ID: 1158075083

View in Genome Browser
Species Human (GRCh38)
Location 18:53518595-53518617
Sequence ATGGGCTGGAGTTCTGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158075083_1158075091 11 Left 1158075083 18:53518595-53518617 CCCATCTCAGAACTCCAGCCCAT No data
Right 1158075091 18:53518629-53518651 CCTCTTAGTGGGTCCTGCTGAGG No data
1158075083_1158075088 -1 Left 1158075083 18:53518595-53518617 CCCATCTCAGAACTCCAGCCCAT No data
Right 1158075088 18:53518617-53518639 TTTTTATTTTTTCCTCTTAGTGG No data
1158075083_1158075089 0 Left 1158075083 18:53518595-53518617 CCCATCTCAGAACTCCAGCCCAT No data
Right 1158075089 18:53518618-53518640 TTTTATTTTTTCCTCTTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158075083 Original CRISPR ATGGGCTGGAGTTCTGAGAT GGG (reversed) Intronic