ID: 1158075086

View in Genome Browser
Species Human (GRCh38)
Location 18:53518613-53518635
Sequence TAAGAGGAAAAAATAAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158075086_1158075091 -7 Left 1158075086 18:53518613-53518635 CCCATTTTTATTTTTTCCTCTTA No data
Right 1158075091 18:53518629-53518651 CCTCTTAGTGGGTCCTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158075086 Original CRISPR TAAGAGGAAAAAATAAAAAT GGG (reversed) Intronic