ID: 1158072310

View in Genome Browser
Species Human (GRCh38)
Location 18:53487172-53487194
Sequence CAATACAAGGGGAAGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158072301_1158072310 1 Left 1158072301 18:53487148-53487170 CCTTTCCACAGCACACTCCACTG 0: 1
1: 0
2: 1
3: 41
4: 300
Right 1158072310 18:53487172-53487194 CAATACAAGGGGAAGTGGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 197
1158072302_1158072310 -4 Left 1158072302 18:53487153-53487175 CCACAGCACACTCCACTGACAAT 0: 1
1: 0
2: 1
3: 18
4: 218
Right 1158072310 18:53487172-53487194 CAATACAAGGGGAAGTGGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 197
1158072299_1158072310 10 Left 1158072299 18:53487139-53487161 CCCTAGGCACCTTTCCACAGCAC 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1158072310 18:53487172-53487194 CAATACAAGGGGAAGTGGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 197
1158072300_1158072310 9 Left 1158072300 18:53487140-53487162 CCTAGGCACCTTTCCACAGCACA 0: 1
1: 0
2: 2
3: 17
4: 216
Right 1158072310 18:53487172-53487194 CAATACAAGGGGAAGTGGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158072310 Original CRISPR CAATACAAGGGGAAGTGGTG GGG Intronic
900322986 1:2094181-2094203 CAAGACAGGTGGAAGTGGGGGGG - Intronic
901095523 1:6676195-6676217 TAACGCAAGGGGGAGTGGTGGGG + Intronic
902276907 1:15346425-15346447 TAATGCAACGGGGAGTGGTGAGG - Intronic
903431442 1:23304239-23304261 CAAGTGAAGGAGAAGTGGTGAGG - Intronic
903897390 1:26616996-26617018 CATGGCAAGGGGAGGTGGTGGGG - Intergenic
906515089 1:46434055-46434077 CAGTACTAGGGGAAGTGGGTAGG + Intergenic
907621674 1:55987588-55987610 CAAAACAAGGGTAAGGGGGGAGG + Intergenic
911512493 1:98824920-98824942 CATAAAAAGGGGAAGTGGTTTGG - Intergenic
912919940 1:113856275-113856297 TAAGACAATGGGAAGTGGTAGGG - Intronic
913495966 1:119428507-119428529 TGATAGAAGGGTAAGTGGTGTGG + Intergenic
915506096 1:156357322-156357344 CAGTATGAGGGGAAGGGGTGAGG + Intronic
917161564 1:172062516-172062538 AAATAGCAGGAGAAGTGGTGAGG - Intronic
918968955 1:191387930-191387952 AAGTACAAAGAGAAGTGGTGTGG + Intergenic
919652728 1:200166279-200166301 CAATACAATTGGAAGGGGTTGGG + Intronic
921106766 1:211988638-211988660 CAATAATAGGGGAAATGGTGGGG + Intronic
923504336 1:234592585-234592607 CATTACCACTGGAAGTGGTGGGG + Intergenic
924941769 1:248817087-248817109 CAATACAAGGTAGAGTTGTGAGG - Intronic
1068258287 10:54542923-54542945 AAATACAGGTGGATGTGGTGAGG + Intronic
1068870396 10:61937166-61937188 CAATGCAATAGGGAGTGGTGGGG + Intronic
1069574422 10:69516682-69516704 CAGTGCAAGGGCAAGTGCTGGGG - Intergenic
1073543102 10:104328230-104328252 TAGGACAACGGGAAGTGGTGAGG - Intronic
1074696241 10:116052212-116052234 GCAGACAAGGGGAGGTGGTGGGG - Intergenic
1074792834 10:116908933-116908955 CAATACAAGGGCAATTGTGGAGG + Intronic
1074890848 10:117735562-117735584 AAGTACAAGGGGAAGTGGTCAGG - Intergenic
1075143992 10:119867779-119867801 CAAGAACAGGGGAAGTGGTTGGG - Intronic
1075209789 10:120481265-120481287 GAATACAAAAGGATGTGGTGAGG + Intronic
1075977778 10:126711025-126711047 CAAGACAATTGGAAGTTGTGGGG + Intergenic
1076443459 10:130496056-130496078 GAATCCACGGGGAAATGGTGGGG - Intergenic
1079443335 11:20536753-20536775 CAAAACAAGAGAAAGGGGTGGGG + Intergenic
1079453104 11:20614455-20614477 CAGTACAAGGTGCAGTTGTGGGG + Intronic
1080527763 11:33144117-33144139 AAAAAAAAGGGGGAGTGGTGGGG - Intronic
1080850352 11:36063163-36063185 CAATACTGGGGGATGTAGTGGGG - Intronic
1085348021 11:75780650-75780672 CAAAGCAGGGGGCAGTGGTGGGG - Intronic
1088657473 11:112014356-112014378 GAATACATTGGGAAGTTGTGAGG - Intronic
1088897880 11:114091763-114091785 AAAAACAAGGGGAAGGGGAGTGG - Intronic
1090491059 11:127161342-127161364 CATTACAAGAGGCAATGGTGGGG + Intergenic
1093942299 12:25068126-25068148 AAATACAAGGTCAAGTGCTGTGG - Intronic
1095790892 12:46165806-46165828 CAAAATAAGGGGTACTGGTGGGG + Intergenic
1101742686 12:107513304-107513326 CAATTCAAGGTGAGGGGGTGGGG - Intronic
1101792216 12:107937983-107938005 CAATGCAAGGGAAAGGTGTGAGG + Intergenic
1102570949 12:113826681-113826703 AAATACTAGGGGTTGTGGTGAGG + Intronic
1102827216 12:115958932-115958954 CAAAAAAAGGGGAAATGGGGAGG - Exonic
1102986934 12:117285811-117285833 CAAGACAAAAGGGAGTGGTGAGG + Intronic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1104148969 12:126063583-126063605 TAATACAATAGGGAGTGGTGGGG + Intergenic
1104239472 12:126973918-126973940 CTATGCAAGCGGAAGTTGTGTGG - Intergenic
1104480271 12:129101427-129101449 CAAGACAAGAGGGAATGGTGGGG - Intronic
1104871772 12:132004094-132004116 CACTAAAAGGGGAAATGATGAGG + Intronic
1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG + Intergenic
1108192331 13:47954962-47954984 CAATAGAAAGGTAAGGGGTGGGG - Intronic
1109693401 13:65923123-65923145 AAATACCAGGCGCAGTGGTGTGG + Intergenic
1114389570 14:22292401-22292423 CAATAATAGGGGAAATGGGGAGG + Intergenic
1114550186 14:23528294-23528316 CAATCCAAGGGAAAGTGGGGAGG - Intronic
1118319484 14:64744654-64744676 CAAGAAAAAGGGAGGTGGTGAGG + Exonic
1124988816 15:34650328-34650350 CAACACATGGGGAGGTGGTGTGG + Intergenic
1127330222 15:57931768-57931790 CAACATGAGGGGAAGTGGAGGGG - Intergenic
1127893364 15:63274394-63274416 CAATGCAAGAGGAAGTGGCTGGG - Intergenic
1133264385 16:4574773-4574795 CACTGCAGCGGGAAGTGGTGAGG + Exonic
1134584603 16:15398936-15398958 CAATGAAAGGGGAAGTGGAAGGG + Intronic
1134644794 16:15857439-15857461 CAATAAAATGGGAAGTGGGGTGG - Intergenic
1138247234 16:55477029-55477051 CAATACAATAGAGAGTGGTGAGG + Intronic
1138449318 16:57083955-57083977 CAAGACAATGGGGAGTGGTGGGG - Intergenic
1138857367 16:60710595-60710617 CAATTAAAGGGGAAGTTGTCAGG + Intergenic
1140178637 16:72691173-72691195 TAATATTAGGGGAAGTTGTGGGG + Intergenic
1140419738 16:74808412-74808434 CAATAAAAGGTGGTGTGGTGGGG + Intergenic
1140427275 16:74871309-74871331 CAATACAAGGCCAAGTGGGGTGG - Intergenic
1140437375 16:74958702-74958724 CAAGACAAGGGCAAGGGGTAGGG + Intronic
1140743830 16:77964034-77964056 AAATACAAGGGCAGGTGGAGGGG - Intronic
1143124923 17:4635924-4635946 CAAGAAAAGGGGAGGTGGTGGGG + Exonic
1143403589 17:6661226-6661248 CAGGAAAAGGGGAGGTGGTGGGG - Intergenic
1143594296 17:7905190-7905212 AAATAAAACGGGAAGAGGTGAGG - Intronic
1144016750 17:11203506-11203528 TAAAACAAGGTGATGTGGTGGGG + Intergenic
1146586956 17:34090823-34090845 GAATAAAAGCGGAAGAGGTGGGG - Intronic
1148207719 17:45790024-45790046 CATCAAAAGGAGAAGTGGTGAGG + Intronic
1148486014 17:47991424-47991446 CAATAAAAGGGGAGGTGGGGTGG + Intergenic
1148587679 17:48792347-48792369 AAATCCAAGAGGCAGTGGTGGGG + Intronic
1149481286 17:57005420-57005442 CAATGAAAGGGGAAGTGGTTTGG - Intronic
1150984126 17:70176089-70176111 CACTACAAAGGGGAGTGTTGGGG - Exonic
1151443136 17:74146564-74146586 AAATAGCAGGGGAAATGGTGGGG - Intergenic
1152325122 17:79631585-79631607 CAATACCATGAGAAATGGTGGGG - Intergenic
1152556660 17:81056500-81056522 CCGCACACGGGGAAGTGGTGTGG + Intronic
1156568562 18:38224427-38224449 AAATAAAAGTGGAATTGGTGTGG - Intergenic
1157543208 18:48527080-48527102 CAATACTAGGGGAAACGGTGGGG - Intergenic
1157864456 18:51168685-51168707 CCATACAAGGGGAGGTGGGTAGG + Intergenic
1158072310 18:53487172-53487194 CAATACAAGGGGAAGTGGTGGGG + Intronic
1158123032 18:54071066-54071088 CAAAACAAGGTCATGTGGTGAGG - Intergenic
1158496415 18:57959168-57959190 GAATACAAGGGGAAGGTTTGTGG - Intergenic
1158670033 18:59466316-59466338 CAATACAAGGGGCAGTTCTCCGG + Intronic
1158879576 18:61764315-61764337 GAATACAATGGAAAGTGGAGGGG - Intergenic
1160111355 18:76034673-76034695 GAAAACAAGGGGAGGGGGTGAGG - Intergenic
1164658326 19:29940808-29940830 CTAAACGAGGGGAAGTGGGGTGG + Intronic
925140616 2:1547447-1547469 CATTCCAAAGGGAAGTGGAGGGG - Intergenic
925808182 2:7673071-7673093 CTATTAATGGGGAAGTGGTGTGG + Intergenic
926765878 2:16322406-16322428 GAATGCTAAGGGAAGTGGTGAGG - Intergenic
927245276 2:20952431-20952453 CATTTCAAGGGGAAATGGAGGGG + Intergenic
927860231 2:26556142-26556164 CAATGCCGGGGGAGGTGGTGAGG - Intronic
928055508 2:28050021-28050043 CAATACAATAGGAAATGGTAGGG + Intronic
928192330 2:29183778-29183800 CAATAAAAAGGGAAGCTGTGTGG + Exonic
928429296 2:31204694-31204716 CAAGGCATGGGGAAGGGGTGTGG - Intronic
932842740 2:75099002-75099024 GGACACAAGGGGAAGTGGTCTGG - Intronic
933894369 2:86797257-86797279 CATTGCAAAGGGAGGTGGTGTGG + Intronic
936279038 2:111122221-111122243 CAAAACAAGGACAAGTGGCGAGG + Intronic
940265898 2:151837337-151837359 AAATGCAGGGGGATGTGGTGAGG + Exonic
940474060 2:154137972-154137994 TAATACAGTGGGAAGGGGTGGGG - Intronic
940759159 2:157718756-157718778 TAAGACAAGAGGGAGTGGTGGGG - Intergenic
941328962 2:164153230-164153252 CAATACAAAGTCAAGTGGTTAGG - Intergenic
943361911 2:186929752-186929774 CAAGAGAAGGGAAAGTGATGTGG + Intergenic
944962461 2:204890573-204890595 GACTATAAGGGGATGTGGTGGGG - Intronic
945691932 2:213047166-213047188 GAATACAAGGGTAATTGGTAAGG - Intronic
946593884 2:221284239-221284261 GAATAAAATGGGAAGTAGTGAGG + Intergenic
1169645477 20:7804626-7804648 AAATATAAGTGGAAGTGTTGGGG + Intergenic
1170207141 20:13810748-13810770 CAATACAAAGGCCAGTGGAGGGG + Intronic
1171306411 20:24110518-24110540 CAATACAAGGAGAGCTGGTCTGG - Intergenic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1175492197 20:59386800-59386822 CCATACAGGTGGCAGTGGTGGGG + Intergenic
1177073773 21:16545963-16545985 TAAGACAAGGGGAAGTAATGGGG + Intergenic
1178013046 21:28308646-28308668 GAGTACAAGGGGAAGTGGAATGG - Intergenic
1179303021 21:40129434-40129456 TAACACAAGTGGAAGTGGGGTGG + Intronic
1179803812 21:43824920-43824942 CAATGCAAGGGGCAATGATGTGG - Intergenic
1180604459 22:17046431-17046453 CGATTCAAGGGGAAGTGAGGAGG + Intergenic
1183052134 22:35271641-35271663 CAATACATGCGGAAGTGTTCAGG + Intronic
1183602394 22:38847511-38847533 CAAAACAAGAGGAAGTAGGGGGG + Intergenic
1184726521 22:46350545-46350567 CTGGAGAAGGGGAAGTGGTGCGG - Intronic
950905210 3:16531398-16531420 CAAGACAAGGGGACATAGTGGGG - Intergenic
953450562 3:43001842-43001864 CAGGAGAAGGGGAAGGGGTGAGG - Intronic
953770343 3:45774812-45774834 CAAGACAATGGGAAGTCTTGGGG + Intronic
955888567 3:63626304-63626326 AAATACAATGGGATGTGGTGGGG - Intergenic
957622689 3:82614942-82614964 CCATACAAGGGGAAATTGAGAGG - Intergenic
958103068 3:89037897-89037919 CAATAAGATGGGAAGTGGAGAGG + Intergenic
958505661 3:94973901-94973923 CTGTTCAAGTGGAAGTGGTGGGG - Intergenic
962203055 3:133415772-133415794 CAGTAGAAGGGTAAGTGGAGGGG - Intronic
962310171 3:134320653-134320675 CCATAGCAGGAGAAGTGGTGGGG - Intergenic
964025982 3:152074845-152074867 CAATTCAAGGTGAATTTGTGTGG + Intergenic
966573185 3:181470297-181470319 CAAAACATGGGATAGTGGTGTGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968447822 4:661270-661292 CAATAACAGGGGATTTGGTGTGG + Intronic
972006591 4:34116748-34116770 TATTAGAAGGGAAAGTGGTGTGG + Intergenic
973786467 4:54337208-54337230 CAATTAAAAGGGAAGAGGTGGGG + Intergenic
973865383 4:55107770-55107792 CAATACCAGTGGATGTGATGCGG + Exonic
975406738 4:73998814-73998836 CCAGACAATGGGAACTGGTGGGG + Intergenic
975797610 4:78025580-78025602 CAAGACAACTGGAAGTGGGGAGG + Intergenic
981512612 4:145574214-145574236 CAAAATAAGTGGAAGTGGTAGGG + Intergenic
981557075 4:146007219-146007241 CAATAAAAGAGGAAGAGGTTGGG - Intergenic
984099200 4:175465929-175465951 CGAGACAGGGAGAAGTGGTGGGG + Intergenic
986116728 5:4782511-4782533 CAGGAGAGGGGGAAGTGGTGAGG + Intergenic
986525839 5:8674057-8674079 CAATTCAAGGGGAATTTGGGTGG - Intergenic
986861369 5:11930094-11930116 CAATATAAGTGTATGTGGTGAGG + Intergenic
988771213 5:34435044-34435066 CAGGACAACTGGAAGTGGTGGGG - Intergenic
990632549 5:57686450-57686472 CTACAGAAGGGTAAGTGGTGTGG - Intergenic
990803308 5:59630285-59630307 AAATACAAGGGAAGGTAGTGGGG - Intronic
991249298 5:64542277-64542299 CAGGACAAGGGGAAGTTCTGGGG - Intronic
991291920 5:65041732-65041754 TCACATAAGGGGAAGTGGTGAGG - Intergenic
992101881 5:73415962-73415984 CTAAGCAATGGGAAGTGGTGAGG - Intergenic
992199813 5:74371968-74371990 AAATACAATGGGAAGTCATGTGG + Intergenic
993014935 5:82524682-82524704 CAATGAAAGTGGAAGTGCTGAGG + Intergenic
996339222 5:122417729-122417751 GAATAAAAGGGGAGGTGGGGAGG - Intronic
996996690 5:129705229-129705251 CAATAAAAGGGGAAGGAGAGAGG - Intronic
998355337 5:141530630-141530652 GAACAAATGGGGAAGTGGTGGGG - Intronic
999268196 5:150280643-150280665 GACTGCAAGGGGTAGTGGTGAGG - Intronic
999982266 5:156968923-156968945 AAATACAATGGGGAGTGGCGGGG + Intergenic
1000259871 5:159577343-159577365 CAATACGAAGGGAAGTAGAGGGG + Intergenic
1002572761 5:180153116-180153138 CAATTAAAGGGGAGGTAGTGGGG + Intronic
1003674348 6:8189181-8189203 CAATACATGGGAATTTGGTGGGG + Intergenic
1005276965 6:24229896-24229918 CTCTCAAAGGGGAAGTGGTGGGG - Intronic
1006077118 6:31540830-31540852 CAGTACCAGGGAAAGTGGTTAGG + Intronic
1007232000 6:40354775-40354797 CAACAACATGGGAAGTGGTGAGG - Intergenic
1010487092 6:76427792-76427814 CAACACAAGGAGAAGAGGTTGGG + Intergenic
1012143956 6:95658046-95658068 CAAGACAAAGGGAAATGATGTGG + Intergenic
1012978345 6:105803890-105803912 CAATACAAGCTGAGGTGGTGGGG - Intergenic
1013367316 6:109446036-109446058 GAATACAGAGGGAAGTTGTGGGG - Intronic
1015593239 6:134842577-134842599 CAATACACAGAGAAGTGGAGAGG - Intergenic
1016071910 6:139748918-139748940 GAATAAATGGGGAAGAGGTGAGG + Intergenic
1016798856 6:148147531-148147553 CAATACAAGGAGAAGGGGAAGGG + Intergenic
1018764613 6:166923705-166923727 CCATAGAAGGGGCAGTAGTGAGG - Intronic
1022228542 7:28389811-28389833 TAATACAAGGGGGAGGGGAGGGG - Intronic
1023297926 7:38735890-38735912 CAATCCAAGGGGCAGTTGGGAGG + Intronic
1024698967 7:51886144-51886166 ATATACAAGGGGCAGTGGGGAGG + Intergenic
1026482618 7:70791102-70791124 TTTTACAAGGGGAAGGGGTGGGG - Exonic
1026988089 7:74567502-74567524 CAATTTTGGGGGAAGTGGTGGGG + Intronic
1029423663 7:100484107-100484129 CAGGACAAGGGGAAGGGGAGGGG + Intronic
1032684051 7:134212749-134212771 CTAGATAAGGGGAAGTGATGAGG + Intronic
1032760652 7:134938373-134938395 TAATACATGGGGATGAGGTGGGG - Intronic
1033437114 7:141343202-141343224 CAATGCAAGGGCGAGTGGTACGG - Intronic
1034189998 7:149206630-149206652 CAGGAGAAGGGGAGGTGGTGGGG + Intronic
1035161494 7:156953527-156953549 CAATACAAGGGGGAAGGGGGTGG - Intronic
1035854897 8:2964301-2964323 CAGTAGAAGGTGGAGTGGTGAGG - Intronic
1040440127 8:47432803-47432825 CCATACAATGGGAAGTAGTTTGG + Intronic
1042370395 8:67984902-67984924 CAAGGAAAGGGGAGGTGGTGAGG - Intronic
1045457508 8:102396025-102396047 AAATAAAGGGGGAAGGGGTGGGG + Intronic
1047045331 8:121046820-121046842 CACTTCAAGGGGAGGTGGTCAGG - Intergenic
1048197333 8:132342661-132342683 CAAGACAATAGGAAGTAGTGAGG - Intronic
1048240842 8:132740376-132740398 CAAGAAAAGGGGAAGTGATGGGG - Intronic
1048833033 8:138495182-138495204 CAATCCAATGGGATGTGGAGAGG - Intronic
1050110449 9:2209909-2209931 CAATCCAAGGGGAACTAGAGTGG - Intergenic
1052068230 9:24049248-24049270 TAATACAAGGGGCTGTGGAGTGG + Intergenic
1052827638 9:33188462-33188484 GGATACAAGGAGAAGTGATGTGG - Intergenic
1053316274 9:37054461-37054483 CAATACAGGAGAAAGTGGAGAGG - Intergenic
1053549903 9:39066698-39066720 CAATGCAAGGGGAAGGGCAGTGG - Intergenic
1053814015 9:41886791-41886813 CAATGCAAGGGGAAGGGCAGTGG - Intergenic
1054616581 9:67300649-67300671 CAATGCAAGGGGAAGGGCAGTGG + Intergenic
1054875704 9:70094258-70094280 CAATACATGGAGAAATGGTGAGG - Intronic
1057164879 9:92917580-92917602 CAAGAAAAGGGGAAGTGGCTGGG - Intergenic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060864926 9:126988126-126988148 AAATACAAGGACCAGTGGTGAGG + Intronic
1061777267 9:132973681-132973703 CCAGACAAGGGGAACAGGTGAGG + Intronic
1186441872 X:9593724-9593746 AAATAAATGGGGAAGTGGGGCGG - Intronic
1192980818 X:76339028-76339050 CCAAACAAGGGGAAGGGGAGAGG + Intergenic
1193568738 X:83114337-83114359 CAATACTGGGATAAGTGGTGTGG + Intergenic
1195778721 X:108437808-108437830 CATTAGAAAGGGGAGTGGTGTGG + Intronic
1195848426 X:109254798-109254820 CACTACGTAGGGAAGTGGTGGGG - Intergenic
1196023276 X:111012574-111012596 CAATAAAAGGGGAATTGGAAAGG + Intronic
1197861382 X:130974511-130974533 CAACTCATGGTGAAGTGGTGGGG + Intergenic
1199536010 X:148903993-148904015 CAATACAGGTGGAAATTGTGAGG - Intronic
1200861672 Y:7998816-7998838 AATTACAAGGGGCAGTGTTGTGG - Intergenic