCTGGAGAGGG + Exonic
1195730721 X:107964339-107964361 AATATGAAGTTACCTGAAAATGG - Intergenic
1198306981 X:135393221-135393243 GAAATTGAGGTTCCTGTAAAGGG - Intergenic
1199221240 X:145318170-145318192 ATTATAGAGGTTATTGCAAAGGG - Intergenic
1199849700 X:151716574-151716596 AATTTGGATTTTCCTCCAAATGG - Intronic
1200470378 Y:3579242-3579264 AATATGGAGGCCGCTGCAGACGG + Exonic
1200667093 Y:6038354-6038376 CATATCGAGGTTCCAACAAAAGG - Intergenic
1200841774 Y:7788998-7789020 AATATGGAGATTCATCAAAAAGG - Intergenic