ID: 1158075085 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:53518609-53518631 |
Sequence | AGGAAAAAATAAAAATGGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1158075085_1158075091 | -3 | Left | 1158075085 | 18:53518609-53518631 | CCAGCCCATTTTTATTTTTTCCT | No data | ||
Right | 1158075091 | 18:53518629-53518651 | CCTCTTAGTGGGTCCTGCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1158075085 | Original CRISPR | AGGAAAAAATAAAAATGGGC TGG (reversed) | Intronic | ||