ID: 1158075082

View in Genome Browser
Species Human (GRCh38)
Location 18:53518577-53518599
Sequence ATGGGCTAGCAGTGTGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158075082_1158075089 18 Left 1158075082 18:53518577-53518599 CCTGAGGCACACTGCTAGCCCAT No data
Right 1158075089 18:53518618-53518640 TTTTATTTTTTCCTCTTAGTGGG No data
1158075082_1158075088 17 Left 1158075082 18:53518577-53518599 CCTGAGGCACACTGCTAGCCCAT No data
Right 1158075088 18:53518617-53518639 TTTTTATTTTTTCCTCTTAGTGG No data
1158075082_1158075091 29 Left 1158075082 18:53518577-53518599 CCTGAGGCACACTGCTAGCCCAT No data
Right 1158075091 18:53518629-53518651 CCTCTTAGTGGGTCCTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158075082 Original CRISPR ATGGGCTAGCAGTGTGCCTC AGG (reversed) Intronic