ID: 1158075084

View in Genome Browser
Species Human (GRCh38)
Location 18:53518596-53518618
Sequence AATGGGCTGGAGTTCTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158075084_1158075089 -1 Left 1158075084 18:53518596-53518618 CCATCTCAGAACTCCAGCCCATT No data
Right 1158075089 18:53518618-53518640 TTTTATTTTTTCCTCTTAGTGGG No data
1158075084_1158075088 -2 Left 1158075084 18:53518596-53518618 CCATCTCAGAACTCCAGCCCATT No data
Right 1158075088 18:53518617-53518639 TTTTTATTTTTTCCTCTTAGTGG No data
1158075084_1158075091 10 Left 1158075084 18:53518596-53518618 CCATCTCAGAACTCCAGCCCATT No data
Right 1158075091 18:53518629-53518651 CCTCTTAGTGGGTCCTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158075084 Original CRISPR AATGGGCTGGAGTTCTGAGA TGG (reversed) Intronic