ID: 1158075084 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:53518596-53518618 |
Sequence | AATGGGCTGGAGTTCTGAGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1158075084_1158075089 | -1 | Left | 1158075084 | 18:53518596-53518618 | CCATCTCAGAACTCCAGCCCATT | No data | ||
Right | 1158075089 | 18:53518618-53518640 | TTTTATTTTTTCCTCTTAGTGGG | No data | ||||
1158075084_1158075088 | -2 | Left | 1158075084 | 18:53518596-53518618 | CCATCTCAGAACTCCAGCCCATT | No data | ||
Right | 1158075088 | 18:53518617-53518639 | TTTTTATTTTTTCCTCTTAGTGG | No data | ||||
1158075084_1158075091 | 10 | Left | 1158075084 | 18:53518596-53518618 | CCATCTCAGAACTCCAGCCCATT | No data | ||
Right | 1158075091 | 18:53518629-53518651 | CCTCTTAGTGGGTCCTGCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1158075084 | Original CRISPR | AATGGGCTGGAGTTCTGAGA TGG (reversed) | Intronic | ||