ID: 1158073644

View in Genome Browser
Species Human (GRCh38)
Location 18:53503139-53503161
Sequence CAGCAGTTTTACATGGGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158073640_1158073644 5 Left 1158073640 18:53503111-53503133 CCCAATAAGGCACACAGAGCTAT 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1158073644 18:53503139-53503161 CAGCAGTTTTACATGGGTCTAGG 0: 1
1: 0
2: 1
3: 8
4: 187
1158073637_1158073644 18 Left 1158073637 18:53503098-53503120 CCTTAGTTTGCCTCCCAATAAGG 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1158073644 18:53503139-53503161 CAGCAGTTTTACATGGGTCTAGG 0: 1
1: 0
2: 1
3: 8
4: 187
1158073641_1158073644 4 Left 1158073641 18:53503112-53503134 CCAATAAGGCACACAGAGCTATG 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1158073644 18:53503139-53503161 CAGCAGTTTTACATGGGTCTAGG 0: 1
1: 0
2: 1
3: 8
4: 187
1158073639_1158073644 8 Left 1158073639 18:53503108-53503130 CCTCCCAATAAGGCACACAGAGC 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1158073644 18:53503139-53503161 CAGCAGTTTTACATGGGTCTAGG 0: 1
1: 0
2: 1
3: 8
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158073644 Original CRISPR CAGCAGTTTTACATGGGTCT AGG Intronic
903568452 1:24286331-24286353 CAGGAGTTTGAGATGGGTCTGGG - Intergenic
905301751 1:36990422-36990444 CAGCAATGTTCCCTGGGTCTGGG + Intronic
905547215 1:38809476-38809498 CAGGAGTTTGAGATGGGCCTAGG - Intergenic
908098729 1:60768381-60768403 CAGGAATTATACAGGGGTCTTGG + Intergenic
908471460 1:64447841-64447863 CAGCAATTTTACAGAGGTTTGGG - Intergenic
908890757 1:68844770-68844792 CAGGAGTTTGACATGAGCCTGGG + Intergenic
912885679 1:113470991-113471013 AAGCTTTTTTACATTGGTCTGGG - Intronic
915259069 1:154662834-154662856 GAGCAGTTGTACATGGCTTTAGG + Intergenic
916462383 1:165039963-165039985 CAGTAGTTTGCCTTGGGTCTCGG + Intergenic
916843700 1:168626777-168626799 CAGAAGTTTGAAATGGGGCTCGG + Intergenic
918425090 1:184401107-184401129 CAGCTCTTTTTCATGTGTCTAGG + Intronic
919881844 1:201906188-201906210 CAGCATTTTTACCTTGGCCTAGG + Intronic
920124632 1:203683882-203683904 CAGGAGTTTGAGATGAGTCTAGG - Intronic
921397104 1:214679966-214679988 CACCAGGTGTACATTGGTCTTGG - Intergenic
922922505 1:229318417-229318439 CAGCAGTTTATGATGTGTCTGGG + Intergenic
923367850 1:233280622-233280644 TACCATTTTTACATGGCTCTAGG - Intronic
924260717 1:242227923-242227945 TAGCAATTTTACATGGGAATGGG - Intronic
1067236377 10:44454063-44454085 CAGCAGTCTGACATTGATCTGGG - Intergenic
1069205967 10:65686064-65686086 CAGGAGATTTACTTGAGTCTGGG - Intergenic
1070116618 10:73534945-73534967 GAGGAATTTTACATGTGTCTGGG - Intronic
1070210440 10:74313647-74313669 AAGCAGTTTTACAAGGGATTAGG - Intronic
1070219372 10:74424118-74424140 CAGTAGTATTACTTGGGGCTGGG + Intronic
1070293747 10:75141132-75141154 CAGGAGTTCGAGATGGGTCTGGG + Intronic
1070869436 10:79737353-79737375 CAGAAGTTATTCATGGGACTGGG - Intergenic
1071636354 10:87259559-87259581 CAGAAGTTATTCATGGGACTGGG - Intergenic
1071658887 10:87478392-87478414 CAGAAGTTATTCATGGGACTGGG + Intergenic
1072158309 10:92743765-92743787 CTGAAGTTTGCCATGGGTCTTGG - Intergenic
1072839047 10:98750218-98750240 CATCAGTCTCACATGAGTCTTGG - Intronic
1072941515 10:99768356-99768378 CAGCAGTTTGAGATGAGCCTGGG + Intergenic
1078456661 11:11481102-11481124 CAGGAGGTTTCTATGGGTCTGGG + Intronic
1078603156 11:12751100-12751122 CAGCAGTTTGAAATGAGCCTGGG + Intronic
1081261783 11:40970703-40970725 CAGCAGTTTAACAAGGCTCTAGG - Intronic
1084703189 11:70800905-70800927 CTGCTGTTTTATATGGGCCTGGG + Intronic
1091193121 11:133710793-133710815 AAGCAGTTTTGGATGGATCTTGG - Intergenic
1092063668 12:5571599-5571621 AAGCAGTTTTAACTGGCTCTAGG + Intronic
1092753239 12:11738513-11738535 CAGGAGTTTGAGATGAGTCTGGG - Intronic
1094289067 12:28825838-28825860 CAACAGCTTCACATGGCTCTTGG - Intergenic
1095158684 12:38889852-38889874 CAGAAGTTTTACTGGGGTATTGG + Intronic
1095266586 12:40166279-40166301 CAGTAGTTTGAGATGAGTCTGGG - Intergenic
1096703529 12:53403561-53403583 CAGGAGTTTGAGATCGGTCTGGG - Intronic
1097131982 12:56818381-56818403 CATCAGATTTCCTTGGGTCTAGG - Intergenic
1099091428 12:78314854-78314876 CAGCAGTATTGCATGGTTCTTGG - Intergenic
1100705788 12:97198783-97198805 CAGCAGGTTTAACTGGTTCTTGG - Intergenic
1100977482 12:100137525-100137547 CAGCAGTTTGAGATCAGTCTGGG - Intronic
1101655691 12:106718108-106718130 CAGAACTTGGACATGGGTCTGGG - Intronic
1104965585 12:132507550-132507572 CAGCAGGTTTACAGGGGGCCTGG + Intronic
1107022577 13:35766520-35766542 TATGAGTTTGACATGGGTCTTGG - Intergenic
1108676378 13:52740335-52740357 CACCAGTTTTTCTAGGGTCTGGG + Intergenic
1109153546 13:58874685-58874707 CAGCAGTTTCACATGACTTTAGG - Intergenic
1109913821 13:68953506-68953528 CAGTAGTTTAAAATGAGTCTTGG + Intergenic
1110455861 13:75689753-75689775 CAGCGGTTTGCCATGGCTCTCGG + Intronic
1113477474 13:110594810-110594832 GAGCAGTTAAACATGGGGCTGGG - Intergenic
1114709956 14:24768119-24768141 CAGCAGTTCTACATTTGTCTAGG - Intergenic
1121497720 14:94407652-94407674 CAGTAGTTTTACATGAGTCTTGG + Intergenic
1123999751 15:25745511-25745533 CAGCAGTTTGAGATGAGCCTGGG + Intronic
1125143731 15:36440903-36440925 CAGCTATTTTACATGGCTGTGGG + Intergenic
1125225791 15:37394676-37394698 CTCCAGTTTTACATGGCTATGGG + Intergenic
1125905841 15:43391650-43391672 CAGAAGTTTCACTTGAGTCTAGG - Intronic
1126175373 15:45730753-45730775 CAGCAGTTTGACAGAGGGCTAGG + Intergenic
1130975192 15:88768545-88768567 CAGACATTTTACATGGGTCGGGG - Intergenic
1131762420 15:95638721-95638743 ATGCTGTTTTACAGGGGTCTAGG - Intergenic
1133419721 16:5635998-5636020 CAGCAGTTTTAGACTAGTCTGGG + Intergenic
1135069714 16:19341265-19341287 CAGGTGTTTGAAATGGGTCTTGG - Intergenic
1137572239 16:49574426-49574448 CAGCAGTTGTATGTGGGGCTGGG + Intronic
1137746516 16:50824466-50824488 CGCCAGCATTACATGGGTCTGGG + Intergenic
1140654579 16:77126282-77126304 CAGCTGTTCTACATGGATCCTGG + Intergenic
1140938492 16:79698466-79698488 CAGCTGTTTTCCATTGCTCTTGG + Intergenic
1141884459 16:86882301-86882323 CACCAGTCTTGCCTGGGTCTTGG - Intergenic
1143460171 17:7098412-7098434 TAGAAGTTTTACAGGGCTCTAGG - Intergenic
1144216547 17:13060204-13060226 CAGAAGTTGTACATGGCTTTTGG + Intergenic
1148477474 17:47938518-47938540 CAGCAGTATTACATGTCTCCAGG + Intergenic
1149018332 17:51934433-51934455 CAAAAGTCTTACAGGGGTCTTGG - Intronic
1151136240 17:71948244-71948266 GAGCAGATTAACATGGGTCCTGG + Intergenic
1151574447 17:74945162-74945184 CAGTAGTTTGAGATGAGTCTGGG - Intronic
1153180753 18:2430126-2430148 CAGGAGTTTGAGATCGGTCTAGG - Intergenic
1154017696 18:10634637-10634659 CAGCAGTTTGACAGGGGTTGTGG - Intergenic
1154187169 18:12194961-12194983 CAGCAGTTTGACAGGGGTTGTGG + Intergenic
1155333287 18:24739583-24739605 GAGCAGGTTAACTTGGGTCTGGG + Intergenic
1156249506 18:35338919-35338941 CTGCAGTTTTACATGTTTCATGG - Intronic
1156868057 18:41910735-41910757 CAGGAATTAGACATGGGTCTTGG - Intergenic
1158073644 18:53503139-53503161 CAGCAGTTTTACATGGGTCTAGG + Intronic
1158774298 18:60557643-60557665 CAGAAGTCTAAAATGGGTCTGGG + Intergenic
1162649029 19:12071206-12071228 CAGCAGTTTCACATGTATCATGG - Intronic
1165838222 19:38772012-38772034 CAGCAGGTTTACATGGAACCTGG + Exonic
1165841341 19:38790685-38790707 CAGCAGGTTTACATGGAACCTGG - Exonic
1165952982 19:39484929-39484951 CAGCAGATTTACATGTATGTGGG + Intronic
1168023259 19:53625259-53625281 CAGGAGTTTGAGATGAGTCTGGG - Intergenic
927358965 2:22209129-22209151 CTACATTTTTACATGGGTGTAGG - Intergenic
928623094 2:33110935-33110957 AAGCAGTTTTTCCTGGGTTTTGG + Intronic
932501096 2:72183288-72183310 CTGCCTTTTTATATGGGTCTTGG + Intronic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
938471522 2:131566986-131567008 CAGCAGTGTAACATTTGTCTTGG - Intergenic
939608153 2:144277397-144277419 CAAAATTTTTGCATGGGTCTAGG + Intronic
941189948 2:162369123-162369145 CAGCAGTTCAACCTGGCTCTCGG + Intronic
943070366 2:183134531-183134553 CGGAAGTTTGAAATGGGTCTTGG + Intronic
944553839 2:200868996-200869018 CAGGAGTTTTAGATCGGCCTGGG - Intergenic
945212343 2:207396714-207396736 AAGCATTTTTATATGGGACTTGG - Intergenic
947578969 2:231299830-231299852 CTGGAGGTTTAAATGGGTCTGGG - Intronic
1169686761 20:8283231-8283253 CACCAATTTTACATGGGCATAGG - Intronic
1177874310 21:26612149-26612171 CAGCAATTTTCCAAGGCTCTAGG + Intergenic
1179264387 21:39790074-39790096 CAGCAATTTGACCGGGGTCTAGG - Intronic
1184637187 22:45842230-45842252 CATGAGGTTTACATGGCTCTTGG + Intronic
949304402 3:2623422-2623444 CAGCAGTTTTACCTAGGCTTTGG + Intronic
952310365 3:32183455-32183477 CAGCAGTTTTGCAAAAGTCTGGG + Intergenic
952714877 3:36470582-36470604 CATCAGTTTTTCATGTGTCAGGG + Intronic
953261118 3:41339820-41339842 CAACAGTAATAGATGGGTCTTGG - Intronic
953348886 3:42199546-42199568 CAGCAGTATTACTTGAGCCTAGG - Intronic
953527597 3:43706660-43706682 CAGGAGTTTGACATTGGCCTGGG - Intronic
955680504 3:61495579-61495601 CAGAAGTTTCACATTGGTATTGG - Intergenic
956141903 3:66154689-66154711 CAGCAGTTTGAGATGAGCCTGGG - Intronic
962578301 3:136774532-136774554 CAGGAGTTTGACATCAGTCTGGG - Intergenic
964304017 3:155321528-155321550 CAGCTCTTTTCCATGGGTCTGGG - Intergenic
964306486 3:155346535-155346557 TAGCTCTTTTCCATGGGTCTGGG - Intergenic
966417583 3:179705211-179705233 TAGCAGTTTCCCATGTGTCTGGG - Intronic
966946605 3:184781228-184781250 CTGCAGTTGGAAATGGGTCTGGG + Intergenic
968045491 3:195622065-195622087 CTGCTGTTTTACTTGGGTCTGGG - Intergenic
968064287 3:195750086-195750108 CTGCTGTTTTACTTGGGTCTGGG - Intronic
968394620 4:223283-223305 CAGGAGTTTGAGATGAGTCTGGG + Intergenic
968678114 4:1896572-1896594 CAGCAGTTTGAGATGAGCCTGGG - Intronic
968690756 4:1988602-1988624 CAGCAGCTGTGCATGGATCTTGG - Intronic
969215341 4:5717612-5717634 CAGCAGTCTGTCGTGGGTCTTGG - Intronic
972850923 4:43049546-43049568 CAGAAATTTTAGATGAGTCTGGG + Intergenic
973070770 4:45855939-45855961 CAGCAGGTCTACAAGGCTCTGGG + Intergenic
973136495 4:46714269-46714291 AAGCACTTTGACATAGGTCTTGG - Intergenic
973136588 4:46715727-46715749 CATCAGCTTTTCTTGGGTCTTGG + Intergenic
974532286 4:63124401-63124423 CAGCAGTTTTATAAGGCTGTGGG - Intergenic
976164534 4:82240234-82240256 CAGCAGTTTGAGATCAGTCTAGG + Intergenic
976398921 4:84586015-84586037 CACCAGGTTTACAAGGGTTTGGG + Intronic
976503373 4:85817336-85817358 AAGCATTTTGACATTGGTCTGGG - Intronic
977933043 4:102769149-102769171 CAGCATTTTTTCATGTTTCTTGG - Intergenic
979526748 4:121725453-121725475 CAGGAGTTTGAGGTGGGTCTGGG + Intergenic
980214432 4:129833463-129833485 CATCACTTTCACATGTGTCTGGG - Intergenic
980458202 4:133072523-133072545 CAGCAATTTAACATGTATCTAGG - Intergenic
981487356 4:145301374-145301396 CATCAGGTTCCCATGGGTCTGGG - Intergenic
988772587 5:34447665-34447687 CAGCAGTCTGACATCGATCTGGG - Intergenic
994208222 5:97059734-97059756 GGGCAGGGTTACATGGGTCTGGG + Intergenic
994725136 5:103426616-103426638 AATGAGTTTTACATGGTTCTTGG + Intergenic
998904733 5:146892766-146892788 CAGAAGTTTTACATGTGCATTGG - Intronic
1001186265 5:169575979-169576001 CAGGAGTTGTAGAAGGGTCTTGG - Intergenic
1002973236 6:2046668-2046690 CAGCAGTTTGAGATCAGTCTGGG - Intronic
1005571942 6:27153758-27153780 CAGGAGTTTAACATGAGACTGGG + Intergenic
1008851584 6:56028610-56028632 TACCTGTTTTACTTGGGTCTTGG - Intergenic
1010045356 6:71436727-71436749 CAGCAAGTTTACCTGGCTCTGGG - Intergenic
1010181369 6:73090170-73090192 GAGCATTTTTTCATGTGTCTTGG + Intronic
1011585865 6:88924532-88924554 CAGGAGTTTGACACTGGTCTGGG - Intronic
1012069261 6:94591761-94591783 CAACAGTTTTACATGGATATTGG - Intergenic
1014035540 6:116764371-116764393 CAGCATTTTTACAAGGGATTGGG - Intronic
1014642505 6:123930029-123930051 CAAGAGTTGTACATTGGTCTTGG - Intronic
1015408893 6:132869689-132869711 CAGGAGTTTGAGATGGGGCTGGG - Intergenic
1015542695 6:134331842-134331864 CAGGAGTTTAAGTTGGGTCTGGG + Intergenic
1015548327 6:134385562-134385584 CACCCGTTTTAGATGGGTCATGG + Intergenic
1019512582 7:1425480-1425502 CAGGAGTTTGAGATGAGTCTGGG - Intergenic
1020044719 7:5032247-5032269 CAGGAGTTTGAGATGGGCCTGGG + Intronic
1020290072 7:6716269-6716291 CAGGAGTTTGAGATGGGCCTGGG + Intergenic
1022274950 7:28846195-28846217 CAGGACCTTTACATGGGGCTTGG - Intergenic
1022394099 7:29970182-29970204 CAGCAGTTTCCCAAGGCTCTTGG + Intronic
1022426296 7:30271926-30271948 CAGCAGTTTGAGACTGGTCTGGG + Intergenic
1024086986 7:45901873-45901895 CACCAGTTTTACTAGGGTGTAGG - Intergenic
1026580152 7:71608987-71609009 CAGGAGTTTGAGATGAGTCTGGG - Intronic
1026862627 7:73800930-73800952 GAGGAGTTTTAGATGAGTCTGGG + Intronic
1028047468 7:86141068-86141090 GAGCATTTTTTCATGTGTCTTGG - Intergenic
1028773499 7:94655275-94655297 CAGCTGTTTTAAATTGGTTTTGG + Intronic
1030615939 7:111738388-111738410 CAGCTCTTTTAAATAGGTCTAGG + Intronic
1031899942 7:127397581-127397603 GAGCATTTTTTCATGTGTCTTGG + Intronic
1032417143 7:131744541-131744563 CAGGCCTTTGACATGGGTCTTGG - Intergenic
1034460177 7:151193713-151193735 GAGGAGTTGTGCATGGGTCTGGG + Intronic
1035773285 8:2167270-2167292 GAGCATTTTTTCATGTGTCTTGG + Intergenic
1035827711 8:2661937-2661959 CAGCAGTTATACATGTGTACTGG - Intergenic
1039428599 8:37506937-37506959 TAGCAGTTTTACATGCTTCAAGG + Intergenic
1041688092 8:60662691-60662713 CAGCAGTTTGAGACCGGTCTGGG - Intergenic
1044421504 8:92001096-92001118 CAGCAGGTTCACATGGGCCCAGG + Intronic
1045332527 8:101167709-101167731 CAACAGTTTTAGCTGGGTTTGGG + Intergenic
1045553161 8:103190800-103190822 CAGCAATTTTACCAGGCTCTGGG - Intronic
1048786328 8:138054504-138054526 GAGCATTTTTTCATGTGTCTTGG - Intergenic
1049235263 8:141508960-141508982 ATGCTGTTTGACATGGGTCTTGG + Intergenic
1051915453 9:22201319-22201341 CAGCGGTTTTACAAGGCTGTTGG - Intergenic
1054819016 9:69503692-69503714 CAGGAGTTTTAGATGGTTTTAGG - Intronic
1055272313 9:74575039-74575061 AAGCAGTTTTTCAAGGGTTTAGG - Intronic
1055465898 9:76565709-76565731 CAGGAGTTTGAGATGAGTCTGGG - Intergenic
1055753209 9:79529843-79529865 CAGGAGGATTGCATGGGTCTAGG - Intergenic
1061383086 9:130270784-130270806 CAGGAGTTTGACATCGGCCTAGG - Intergenic
1185811397 X:3113748-3113770 CAGGAGTTTGAGATGGGCCTGGG - Intergenic
1186084766 X:5975099-5975121 CATCAGTTTTACATTGCCCTTGG - Intronic
1187286652 X:17911539-17911561 CTGCAGTTTTACATTTATCTAGG + Intergenic
1189995657 X:46634778-46634800 AAGCAGTGGGACATGGGTCTTGG - Intronic
1190774164 X:53539270-53539292 CAGCAGTTTGAGATCAGTCTGGG + Intronic
1193093513 X:77521227-77521249 CAGCAATTTTACATAGATGTTGG - Intronic
1193156930 X:78183705-78183727 CAGCAGGTCTACCTGGCTCTGGG - Intergenic
1195241673 X:102959234-102959256 CAGCAGTTCTGCATGTCTCTGGG - Intergenic
1195898157 X:109769670-109769692 CAGGAGTTTGAGATGAGTCTGGG + Intergenic
1196394249 X:115242310-115242332 GAGCATTTTTTCATGTGTCTTGG + Intergenic
1199335767 X:146617844-146617866 GAGCAGTTTTTCATGTTTCTTGG + Intergenic
1199938132 X:152597734-152597756 CAGCAGTGTGACAGGGGTCCTGG - Intergenic
1201368911 Y:13238649-13238671 GTGCAGTTTTACCTGGGACTGGG - Intergenic
1201511062 Y:14763725-14763747 CATCAGTTTTACATTGCCCTTGG + Intronic
1201861669 Y:18604550-18604572 CAGCAGTTTGAGATGAGCCTGGG + Intergenic
1201871654 Y:18715830-18715852 CAGCAGTTTGAGATGAGCCTGGG - Intergenic