ID: 1158073308

View in Genome Browser
Species Human (GRCh38)
Location 18:53499015-53499037
Sequence CTATATTGCTTGAACTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158073308 Original CRISPR CTATATTGCTTGAACTGTCT GGG (reversed) Intronic
901885305 1:12218524-12218546 CTAGATTGCTTGAGCTGTGATGG + Intergenic
904605167 1:31694226-31694248 CTAAATTGCTTGACTTCTCTGGG - Intronic
904951898 1:34249255-34249277 CTAAATTCCTTCAATTGTCTGGG - Intergenic
908309582 1:62865570-62865592 CTATATTGCTTTGACATTCTAGG - Intergenic
908317741 1:62949967-62949989 CTTTGTTGCTTCACCTGTCTTGG - Intergenic
909282629 1:73774629-73774651 CTAAATTGCTAGAGCTGCCTTGG + Intergenic
911111714 1:94195311-94195333 GAATATTGCTTGCAATGTCTTGG - Intronic
915866676 1:159507982-159508004 CTTTATTTCTTGATCTGTCTAGG - Intergenic
916520061 1:165555619-165555641 CTCTTTTGCCTGAACTGTGTTGG - Intronic
922080259 1:222288682-222288704 CTATATTAGTTGAAATGTATGGG + Intergenic
1064909931 10:20389529-20389551 ACATATAGCTTGTACTGTCTGGG - Intergenic
1068546283 10:58349346-58349368 ATTTATTGCTTGATCTGTTTAGG + Intronic
1068833467 10:61524819-61524841 CTTTATTCATTGAAATGTCTGGG + Intergenic
1068997815 10:63227311-63227333 ATATATTTCTTGAACTGGCAAGG - Intronic
1069454387 10:68542195-68542217 GTATTATGCTAGAACTGTCTGGG - Intergenic
1071375693 10:85000406-85000428 CTATAATGCATGAACTGACAGGG + Intergenic
1071665538 10:87552839-87552861 TTAACTTGATTGAACTGTCTAGG + Exonic
1072194885 10:93109002-93109024 CTATATTCCTCTTACTGTCTGGG + Intergenic
1075350040 10:121715861-121715883 TTGTATTGCTTGACCTGCCTGGG + Intergenic
1079053127 11:17180836-17180858 CTATATTACTTGTACTGTTTTGG + Intronic
1079877837 11:25882428-25882450 CTATATTTCTAGAAATATCTAGG + Intergenic
1082902026 11:58265588-58265610 CTATATTGGTTTCACTGTCAGGG + Intergenic
1087878263 11:103384663-103384685 CTAAGCTTCTTGAACTGTCTGGG - Intronic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1098732186 12:74050790-74050812 CTACATTACTTGAAATGTTTTGG - Intergenic
1103245903 12:119456935-119456957 TTAGAATGCTTTAACTGTCTGGG + Intronic
1105390598 13:19973914-19973936 CCATATTGAAAGAACTGTCTTGG - Intronic
1107601271 13:42015234-42015256 CAATATTGAATGAACTCTCTGGG + Intergenic
1110174770 13:72542749-72542771 CTGAATTGCTTGCTCTGTCTGGG - Intergenic
1110564382 13:76943426-76943448 CTATATTGCTTTTAAAGTCTGGG + Intergenic
1110963651 13:81662568-81662590 GTATATTGCTGTTACTGTCTGGG - Intergenic
1112192651 13:97192950-97192972 CTCTCTTGATTGAATTGTCTTGG - Intergenic
1113033291 13:106018003-106018025 CAATATTGGTTGAACTGAATTGG + Intergenic
1115002393 14:28438948-28438970 CTTTAATGCTTGACCTGTGTTGG + Intergenic
1117425638 14:55592922-55592944 CTCTTTTGCTAGACCTGTCTTGG + Intronic
1118366890 14:65103346-65103368 GGATATTGCCTAAACTGTCTGGG - Intergenic
1120760510 14:88280641-88280663 CTATTTGGCTTGAACGGTTTGGG - Intronic
1126087126 15:45021280-45021302 CTAGATCTCTTGAACTTTCTAGG + Intergenic
1133586952 16:7204905-7204927 CTATGTCTCTTGCACTGTCTGGG + Intronic
1135593377 16:23721604-23721626 CAATATTACATGAACTATCTAGG + Intergenic
1136041089 16:27579486-27579508 TTATATTACTTGAAGTGTCTAGG + Intronic
1144706431 17:17371377-17371399 TTAGAATGCCTGAACTGTCTGGG - Intergenic
1154071405 18:11155507-11155529 ATAAATTGCTTGACCTTTCTGGG + Intergenic
1154935544 18:21052454-21052476 CTATATAGCCTGAACTTTGTAGG + Intronic
1155452082 18:25974035-25974057 TTAGAATGCTTTAACTGTCTGGG + Intergenic
1157894284 18:51449171-51449193 CTGAATTGCCTGAATTGTCTGGG - Intergenic
1158073308 18:53499015-53499037 CTATATTGCTTGAACTGTCTGGG - Intronic
1158367632 18:56756611-56756633 CTTTATTGCTTGAACCATCAGGG - Exonic
1159644141 18:70897652-70897674 CTATATTTTTTCAATTGTCTTGG + Intergenic
926465448 2:13181197-13181219 CTGTAATTCCTGAACTGTCTCGG - Intergenic
926997350 2:18750790-18750812 CTAAGTTGCTTCAATTGTCTGGG + Intergenic
927326229 2:21808630-21808652 CTTTATTGATTGCACTGGCTAGG - Intergenic
928237236 2:29554740-29554762 ATAGAATGCCTGAACTGTCTGGG - Intronic
928700542 2:33894690-33894712 TTAGAATGCTTTAACTGTCTGGG - Intergenic
930190850 2:48457810-48457832 TTATATTGCTGGAGCTTTCTAGG + Intronic
933620099 2:84528792-84528814 CCATATTGCATGAGATGTCTAGG - Intronic
935271696 2:101440357-101440379 CCATATTGTTTGTACAGTCTAGG - Intronic
939823867 2:146990401-146990423 CAATTTTGCTGGAACTGTCCTGG + Intergenic
940486756 2:154305737-154305759 CTATCTGTCTTGAACTGTCTGGG + Intronic
1169646892 20:7821193-7821215 CTAGATTCACTGAACTGTCTTGG - Intergenic
1173768703 20:45638732-45638754 CCAAATTGCTAGAACTATCTTGG - Intergenic
1175832779 20:61976265-61976287 CTTTGTCGCGTGAACTGTCTGGG + Exonic
950206311 3:11083928-11083950 ACATGTTGCATGAACTGTCTGGG + Intergenic
952379460 3:32793272-32793294 CTATTTTTCTTGAACCATCTGGG - Intergenic
958980806 3:100717365-100717387 CAGTATTGCTTTGACTGTCTGGG + Intronic
964790038 3:160445476-160445498 TTAAATTGCTAGAACTGGCTGGG + Intronic
964978167 3:162644713-162644735 CTATATTGTTAGAACATTCTTGG + Intergenic
967514904 3:190356171-190356193 ATATATTACTTAAACTTTCTTGG - Intronic
967594320 3:191312436-191312458 CTAAATTCCTTGAGCTGTCACGG - Intronic
967648319 3:191953595-191953617 CTCTATTATCTGAACTGTCTCGG - Intergenic
969295409 4:6267785-6267807 CTACTGTGATTGAACTGTCTCGG + Intergenic
972465435 4:39351595-39351617 CTATATTCGTGGAACTATCTTGG - Intronic
973952730 4:56034094-56034116 ATATATGGCTTCAAATGTCTAGG - Intergenic
975958676 4:79874243-79874265 CCACCTTGTTTGAACTGTCTAGG + Intergenic
977804017 4:101274879-101274901 TTTTATTGCTTAAAGTGTCTTGG - Intronic
978076426 4:104536383-104536405 CAAGATTGCTTTGACTGTCTGGG + Intergenic
978369439 4:108015736-108015758 CTATGTTTCTTGAAGTGTGTAGG + Intronic
980305998 4:131062084-131062106 TTGTATTGCTTGATATGTCTAGG + Intergenic
980647904 4:135668108-135668130 CAATTTAGCTTTAACTGTCTTGG - Intergenic
982184021 4:152778648-152778670 CAATATTGATTGAGCTCTCTAGG - Intronic
984728323 4:183041808-183041830 ATATATTGCTAGAACTATGTTGG + Intergenic
988383590 5:30532122-30532144 ATAATTTGATTGAACTGTCTTGG + Intergenic
992416202 5:76554090-76554112 CTACCTTTGTTGAACTGTCTTGG - Intronic
993072142 5:83178530-83178552 TTATTTTGCTTGCACTGGCTTGG - Intronic
994918831 5:106015513-106015535 TAATATTGCTTAAACTTTCTTGG - Intergenic
994959938 5:106586808-106586830 TTAGAATGCTCGAACTGTCTGGG - Intergenic
995216002 5:109594990-109595012 CTTTCTTGCTTCAACTGCCTTGG + Intergenic
1005146588 6:22698193-22698215 CTATGTTTCTTGTACTATCTAGG - Intergenic
1007821816 6:44565958-44565980 CTCTGTTGCCTCAACTGTCTAGG + Intergenic
1008158435 6:48046994-48047016 GAATATTGCTTGCAATGTCTTGG + Intronic
1010641922 6:78339749-78339771 CTATAGTCTTTGAAATGTCTAGG - Intergenic
1011890195 6:92149509-92149531 CTCTATTTAATGAACTGTCTGGG - Intergenic
1017144616 6:151223140-151223162 CTTTCTTCCTTGAACGGTCTTGG + Intergenic
1017661126 6:156674656-156674678 CTAGATTGCTTTAACTATTTGGG - Intergenic
1026126545 7:67584586-67584608 TTAGAATGCTTTAACTGTCTGGG - Intergenic
1026161548 7:67873768-67873790 CAATATGGCTTGAACTGTGTGGG - Intergenic
1026224319 7:68427284-68427306 CTATATGCCTAGCACTGTCTTGG + Intergenic
1027394758 7:77742860-77742882 CTATATTGTTTGCACAGTTTTGG + Intronic
1028878338 7:95849679-95849701 CAATGTTGCTTTAACTGTTTGGG + Intronic
1029884469 7:103852555-103852577 CTATATTGCTAAAACTTTTTAGG + Intronic
1030484028 7:110143078-110143100 TTATCTTGCTTGAATTCTCTAGG - Intergenic
1031643931 7:124200484-124200506 CTACATTTCTTGATCTGTTTTGG + Intergenic
1037580134 8:20240237-20240259 ATAAATTGCTTAAACTCTCTGGG - Intergenic
1044787602 8:95811066-95811088 TTCTTTTGCTAGAACTGTCTGGG + Intergenic
1044894423 8:96875555-96875577 CTATTCTTGTTGAACTGTCTGGG + Intronic
1048059710 8:130905782-130905804 CACTATAGCTTCAACTGTCTGGG - Intronic
1050040659 9:1489718-1489740 CTATATTCTTTGAAATGTCAAGG + Intergenic
1051661346 9:19429871-19429893 CTATATTGCTGTAACTATCAAGG + Intronic
1051867198 9:21695986-21696008 TCATCTTGCTTGAACTGTATCGG - Intergenic
1052266283 9:26577400-26577422 CTAATTTACTTGAGCTGTCTGGG + Intergenic
1052507045 9:29369253-29369275 ATATAGTGCTTGAACTTTTTAGG + Intergenic
1055671926 9:78616243-78616265 CAATATTGCATGAGCTTTCTTGG - Intergenic
1057091604 9:92263068-92263090 CTATTTTTATTGAACTGTTTGGG - Intronic
1060019346 9:120115847-120115869 CTGTAGTGCCTGAACTGTCCGGG - Intergenic
1189079535 X:37956005-37956027 CTCTACTGGTTGAACTGTGTGGG + Intronic
1190685850 X:52872458-52872480 ACATATTGCTTGAACAGTTTCGG - Intergenic
1190999074 X:55640368-55640390 CTTTATAGTTTGAACTGTTTTGG + Intergenic
1194997854 X:100611261-100611283 TTAGAATGCTTTAACTGTCTGGG + Intergenic
1199788733 X:151129941-151129963 TTATATTCTTTGAACTATCTGGG + Intergenic
1199789411 X:151137994-151138016 TTAAATTCCTTGAACTATCTGGG + Intergenic
1199813857 X:151379163-151379185 CTATCTTGCTTACCCTGTCTTGG + Intergenic
1199877652 X:151947361-151947383 CAATAGTTCTTGAAATGTCTGGG + Intergenic