ID: 1158075085

View in Genome Browser
Species Human (GRCh38)
Location 18:53518609-53518631
Sequence AGGAAAAAATAAAAATGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158075085_1158075091 -3 Left 1158075085 18:53518609-53518631 CCAGCCCATTTTTATTTTTTCCT No data
Right 1158075091 18:53518629-53518651 CCTCTTAGTGGGTCCTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158075085 Original CRISPR AGGAAAAAATAAAAATGGGC TGG (reversed) Intronic